γδT have functions of innate and adaptive immunity, with the potential to induce durable responses while being well-tolerated, with limited adverse effects, making it attractive as a tool for immunotherapy. γδT faces challenges as a frontline tool in clinical oncology, with limited response rates due to difficulties in reaching tumor sites with consistent cytotoxic activity and strength. Modulated Electro-hyperthermia (mEHT) is a loco-regional treatment, whereby energy-transmission from an electromagnetic field selectively targets the plasma membrane of tumor cells, inducing apoptosis and activating immune cells. We hypothesized that mEHT could enhance therapeutic effects by drawing γδT to tumor cells, while also rendering tumor cells to be more susceptible to cytotoxic effects. In this study, NOD/SCID mice harboring subcutaneous human HepG2 tumors were treated with intravenous injections of γδT after mEHT treatment. This method increased infiltration of γδT into the tumor site, significantly inhibiting tumor growth as compared to monotherapy with either modality. These data suggest that γδT could mediate a potent anti-tumor effect when combined with mEHT, and provide a strong rationale for combining these modalities in clinical application for cancer treatment.

MicroRNAs (miRNAs) play important roles in the control of HIV-1 infection. Here, we performed RNAseq profilings of miRNAs and mRNAs expressed in CD4+ T-lymphocytes upon HIV-1 infection. Our results reveal significant alterations of miRNAs and mRNAs expression profiles in infected relative to uninfected cells. One of the miRNAs markedly downregulated in infected cells is miRNA-26a. Among the putative targets of miRNA-26a are CD59 receptor transcripts, which are significantly upregulated in infected CD4+ T-cells. Addition of miRNA-26a mimics to CD4+ T-cells reduces CD59 at both mRNA and surface protein levels, validating CD59 as a miRNA-26a target. Consistent with the reported inhibitory role of CD59 in complement-mediated lysis (CML), knocking-out CD59 in CD4+ T-cells renders both HIV-1 infected cells and progeny virions more prone to antibody-dependent CML (ADCML). Addition of miRNA-26a mimics to infected cells leads to enhanced sensitivity of progeny virions to ADCML, a condition linked to a reduction of CD59 packaging into released virions. Lastly, HIV-1-mediated downregulation of miRNA-26a expression is shown to be dependent on integrated HIV-1 expression but does not involve viral accessory proteins. Overall, these results highlight a novel mechanism by which HIV-1 limits ADCML by upregulating CD59 expression via miRNA-26a downmodulation.

Acute and chronic graft versus host disease (a/cGVHD) are major complications of allogeneic stem cell transplantation and a frequent cause of non relapse-mortality. The treatment of a/cGVHD consists of steroid administration at full dose. In the case of aGVHD, around 60 % of patients with grade III/IV fails to respond (steroid-resistant, SR), requiring a second line therapy. Extracorporeal photopheresis (ECP) represents a good option for second line treatment, leading to multiorgan response in several patients. Here, we have evaluated the performances of a cytofluorimetric quality control of the first ECP procedure in 29 patients with severe SR aGVHD who underwent ECP. The quality control represents a check control of in vitro cell apoptosis/death induction in collected and irradiated CD3+ cells by ECP. Our analysis shows that in more than 70 % quality controls a relevant apoptotosis/death of CD3+ cells was observed after cell irradiation, as compared to non-irradiated controls. Albeit observed in a small patients’ series, the occurrence of relevant in vitro effect after ECP relates to less procedures and/or to a better survival on ECP. Age, disease, gender, aGVHD grade and time from transplant to the first ECP had not impact on ECP efficacy in this patients’ series.

Shigella and Salmonella have been implicated in neonatal sepsis, food poisoning, and bacteremia. Their increasing resistance to antibiotics has undermined treatment options, constituting a public health crisis. Also, the scarcity of new antibiotics in the development pipeline compounds multidrug-resistance (MDR). Hence, there is a need to potentiate antibiotics to mitigate resistance. This study leveraged riboflavin to re-sensitize fluoroquinolones and carbapenems against MDR Shigella and Salmonella spp. Disk diffusion, microbroth-dilution, chequerboard, and time-kill assays were used to determine resistance profiles and riboflavin-antibiotic activity. Biofilm-formation and bacterial viability (after riboflavin-antibiotic challenge) was determined with crystal-violet and Macrophage infection assays, respectively. Strains exhibited >80% resistance to fluoroquinolones and carbapenems, with 160–320 µg MIC ranges and 0.5–2 FIC, indicating no synergy. At 40–80 µg riboflavin, there was two-fold reduction in bacterial survival, with meropenem-riboflavin exhibiting significant reduction and FIC of 0.075 indicating high synergistic activity. Biofilm-formation was altered (from strong to weak phenotype) with 40 µg riboflavin-antibiotic treatment. There was a 40–70% reduction in bacterial survival in THP-1 cells treated with meropenem-riboflavin after 3 hours, and complete clearance between 24-48 hpi. Riboflavin potentiated fluoroquinolones and meropenem, leading to modulation of the host immune response for the clearance of the strains.

The positional cloning of single nucleotide polymorphisms (SNPs) of the neutrophil cytosolic factor 1 (Ncf1) gene, advocating that a low oxidative burst drives autoimmune disease, demands an understanding of the underlying molecular causes. A cellular target could be T cells, which have been shown to be regulated by reactive oxygen species (ROS). However, the pathways by which ROS mediate T cell signaling remain unclear. The adaptor molecule linker for activation of T cells (LAT) is essential for coupling T cell receptor-mediated antigen recognition to downstream responses, and it contains several cysteine residues that have previously been suggested to be involved in redox regulation. To address the possibility that ROS regulate T cell-dependent inflammation through LAT, we established a mouse strain with cysteine-to-serine mutations at positions 120 and 172 (LATSS). We found that redox regulation of LAT through C120 and C172 mediate its localization and phosphorylation. LATSS mice had reduced numbers of double-positive thymocytes and naïve peripheral T cells. Importantly, redox insensitivity of LAT enhanced T cell-dependent autoimmune inflammation in collagen-induced arthritis (CIA), a mouse model of rheumatoid arthritis (RA). This effect was reversed on an NCF1-mutated (NCF1m1j), ROS-deficient, background. Overall, our data shows that LAT is redox-regulated, acts to repress T cell activation, and is targeted by ROS induced by NCF1 in antigen-presenting cells (APCs).

Plant cells' ability to withstand abiotic stress is strongly linked to modifications in their mechanical characteristics. Nevertheless, the lack of a workable method for consistently tracking plant cell mechanical properties severely restricts our comprehension of the mechanical alterations in plant cells under stress. With Polyethylene Glycol (PEG6000), we created a drought-like environment, and we used the Double Resonator Piezoelectric Cytometry (DRPC) method to dynamically and non-invasively track changes in the stress (ΔS) created and viscoelasticity (storage modulus G' and loss modulus G") of protoplasts and suspension cells of rice during drought stress. The findings demonstrate that, rice suspension cells and protoplasts react mechanically differently to 5%–15% PEG6000 stress, implying distinct resistance mechanisms. However, neither of them can withstand 25% PEG6000 stress, they respond mechanically similarly to 25% PEG6000 stress. The results of DRPC are further corroborated by the morphological alterations of rice cells and protoplasts observed under an optical microscope. To sum up, the DRPC technique functions as a precise cellular mechanical sensor and offers novel research tools for the evaluation of plant cell adversity and differentiating between the mechanical reactions of cells and protoplasts under abiotic stress.

One of the G protein-coupled receptors, C-C chemokine receptor 5 (CCR5), is an important regulator for the activation of T and B lymphocytes, dendritic cells, natural killer cells, and macrophages. Upon binding to the ligands, CCR5 activates downstream signaling, which plays critical roles in the innate and adaptive immune response through the promotion of lymphocyte migration and the secretion of pro-inflammatory cytokines. Anti-CCR5 monoclonal antibodies (mAbs) have been developed and evaluated in clinical trials for tumors and inflammatory diseases. In this study, we developed novel mAbs for mouse CCR5 (mCCR5) using the N-terminal peptide immunization. Among the established anti-mCCR5 mAbs, C₅Mab-4 (rat IgG_2a, kappa) and C₅Mab-8 (rat IgG₁, kappa), recognized mCCR5-overexpressed Chinese hamster ovary-K1 (CHO/mCCR5) and an endogenously mCCR5-expressing cell line (L1210) by flow cytometry. The dissociation constant (K_D) values of C₅Mab-4 and C₅Mab-8 for CHO/mCCR5 were determined as 3.5 × 10⁻⁸ M and 7.3 × 10⁻⁹ M, respectively. Furthermore, both C₅Mab-4 and C₅Mab-8 could detect mCCR5 by western blotting. These results indicated that C₅Mab-4 and C₅Mab-8 are useful for detecting mCCR5 by flow cytometry and western blotting and provide a possibility to obtain the proof of concept in preclinical studies.

C-C motif chemokine receptor-8 (CCR8) belongs to class A of G protein-coupled receptors (GPCRs). CCR8 interacts with the specific chemokine ligand CCL1/I-309 in humans, which is produced by various cells, including tumor-associated macrophages and regulatory T cells (Treg). CCR8 is highly expressed on Treg and T-helper 2 (T_H2) cells recruited to the inflammation site and is implicated in allergy, asthma, and cancer progression. The CCR8⁺Treg has been suggested to be an important regulator in the immunosuppressive tumor microenvironment (TME); therefore, it has been desired to develop sensitive monoclonal antibodies (mAbs) for CCR8. This study developed a specific mAb for human CCR8 (hCCR8), which is useful for flow cytometry by employing the Cell-Based Immunization and Screening (CBIS) method. The established anti-hCCR8 mAb, C₈Mab-21, (mouse IgM, kappa) reacted with hCCR8-overexpressed Chinese hamster ovary-K1 (CHO/hCCR8) cells, TALL-1 (acute T lymphoblastic leukemia), CCRF-HSB2 (human T-lymphoblastic leukemia), and natural killer cells, which express endogenous hCCR8 by flow cytometry. Furthermore, C₈Mab-21 demonstrated a moderate binding affinity for CHO/hCCR8 and TALL-1 with a dissociation constant of 6.5×10^-8 M and 2.0×10^-8 M, respectively. C₈Mab-21, which was established by the CBIS method, could be a useful tool for analyzing the hCCR8-related biological response using flow cytometry.

Cell-culture meat is a novel concept to replace traditional meat produced from animals, and to satisfy rising food demands due to the world population growth. It is still a young field and requires to solve technical issues including cell sources and types, efficient culture for large scale production, taste and texture for customer satisfaction. The current review summarized traditional beef meat production and evaluation methods for customer satisfaction. In particular, serum biomarkers for beef meat evaluation are discussed, which can be applicated for cell-culture meat production.

CD44 is a type I transmembrane glycoprotein, which is associated with poor prognosis in various solid tumors. Since CD44 plays critical roles in tumor development by regulating cell adhesion, survival, proliferation, and stemness, it has been considered a target for tumor therapy. Anti-CD44 monoclonal antibodies (mAbs) have been developed and applied to antibody-drug conjugates and chimeric antigen receptor-T cell therapy. We previously developed anti‐pan-CD44 mAbs, C₄₄Mab-5 and C₄₄Mab-46, which can recognize both CD44 standard (CD44s) and variant isoforms. In the present study, a defucosylated mouse IgG_2a version of the anti-pan-CD44 mAbs (5-mG_2a-f and C₄₄Mab-46-mG_2a-f) was generated to evaluate the antitumor activities against CD44-positive cells. Both 5-mG_2a-f and C₄₄Mab-46-mG_2a-f recognized CD44s-overexpressed CHO-K1 (CHO/CD44s) cells and esophageal tumor cell line (KYSE770) in flow cytometry. Furthermore, both 5-mG_2a-f and C₄₄Mab-46-mG_2a-f could activate effector cells in the presence of CHO/CD44s cells and exhibited the complement‐dependent cytotoxicity against both CHO/CD44s and KYSE770 cells. Furthermore, the administration of 5-mG_2a-f and C₄₄Mab-46-mG_2a-f significantly suppressed CHO/CD44s and KYSE770 xenograft tumor development compared with the control defucosylated mouse IgG_2a. These results indicate that 5-mG_2a-f and C₄₄Mab-46-mG_2a-f could exert antitumor activities against CD44-positive cancers and could be a promising therapeutic regimen for tumors.

Reconstructing the Tree of Life remains a central goal in biology. Early methods, relying on small numbers of morphological or genetic characters, often yielded conflicting evolutionary histories, undermining confidence in the results. Investigations based on phylogenomics, which use hundreds to thousands of loci for phylogenetic inquiry, have provided a clearer picture of life's history, but certain branches remain problematic. To resolve difficult nodes on the Tree of Life, two recent studies tested the utility of synteny, the conserved collinearity of orthologous genetic loci in two or more organisms, for phylogenetics. Synteny exhibits compelling phylogenomic potential while also raising new challenges. We identify and discuss specific opportunities and challenges that bear on the value of synteny data and other rare genomic changes for phylogenomic studies. Synteny-based analyses of highly contiguous genome assemblies mark a new chapter in the phylogenomic era and the quest to reconstruct the Tree of Life.

The successful vaccination implies the induction of effective specific immune responses. We intend to find biomarkers among various immune cell subpopulations, cytokines and antibodies which could be used to predict the levels of specific antibody- and cell-mediated responses after measles-mumps-rubella vaccination. We measured 59 baseline immune status parameters (frequencies of 42 immune cell subsets, levels of 13 cytokines, immunoglobulins) before vaccination and 13 response variables (specific IgA and IgG, antigen-induced IFN-γ production, CD107a expression on CD8+ T lymphocytes, and cellular proliferation levels by CFSE dilution) 6 weeks after vaccination for 19 individuals. Statistically significant Spearman correlations between some baseline parameters and response variables were found for each response variable (p<0.05). Due to the low number of observations relative to the number of baseline parameters and missing data for some observations, we utilized three feature selection strategies to select potential predictors of the post-vaccination responses among baseline variables: (a) screening of the variables based on the correlation analysis, (b) supervised screening based on the information of changes of baseline variables at day 7, (c) implicit feature selection is performed using regularization-based sparse regression. We identified optimal multivariate liner regression models for predicting the effectiveness of vaccination against measles-mumps-rubella using the baseline immune status parameters. It turned out that the sufficient number of predictor variables ranges from one to five depending on the response variable of interest.

Few-layer graphene oxide (GO) has shown none or very weak cytotoxicity and anti-proliferative effects in a wide range of cell lines such as glyoma cells and human skin HaCaT cells, in concentrations up to 100 µg/mL However, multi-layer GO has been hardly explored in the biomedical field. Thus, multi-layer GO was examined here in human keratinocyte HaCaT cells treated with different concentrations ranging from 0.01 to 150 µg/mL during different periods of times (3, 12 and 24 hours). The results of this study showed a time-concentration dependence with two non-cytotoxic concentrations (0.01 and 0.05 µg/mL) and a median effective concentration value of 4.087 µg/mL at 24 hours of GO exposure. Contrary to what has been reported for few-layer GO, cell proliferation of the HaCaT cells in contact with the multi-layer GO at 0.01 μg/mL showed identical proliferative activity compared to an epidermal growth factor (1.6-fold greater than the control group) after 96 hours. The effects of the multi-layer GO on the expression of 13 genes (SOD1, CAT, MMP1, TGFB1, GPX1, FN1, HAS2, LAMB1, LUM, CDH1, COL4A1, FBN and VCAN) at the non-cytotoxic concentrations of GO in the HaCaT cells were analyzed after 24 hours. Thus, the lowest non-cytotoxic GO concentration was able to up-regulate the CAT, TGFB1, FN1 and CDH1 genes, which confirms the great potential of multi-layer GO in the biomedical field.

Pulmonary hypertension (PH) is a progressive and potentially fatal complication of sickle cell disease (SCD) affecting 6-10% of adult SCD patients. Various mechanisms and theories have been evaluated to explain the pathophysiology of the disease. However, questions remain, particularly regarding the clinical heterogeneity of the disease in terms of symptoms, complications, and survival. Beyond the classical mechanisms that have been thoroughly investigated and include hemolysis, nitric oxide availability, endothelial disorders, thrombosis, and left heart failure, attention is focused nowadays on the potential role of the genes involved in such processes. Potential candidate genes are investigated through next-generation sequencing, with the TGF-β pathway being the initial target. This field of research may also provide novel targets for pharmacologic agents in the future as is already the case with idiopathic PH. The collection and processing of data and samples from multiple centers can yield safe results that will allow a better understanding of SCD-related PH as a part of the disease’s clinical spectrum. The following review attempts to capture the most recent findings of studies on gene polymorphisms that have been associated with PH in SCD patients.

Music has the innate potential to reach all parts of the brain, stimulates certain brain areas which are not achievable through other modalities. Music Therapy (MT) is being used for more than a century to treat individuals who needs personalized care. MT optimizes motor, speech and language responsibilities of the brain and improves cognitive performance. Pervasive developmentdisorder (PDD) is a multifaceted, neuro developmental disorder and autism spectrum disorder (ASD) comes under PDD, which is defined by deficiencies in three principal spheres: social connection with others, communicative and normal movement skills. The conventional imaging studies illustrate reduced brain area connectivity in people with ASD, involving selected parts of the brain cortex. People with ASD express much interest in musical activities which engages the brain network areas and improves communication and social skills.The main objective of this review is to analyze the potential role of MT in treating the neurological conditions, particularly ASD. Evidence based studies have reported the extensive therapeutic application of music on various part of the brain in a nonverbal child with autism through hearing or making music.Hence we hypothesized that MT intervention can improve the communication capacity in people with ASD, than customary neurorestoration therapy alone.

Vascular cell adhesion molecule-1 (VCAM-1) is closely associated with tumor progression and metastasis. However, the relevance and role of VCAM-1 in lung cancer have not been clearly elucidated. In this study, we found that VCAM-1 was highly overexpressed in lung cancer tissue compared with that of normal lung, and high VCAM-1 expression correlated with poor survival of lung cancer patients. VCAM-1 knockdown reduced invasion in A549 human lung cancer cells, and competitive blocking experiments targeting the Ig-like domain 6 of VCAM-1 (VCAM-1-D6) demonstrated that the VCAM-1-D6 domain was critical for VCAM-1-mediated A549 cell invasion. Next, we developed a human monoclonal antibody specific to human and mouse VCAM-1-D6 (VCAM-1-D6 huMab), which was isolated from a human synthetic antibody library using phage display technology. Finally, we showed that VCAM-1-D6 huMab had a nanomolar affinity for VCAM-1-D6 and that it potently suppressed invasion in A549 and NCI-H1299 lung cancer cell lines. Taken together, these results suggest that VCAM-1-D6 is a novel therapeutic target in VCAM-1-mediated lung cancer invasion and that our newly developed VCAM-1-D6 huMab will be a useful tool for inhibiting VCAM-1-expressing lung cancer cell invasion.

In agriculture, soil-borne fungal pathogens, especially Fusarium oxysporum strains, are posing a serious threat to efforts to achieve global food security. In the search for safer agrochemicals, silica nanoparticles (SiO2NPs) have recently been proposed as a new tool to alleviate pathogen damage including Fusarium wilt. Hollow mesoporous silica nanoparticles (HMSNs), a unique class of SiO2NPs, have been widely accepted as a desired pesticide carrier. However, their role in enhancing the disease resistance and the specific mechanism remain unknown. In this study, three sizes of HMSNs (19, 96 and 406 nm as HMSNs–19, HMSNs–96 and HMSNs–406, respectively) were synthesized and characterized to determine their effects on seed germination, seedling growth, and Fusarium oxysporum f. sp. phaseolus (FOP) suppression in cowpea roots by foliar spray using phenotypes, fresh biomass and disease progression as indicators. The results revealed that three HMSNs exhibited no adverse impacts on seed germination and tended to improve plant growth. Also, they exert their FOP suppression with a size- and concentration-dependent manner. HMSNs–406 possessed the best control effect at a concentration of 1000 mg/L showing an upto 40.00% decline in the disease severity. The Si(OH)4 control was also effective on FOP suppression at a lower concentration of 100 mg/L, whereas its higher concentrations exhibited obviously adverse impacts on FOP control, seed germination and plant growth. Moreover, we conformed that HMSNs posed their Fusarium wilt suppression in cowpea plant by activating SA (salicylic acid)-dependent SAR (systemic acquired resistance) responses rather than directly suppressing FOP. A higher level of SA content and elevated expression of its maker genes of PR-1 and PR-5 in HMSNs–406 treated cowpea roots provided substantial evidences of this mode of action. Other resistance-related genes, as well as defense-responsive enzymes, were also involved in the HMSNs-activated SAR pathway. Overall, for the first time, our results extended a new role of HMSNs as a potent elicitor to serve as a versatile alternative for plant disease protection of low cost, highly efficiency and sustainability.

In spite of prevalence gaps in several micronutrients supporting immune function, significance of their deficits/supplementation for efficacy of vaccines is underinvestigated. Thus, influence of supplementation combining vitamins C and D, zinc, selenium and manganese, and N-acetyl-cysteine on mouse IgG responses and underlying mechanisms to seasonal quadrivalent influenza vaccine (QIV) was investigated. QIV was given in two doses (28 days apart). The supplementation starting 5 days before the first injection increased the total serum IgG titre, through stimulation of germinal centre (GC) reaction in secondary lymphoid organs (SLOs), as indicated by increase in the frequency of GC B cells and follicular CD4+ T helper (Th) cells, and IL-21-producing Th cells. Additionally, the supplementation “optimized” IgG response following the second QIV injection by supporting more favorable (in respect to virus clearance) IgG2a response through favoring Th1 differentiation as indicating by Th1 (INF-γ) /Th2 (IL-4) signature cytokine level ratio upon QIV restimulation in SLO cell cultures. This most likely reflected partly their antioxidant action (as indicated by redox status analyses) on Th cell differentiation. Thus, the study forms solid base for further research aimed at repurposing use this safe and inexpensive micronutrient combination as an adjuvant for virus influenza vaccine.

Curcumin has attracted attention for its nontoxic chemopreventive effects; however, the specific pathways underlying its anticancer effects in colon cancer remain unclear. This study investigated the potential interplay between curcumin and integrin β1 in colon cancer. HCT116 and fibroblast cells were treated with curcumin, and cell proliferation was assessed using MTT assay and western blotting. We analyzed integrin β1 expression after curcumin treatment of HCT116 cells using western blotting and confocal microscopy. The roles of talin and rab25 in integrin β1 activation by curcumin were investigated using the same methods. Curcumin treatment significantly decreased the survival of HCT 116 cells but did not significantly affect the survival of fibroblast cells. Moreover, curcumin significantly increased integrin β1 expression in HCT 116 cells, which was primarily mediated by talin. In contrast, rab25 expression remained unchanged after curcumin treatment. Using rab25-specific siRNA knockdown experiments, we confirmed that curcumin increased integrin β1 expression even in the absence of rab25. Confocal microscopy revealed a dose-dependent increase in integrin β1 and talin expression, with consistent spatial distribution patterns in response to curcumin. This study highlights the clinical significance of curcumin as a selective anticancer agent in colon cancer by modulating integrin β1 expression through a talin-mediated pathway rather than through rab25.

Predominantly antibody deficiencies (PAD) represent the most common type of primary immu-nodeficiencies in humans, characterized by a wide variation in disease onset, clinical manifesta-tions, complications and outcome. Considering that the prevalence of PAD in Greece is unknown and there is limited knowledge on clinical and laboratory characteristics of affected patients, we conducted a nationwide study, including 153 patients (male/female: 66/87; median age: 43.0 years; range: 7.0-77.0) diagnosed and/or followed-up between April 2007 to September 2023. Furthermore, we classified our cohort into five Groups according to their medical history, im-munoglobulin levels, and CTLA4-mutational status: 123 had common variable immunodeficien-cy (CVID), 12 with CVID-like disease (with a history of a previous B-cell depletion immunother-apy for autoimmune or malignant disease), seven with combined IgA and IgG subclass deficien-cies, five with immune dysregulation syndrome and CTLA4 defects, and six with unclassified hypogammaglobulinemia. We demonstrated a remarkable delay of PAD diagnosis, several years after the onset of related symptoms (median: 9.0 years, range: 0-43.0). Family history of PAD was only 11.8%, with the majority of patients considered sporadic cases. Most patients were diag-nosed in the context of a diagnostic work-up for recurrent infections, or recurrent/resistant auto-immune cytopenias. Interestingly, ten patients (5.6%) had no history of infection, diagnosed due to either recurrent/resistant autoimmunity, or during a work-up of their medical/family history. Remarkable findings included an increased prevalence of lymphoproliferation (60.1%) and atopy (24.2%), while 39 patients (25.5%) developed bronchiectasis and 16 (10.5%) granulomatous dis-ease. Patients with CTLA4 defects displayed a variable clinical phenotype at diagnosis, with four patients diagnosed during a work-up of re-current infections, while one also displayed a massive splenomegaly. Cancer was a common complication in our cohort (25 patients, 16.3%), with B-cell malignancies representing the most common neoplasms (56.7%). Our findings indicate the necessity of awareness about PAD and their complications, aiming for early diagnosis and appropriate management of affected patients

Viruses can infect a cell via one or both routes viz. cell-to-cell (c-c) or cell-free (c-f) . Pathogenesis studies of various viruses, including HIV, have shown that c-c transmission yields a significantly higher infection magnitude than the c-f route. Expectedly, potent antibodies inhibited c-f infection more efficiently than with c-cell transmission. To achieve a one-step, synchronous infection cycle that provides amplified infection, we have studied a consistent and efficient c-c HIV infection model since 1992. H9 cells persistently infected with HTLV-IIIB (H3B cells) and uninfected target CD4+ lymphocyte line (HuT78) were mixed in a ratio of 1:4 respectively. We have recently used this model to produce HIV designer antigens that have been shown to elicit monoclonal as well as polyclonal specific antibodies against novel epitopes that are formed post virus-cell engagement, but prior to fusion. The model can be extended for HIV neutralizing antibody assays or drug inhibitors against high multiplicity of infection.

Background: In 80% of patients, COVID-19 presents as mild disease^1,2. 20% of cases develop severe (13%) or critical (6%) illness. More severe forms of COVID-19 present as clinical severe acute respiratory syndrome, but include a T-predominant lymphopenia³, high circulating levels of proinflammatory cytokines and chemokines, accumulation of neutrophils and macrophages in lungs, and immune dysregulation including immunosuppression⁴. Methods: All major SARS-CoV-2 proteins were characterized using an amino acid residue variation analysis method. Results predict that most SARS-CoV-2 proteins are evolutionary constrained, with the exception of the spike (S) protein extended outer surface. Results were interpreted based on known SARS-like coronavirus virology and pathophysiology, with a focus on medical countermeasure development implications. Findings: Non-neutralizing antibodies to variable S domains may enable an alternative infection pathway via Fc receptor-mediated uptake. This may be a gating event for the immune response dysregulation observed in more severe COVID-19 disease. Prior studies involving vaccine candidates for FCoV^5,6 SARS-CoV-1^7-10 and Middle East Respiratory Syndrome coronavirus (MERS-CoV) ¹¹ demonstrate vaccination-induced antibody-dependent enhancement of disease (ADE), including infection of phagocytic antigen presenting cells (APC). T effector cells are believed to play an important role in controlling coronavirus infection; pan-T depletion is present in severe COVID-19 disease³ and may be accelerated by APC infection. Sequence and structural conservation of S motifs suggests that SARS and MERS vaccine ADE risks may foreshadow SARS-CoV-2 S-based vaccine risks. Autophagy inhibitors may reduce APC infection and T-cell depletion^{12 13}. Amino acid residue variation analysis identifies multiple constrained domains suitable as T cell vaccine targets. Evolutionary constraints on proven antiviral drug targets present in SARS-CoV-1 and SARS-CoV-2 may reduce risk of developing antiviral drug escape mutants. Interpretation: Safety testing of COVID-19 S protein-based B cell vaccines in animal models is strongly encouraged prior to clinical trials to reduce risk of ADE upon virus exposure.

Dendritic cells (DCs) are the professional antigen-presenting cells that recognize and present antigens to naïve T cells to induce antigen-specific adaptive immunity. Among the T-cell subsets, T helper type 2 (Th2) cells produce the humoral immune responses required for protection against helminthic disease by activating B cells. DCs induce a Th2 immune response at a certain immune environment. Basophil, eosinophil, mast cells, and type 2 innate lymphoid cells also induce Th2 immunity. However, in the case of DCs, controversy remains regarding which subsets of DCs induce Th2 immunity, which genes in DCs are directly or indirectly involved in inducing Th2 immunity, and the detailed mechanisms underlying induction, regulation, or maintenance of the DC-mediated Th2 immunity against allergic environments and parasite infection. A recent study has shown that a genetic defect in DCs causes an enhanced Th2 immunity leading to a severe atopic dermatitis. We summarize the Th2 immune-inducing DC subsets, the genetic and environmental factors which involved in DC-mediated Th2 immunity, and current therapeutic approaches for Th2-mediated immune disorders. This review is to provide an improved understanding of DC-mediated Th2 immunity and Th1/Th2 immune balancing, leading to control over their adverse consequences.

Pteridophytes, represented by ferns and allies, are an important phytogenetic bridge between lower and higher plants (gymnosperms and angiosperms). Ferns have evolved independently of any other species in the plant kingdom being its secondary metabolism a reservoir of phytoconstituents characteristic of this taxon. The study of the possible medicinal uses of Polypodium vulgare L. (Polypodiaceae), PV, has increased particularly when in 2008 the European Medicines Agency published a monograph about the rhizome of this species. Thus, our objective is to provide scientific knowledge on the methanolic extract from the fronds of P. vulgare L., one of the main ferns described in the Prades Mountains, to contribute to the validation of certain traditional uses. Specifically, we have characterized the methanolic extract of PV fronds (PVM) by HPLC-DAD and investigated its potential cytotoxicity, phototoxicity, ROS production and protective effects against oxidative stress by using in vitro methods. Our results show that PVM is not cytotoxic against the different cell lines assessed, but we found potential cytoprotective and cellular repair activity in 3T3 fibroblast cells. This biological activity could be attributed to the high content of polyphenolic compounds; thus, this extract is positioned as a potential candidate for pharmaceutical uses.

Antler is the fastest growing tissue. Because is based on proto-oncogenes, to avoid the risk of cancer, antlers evolved strong anticancer mechanisms, and thus its extract (DVA) is effective also against the few human tumours studied so far. We assessed whether DVA is a general anticancer compound testing direct effects in cells of different tumours: glioblastoma (GBM), colorectal and breast cancer, and leukaemia. DVA reduced viability of tumour but not healthy cells. Mobility decreased at least at the longest test (72 h). Intraperitoneal/oral 200 mg DVA/kg administration in GBM xenograft mice for 28 d reduced tumour weight 66.3% and 61.4% respectively, and also spleen weight. In addition, tumours treated with DVA showed symptoms of liquefactive necrosis. Serum cytokines showed DVA up-regulated factors related with tumour fighting and down-regulated those related with inducing immune tolerance to the tumour. DVA shows general anticancer effects in the lines tested and, in GBM mice, also strong indirect effects apparently mediated by the immune system.

Cell-penetrating peptides (CPPs), a group of small peptides capable of promoting the transport of molecular cargo across the plasma membrane, have become important tools in promoting the cellular uptake of exogenously delivered macromolecules. GV1001, a peptide derived from a reverse-transcriptase subunit of telomerase (hTERT) and developed as a vaccine against various cancers, reportedly has unexpected CPP properties. Unlike typical CPPs, such as the HIV-1 TAT peptide, GV1001 enabled the cytosolic delivery of macromolecules such as proteins, DNA and siRNA via extracellular heat shock protein 90 (eHSP90) and 70 (eHSP70) complexes. The eHSP-GV1001 interaction may have biological effects in addition to its cytosolic delivery function. GV1001 was originally designed as a MHC class II-binding cancer epitope, but its CPP properties may contribute to its strong anti-cancer immune response relative to other telomerase peptide-based vaccines. Cell signaling via eHSP-GV1001 binding may lead to unexpected biological effects, such as direct anticancer or antiviral effects. In this review, we focus on the CPP effects of GV1001 bound to eHSP90 and ehsp70.

Duct-dependent lesions are classically divided into duct dependent pulmonary circulation which involves severe right sided obstructive lesions such as pulmonary atresia or critical stenosis, and duct dependent systemic circulation which is characterized by malformation of the left side of the heart, and whose severest spectrum is hypoplastic left heart syndrome. Dextro-transposition of the great arteries remains in gray zone between being included in some old classifications as a duct dependent pulmonary circulation lesion or a new category of duct-dependent or independent mixing lesion. We hypothesize that re-classifying duct dependent congenital defects into duct dependent perfusion and oxygenation offers a model to fit D-TGA into the same category of right sided obstructive lesions and reflects the clinical spectrum in a more comprehensive way.

Natural killer (NK) cells play a crucial role in innate immunity, particularly in combating infections and tumors. However, in hematological cancers, NK cells often exhibit impaired functions. Therefore, it is very important to activate its endosomal toll-like receptors (TLRs) as a potential strategy to restore its antitumor activity. We stimulate NK cells from the peripheral blood mononuclear cells from children with acute lymphoblastic leukemia and NK cells isolated, the NK cells were stimulated with specific TLR ligands (Poly I:C, Imiquimod, R848, and ODN2006) and evaluated changes in IFN-γ, CD107a, NKG2D, NKp44 expression, Granzyme B secretion, cytokine/chemokine release, and cytotoxic activity. Results revealed that Poly I:C and Imiquimod enhanced activation of both immunoregulatory and cytotoxic NK cells, increasing IFN-γ, CD107a, NKG2D, and NKp44 expression. R848 activated immunoregulatory NK cells, while ODN2006 boosted CD107a, NKp44, NKG2D, and IFN-γ secretion in cytotoxic NK cells. R848 also increased secretion of various cytokines/chemokines. Importantly, R848 and ODN 2006 significantly improved cytotoxicity against leukemic cells. Overall, TLR stimulation enhances NK cell activation, suggesting TLR8 (R848) and TLR9 (ODN 2006) ligands as promising candidates for antitumor immunotherapy.

As a part of our ongoing research on endophytic fungi, we have isolated a sesterterpene mycotoxin, fusaproliferin (FUS), from Fusarium solani strain associated with the plant Aglaonema hookerianum Schott. FUS showed rapid and sub-micromolar IC₅₀ against pancreatic cancer cell lines. Time dependent survival analysis and microscopy imaging showed rapid morphological changes in cancer cell lines 4 hours after incubation with FUS. This provides a new chemical scaffold that can be further developed to obtain more potent synthetic agents against pancreatic cancer.

IQGAP1 is a multi-functional scaffold protein. However, its role in B cell development and function is not known. Here, we demonstrate Iqgap1mice contained significantly increased numbers of B220+ B, B220+IgM pro/pre-B, and B220+IgM+ immature-B cells in the bone marrow. Here, we show IQGAP1 as the essential scaffold that regulates early B cell development and function. Iqgap1mice contained significantly increased numbers of B220+ B, B220+IgM pro/pre-B, and B220+IgM+ immature-B cells in the bone marrow. New-forming and follicular B cell numbers were increased, while the marginal zone B cell numbers were significantly reduced in the spleen of the Iqgap1mice. Lack of IQGAP1 reduced T-dependent and T-independent humoral responses. Mechanistically, the lack of IQGAP1 considerably decreased the phosphorylation of Mek1/2, Erk1/2, and Jnk1/2. B cells from Iqgap1mice failed to suppress IL-7R-mediated activation of Stat5a/b, an essential step for cell-cycle exit and initiate light-chain recombination, leading to a reduction in RS rearrangement frequency. Lack of IQGAP1 resulted in a significant reduction of IRF4 and IRF8 in BM B cells. Our study provides the first evidence that IQGAP1-based signalosome is essential for the development and functions of B cells.

In this study, the microbial strain was isolated from the humus soil to ferment Sophora flavescens and Eleutherococcus sessiliflorus extracts. The isolated microbial was identified as Bacillus genus by 16S rRNA sequence analysis. The fermented plant extracts exhibited the antifungal effects against four types of the plant pathogens such as P. carotorum, B. cinerea, C. fructicola Sau-3, and C. gloeosporioides according to incubation time. Especially, the fermented plant extracts showed the most active activities for Colletotrichum genus to inhibit mycelium growth. Metabolite changes in fermented S. flavescens and E. sessiliflorus extracts were confirmed through LC-Q-TOF/MS. Flavonoid and peptide derivatives were improved in fermented S. flavescens and E. sessiliflorus extracts compared to their unfermented one, respectively. This study suggested that the isolated Bacillus microbial fermentation could be a valuable tool in improving the bioactivity of S. flavescens and E. sessiliflorus extracts to have potential with more environmentally-friendly antifungal agents.

Vaccine-induced immune thrombotic thrombocytopenia (VITT) is a rare but severe adverse event that was first observed during the global vaccination campaign against SARS-CoV-2 infection, specifically in those receiving adenoviral vector-based vaccines for Coronavirus disease 2019 (COVID-19). VITT develops 4 to 42 days post-vaccination and is characterized by the development of platelet-activating anti-platelet factor 4 (PF4) antibodies, leading to thrombocytopenia and thrombosis at unusual sites. The rise in awareness and subsequent prompt recognition of VITT was paramount in reducing mortality. Moreover, as vaccination campaigns around the world continue, a better understanding of VITT not only has important clinical implications but is also crucial for future vaccine development. In this review, we summarize the clinical features, pathophysiology, and incidence rates of VITT as well as highlight other anti-PF4 antibody-mediated disorders of growing clinical significance.

Immunosorbent turnip vein clearing virus (TVCV) particles displaying the IgG-binding domains D and E of Staphylococcus aureus protein A (PA) on every coat protein (CP) subunit (TVCVPA) were purified from plants via optimized and new protocols. The latter used polyethylene glycol (PEG) raw precipitates, from which virions were selectively re-solubilized in reverse PEG concentration gradients. This procedure improved the integrity of both TVCVPA and the wildtype subgroup 3 tobamovirus. TVCVPA could be loaded with more than 500 IgGs per virion, which mediated the immunocapture of fluorescent dyes, GFP and active enzymes. Bi-enzyme ensembles of cooperating glucose oxidase and horseradish peroxidase were tethered together on the TVCVPA carriers by a single antibody type, with one enzyme conjugated chemically to its Fc region, and the other one bound as target, yielding synthetic multienzyme-complexes. In microtiter plates, the TVCVPA-displayed sugar-sensing system possessed a considerably increased reusability upon repeated testing, compared to the IgG-bound enzyme pair in the absence of the virus. A high coverage of the viral adapters was achieved also on Ta2O5 sensor chip surfaces coated with a polyelectrolyte interlayer, as a prerequisite for durable, TVCVPA-assisted electrochemical biosensing through modularly IgG-assembled sensor enzymes.

Despite successful vaccination efforts, the emergence of new SARS-CoV-2 variants poses ongoing challenges to control COVID-19. Understanding humoral responses concerning SARS-CoV-2 infections and their impact is crucial for developing future vaccines that are effective worldwide. Here, we identified 41 immunodominant linear IgG B-cell epitopes in its Spike glycoprotein with a SPOT synthesis peptide array probed with a pool of serum from hospitalized COVID-19 patients. Bioinformatics showed a restricted set of epitopes unique to SARS-CoV-2 compared to other coronavirus family members. Potential crosstalk was also detected with Dengue virus (DENV), confirmed by screening individuals infected with DENV before the COVID-19 pandemic in a commercial ELISA assay for anti-SARS-CoV-2 antibodies. Higher reactivity indices were often measured in individuals with a pre-pandemic dengue infection than those with COVID-19. A high-resolution evaluation of antibody reactivity against peptides representing epitopes in the spike protein identified ten sequences in the NTD, RBD, and S2 domains. Functionally, antibody-dependent enhancement (ADE) in SARS-CoV-2 infection of monocytes was observed with pre-pandemic dengue-positive sera. A significant increase in viral load was measured compared to controls, with no detectable neutralization or considerable cell death, suggesting its role in viral entry. This study highlights the importance of identifying the epitopes generated during the humoral response to a pathogenic infection to understand the potential interplay of previous and future conditions on disease. Vaccine development and optimization strategies should be mindful of the potential for A.D.E. that could differ geographically due to endemic biological risks.

Multiple Myeloma (MM) is one of the incurable types of cancer in plasma cells. While immense progress has been made in the treatment of this malignancy, a large percentage of patients were unable to adapt to such therapy. Additionally, these therapies might be associated with significant diseases and are not always tolerated well in all patients. Since cancer in plasma cells has no cure, patients develop resistance to treatments, resulting in R/R MM. BCMA is primarily produced on mature B cells. Its up-regulation and activation are associated with multiple myeloma in both murine and human models, indicating that this might be an effective therapeutic target for this type of malignancy. Additionally, BCMA's predictive value, association with effective clinical trials, and capacity to be utilized in previously difficult to observe patient populations, imply that it might be used as a biomarker for multiple myeloma. Numerous kinds of BCMA-targeting medicines have demonstrated antimyeloma efficacy in individuals with refractory/relapsed MM, including CAR T-cell treatments, ADCs, bispecific antibody constructs. Among these medications, CART cell-mediated BCMA therapy has shown significant outcomes in multiple myeloma clinical trials. This review article outlines CAR T cell mediated BCMA medicines have the efficiency to change the therapeutic pattern for multiple myeloma significantly.

Candida albicans as an opportunistic pathogen exploits the host immune system and causes a variety of life-threatening infections. The polymorphic nature of this fungus gives it tremendous advantage to breach mucosal barriers and cause a variety of oral and disseminated infections. Enterococcus faecalis, another opportunistic pathogen co-exists with C. albicans in several niches in the human body, including the oral cavity and gastrointestinal tract. However, interactions between E. faecalis and C. albicans on oral mucosal surfaces remain unknown. Here, for the first time, we comprehensively characterized the interactive profiles between laboratory and clinical isolates of C. albicans (SC5314 and BF1) and E. faecalis (OG1RF and 846) on an organotypic oral mucosal model. Our results demonstrated that the two species formed robust biofilms on the mucosal tissue surface with profound surface erosion and fungal invasion. Specifically, this effect was more pronounced in the laboratory isolates than in the clinical isolates. Notably, several genes of C. albicans involved in tissue adhesion, hyphal formation, fungal invasion, and biofilm formation were significantly upregulated in the presence of E. faecalis. This study highlights the strain-dependent cross-kingdom interactions between E. faecalis and C. albicans on oral mucosa, demonstrating the requisite to study more substrate-dependent polymicrobial interactions.

Given the accelerating scientific, clinical and consumer interest in highly-prevalent functional gastrointestinal disorders, appropriate therapeutic strategies are needed to address the many aspects of digestive dysfunction. Accumulating evidence for the crucifer-derived bioactive molecule, sulforaphane in upstream cellular defence mechanisms highlights its potential as a therapeutic candidate in targeting functional gastrointestinal conditions together with systemic disorders. This article catalogues the evolution of and rationale for a hypothesis that utilises multifunctional sulforaphane as the initial step in restoring the ecology of the gut ecosystem; it does this primarily by targeting the functions of intestinal epithelial cells. A growing body of work has identified the colonocyte as the driver of dysbiosis, so that targeting gut epithelial function could provide an alternative to targeting the microbes themselves for remediation of microbial dysbiosis. The hypothesis discussed herein has evolved over several years and is supported by case studies showing the application of sulforaphane in gastrointestinal disorders, related food intolerance and several systemic conditions. To our knowledge, this is the first time the effects of sulforaphane have been reported in a clinical environment where several of its key properties within the gut ecosystem appear to be related to its nutrigenomic effects on gene expression.

Indiana Vesiculovirus (IVV; formerly as Vesicular stomatitis virus and Vesicular stomatitis Indiana virus) causes a disease in livestock that is very similar to the foot and mouth disease thereby an outbreak may lead to significant economic loss. Long-read sequencing (LRS) -based approaches revealed a hidden complexity of the transcriptomes in several viruses already. This technique was utilized already for the sequencing of the IVV genome, but our study is the first for the application of this technique for the profiling of IVV transcriptome. Since LRS is able to sequence full-length RNA molecules, and thereby providing more accurate annotation of the transcriptomes than the traditional short-read sequencing methods. The objectives of this study were to assemble the complete transcriptome of using nanopore sequencing, to ascertain cell-type specificity and dynamics of viral gene expression and to evaluate host gene expression changes induced by the viral infection. We carried out a time-course analysis of IVV gene expression in human glioblastoma and primate fibroblast cell lines using a nanopore-based LRS approach and applied both amplified and direct cDNA sequencing, as well as cap-selection for a fraction of samples. Our investigations revealed that, although the IVV genome is simple, it generates a relative complex transcriptomic architecture. In this study, we also demonstrated that IVV transcripts vary in structure and exhibit differential gene expression patterns in the two examined cell types.

Cyclodextrin polymers have high applicability in pharmaceutical formulations due to better biocompatibility, solubility enhancement, loading capacity and controlled drug release than parent the cyclodextrins. The cytotoxicity and cell uptake of new cationic beta-cyclodextrin monomers and polymers were evaluated as suitable material for nasal formulations and their protective effects on cells exposed to hydrogen peroxide were studied. PC12 and CACO-2 cells were selected as the neuronal and epithelial type cells, respectively, to mimic the structure of respiratory and olfactory epithelia of the nasal cavity. All cationic beta-cyclodextrin polymers tested showed dose- and time-dependent toxicity; nevertheless, at 5 µM concentration and 60 min of exposure, the quaternary-ammonium-beta-cyclodextrin soluble polymer could be recognized as non-toxic. Based on these results, fluorescently labelled quaternary-ammonium-beta-cyclodextrin monomer and polymer were selected for uptake studies in CACO-2 cells. The monomeric and polymeric beta-cyclodextrins were internalized in the cytoplasm of CACO-2 cells; the cationic monomer showed higher permeability than the hydroxypropyl-beta-cyclodextrin, employed as comparison. Therefore, these cationic beta-cyclodextrins showed potential as excipients able to improve the nasal absorption of drugs. Furthermore, amino-beta-cyclodextrin and beta-cyclodextrin soluble polymers were able to reduce oxidative damage in PC12 and CACO-2 cells and thus could be studied as bioactive carriers or potential drugs for cells protection against oxidative stress.

The world is currently going through a serious pandemic of viral infection with SARS-CoV-2, a new isolate of coronavirus, resembling and surpassing the crisis that occurred in 2002 and 2013 with SARS and MERS, respectively. SARS-CoV-2 has currently infected more than 142,000 people, causing 5,000 deaths and reaching more than 130 countries worldwide. The very large spreading capacity of the virus clearly demonstrates the potential threat of respiratory viruses to human health, alarming governments around the world that preventive health policies and scientific research are pivotal to overcoming the crisis. Coronavirus disease 2019 (COVID-19) causes flu-like symptoms in most cases. However, approximately 15% of patients will need hospitalization, and 5% require assisted ventilation, depending on the cohorts studied. What is intriguing, however, is the higher susceptibility of elderly individuals, especially those who are more than 60 years old and have comorbidities, including hypertension, diabetes and heart disease. In fact, the death rate in this group may be up to 10-12%. Interestingly, children are somehow protected and not included as a risk group.Thus, here, we discuss some possibilities of molecular and cellular mechanisms by which elderly subjects may be more susceptible to severe COVID-19. In this sense, we raise two main points: i) increased ACE-2 expression in pulmonary and heart tissue of chronic angiotensin 1 receptor (AT1R) blocker users and hypertensive individuals and ii) antibody-dependent enhancement (ADE) after previous exposure to other circulating coronaviruses. We believe these are pivotal points for a better understanding of the pathogenesis of severe COVID-19 and must be addressed with attention by physicians and scientists in the field.

Regulatory T cells (Tregs) are major drivers behind immunosuppressive mechanisms and present a major hurdle for cancer therapy. Tregs are characterized by high expression of CD25, which is a potentially valuable target for Treg depletion to alleviate immune suppression. The preclinical anti-CD25 (αCD25) antibody, clone PC-61, has met with modest anti-tumor activity, due to its capacity to clear Tregs from circulation and lymph nodes but not those that reside in the tumor. Optimization of the Fc domain of this antibody clone has been shown to enhance intratumoral Treg depletion capacity. Here, we generated a stable cell line that produces optimized recombinant Treg depleting antibodies. A genome engineering strategy in which CRISPR-Cas9 was combined with homology directed repair (CRISPR-HDR) was utilized to optimize the Fc domain of the hybridoma PC-61 for effector functions by switching it from the original rat IgG1 to a mouse IgG2a isotype. In a syngeneic tumor mouse model the resulting αCD25-m2a antibody mediated effective depletion of tumor resident Tregs leading to a high effector T cell (Teff) to Treg ratio. Moreover, combination of the αCD25-m2a with αPD-L1 treatment augmented tumor eradication in mice, demonstrating the potential for αCD25 as a cancer immunotherapy.

Using a randomized, crossover approach, cyclists (N = 20, overnight fasted) engaged in three 75-km time trials while ingesting water (WAT) or carbohydrate (0.2 g/kg every 15 minutes) from bananas (BAN) or a 6% sugar beverage (SUG). Blood samples were collected pre-exercise and 0 h-, 1.5 h-, and 21 h-post-exercise, and analyzed for NK cytotoxicity activity (NKCA) using pure NK cell populations. The two carbohydrate trials (BAN, SUG) compared to WAT were associated with higher post-exercise glucose, and lower cortisol, total blood leukocyte, neutrophil, and NK cell counts (interaction effects, P < 0.001). The immediate post-exercise increase in NK cell counts was higher in WAT (78%) compared to BAN (32%) and SUG (15%) trials (P ≤ 0.017). The 1.5 h post-exercise decrease in NK cell counts did not differ after WAT (−46%), BAN (−46%), and SUG (−51%) trials. The pattern of change in post-exercise NKCA differed between trials (P < 0.001). The 1.5 h post-exercise decreases in NKCA were 23%, 29%, and 33% in the WAT, BAN, and SUG trials, respectively, but trial contrasts did not differ significantly. Carbohydrate ingestion from BAN or SUG attenuated immediate-post-exercise increases in leukocyte, neutrophil, and NK cell counts, but did not counter the 1.5-h decreases in NK cell counts and NKCA.

The microenvironment of most tumors is complex, comprising numerous aspects of immunosuppression. Several studies have indicated that the adrenergic system is vital for controlling immunological responses. In the context of tumor microenvironment, Nor-Adrenaline (NA) is poured-in by innervating nerves and tumor tissues itself. The receptors for nor-adrenaline are present on the surface of cancer and immune cells and are often involved in activation of pro-tumoral signaling pathways. β2-adrenergic receptor (β2-AR) is an emerging class of receptors that are capable of modulating the functioning of immune cells. β2-AR is reported to activate the regulatory immune cells and inhibit the effector immune cells. Blocking β2-AR increases activation, proliferation and cytokine release of T lymphocytes. Moreover β2-AR deficiency during metabolic reprograming of T cells increases mitochondrial membrane potential and biogenesis. In the view of available research data, immunosuppressive role of β2-AR in T cells presents it a targetable checkpoint in CAR-T cell therapies. In this review, we have abridged contemporary knowledge about adrenergic stress mediated β2-AR activation on T lymphocytes inside tumor milieu.

Background/methods: For mechanistic studies, in vitro human B cell differentiation and generation of plasma cells are invaluable techniques. However, the heterogeneity of both T cell-dependent (TD) and T cell-independent (TI) stimuli and the disparity of culture conditions used in existing protocols makes interpretation of results challenging. The aim of the present study was to achieve the most optimal B cell differentiation conditions using isolated CD19⁺ B cells and PBMC cultures. We addressed multiple seeding densities, different durations of culturing and various combinations of TD stimuli and TI stimuli including B cell receptor (BCR) triggering. B cell expansion, proliferation and differentiation was analyzed after 6 and 9 days by measuring B cell proliferation and expansion, plasmablast and plasma cell formation and immunoglobulin (Ig) secretion. In addition, these conditions were extrapolated using cryopreserved cells and differentiation potential was compared. Results: This study demonstrates improved differentiation efficiency after 9 days of culturing for both B cell and PBMC cultures using CD40L and IL-21 as TD stimuli and 6 days for CpG and IL-2 as TI stimuli. We arrived at optimized protocols requiring 2500 and 25.000 B cells per culture well for TD and TI assays, respectively. The results of the PBMC cultures were highly comparable to the B cell cultures, which allows dismissal of additional B cell isolation steps prior to culturing. In these optimized TD conditions, the addition of anti-BCR showed little effect on phenotypic B cell differentiation, however it interferes with Ig secretion measurements. Addition of IL-4 to the TD stimuli showed significantly lower Ig secretion. The addition of BAFF to optimized TI conditions showed enhanced B cell differentiation and Ig secretion in B cell but not in PBMC cultures. With this approach, efficient B cell differentiation and Ig secretion was accomplished when starting from fresh or cryopreserved samples. Conclusion: Our methodology demonstrates optimized TD and TI stimulation protocols for more indepth analysis of B cell differentiation in primary human B cell and PBMC cultures while requiring low amounts of B cells, making them ideally suited for future clinical and research studies on B cell differentiation of patient samples from different cohorts of B cell-mediated diseases.

The Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was isolated in 2012 and is well known to cause the respiratory syndrome. The orf1ab gene is known to mediate MERS-CoV replication. In this study, we have discussed the in silico prediction of potential siRNAs targeting MERS-CoV-orf1ab gene for antiviral therapeutics. To identify the potential siRNAs, various factors were considered. We have excluded the siRNAs with off-target effects and potential binding with human mRNAs. By using available softwares, total twenty-one functional, off-target reduced potential siRNA were selected from four hundred and sixty-two siRNAs based on greater potency and specificity. We have tested only seven siRNAs initially to evaluate their performance by reverse transfection approach by lipofectamine mediated delivery in Vero cells. The evaluation results showed no cytotoxicity at various concentrations of siRNAs used. The results obtained in this study provided preliminary information about the cytotoxicity which will help us to further evaluate siRNAs in other cell cultures to find out the replication inhibition efficiency of MERS-CoV. Finally, it is concluded that the in silico prediction and designing resulted in filtration and selection of potential siRNAs with high accuracy, efficiency, and strength which can be further utilized for the development of oligonucleotide-based therapeutics.

Formaldehyde, sulfuric acid and salicylic acid were combined to create 3,3’-methylenebis[2-hydroxybenzoic acid] (MHB) ligand, which was subsequently permitted to bind with zinc ions. The ligand and its zinc (II) complex (Zn-MHB) have been described by a combination of elemental analyses, spectral (UV-Vis, IR, MS, NMR), XRD, TEM as well as TGA measurement. The ligand has been suggested to coordinate to the zinc center in tetradentate manner forming binuclear tetrahedral complex. An X-ray analysis indicated a considerable difference between MHB (crystalline) and Zn-MHB (amorphous). UV-Vis spectra were used to determine the optical properties such as bandgap, refractive index, optical conductivity and penetration depth. Possibility of employing the samples for optoelectronic applications was indicated from the band gap values which underlie the range of semiconductors. TEM revealed spherical shapes and mutation of ligand particles into nano-scale by complexation. The antimicrobial potential of the MHB towards gram-positive and negative bacterial growths has been investigated. The results suggested that it would be possible to employ MHB to stop bacterial development, particularly salmonella typhimurium. Cytotoxicity of the MHB was assessed against two types of mammalian cells: VERO (the kidney of an African green monkey) and HFB4 (human skin melanocytes). Lower sensitivity was observed in VERO cells.

Beta-thalassemia major (β-TM) is a severe form of thalassemia caused by mutations in the β-globin gene, resulting in partial or complete deficiency of β-globin chains. This deficiency results in oxidative stress, dyserythropoiesis, and chronic anemia. Cytokine dependent hematopoietic cell linker (CLNK) belongs to the adaptor protein family and has the capacity to interact with multiple signaling proteins thereby modulating signal transduction. The aim of the present study was to examine CLNK in sera of β-TM patients and examine its association with iron overload biomarkers. Sixty β-TM patients, aged 3–12 years old and undergoing blood transfusions, and 30 healthy control children were recruited and CLNK, ferritin and iron status parameters were measured. The results showed a significant increase (p < 0.001) in serum CLNK levels in β-TM patients as compared with normal controls. The increased levels of CLNK were significantly associated with increased ferritin levels. Increased CLNK levels in β-TM may be explained by reciprocal effects between immune signaling and immature erythrocytes, which, release soluble receptors and signaling molecules, including CLNK, in the blood.

The present work encompasses an application-oriented perspective to the possible employment of gold nanoparticles as nanomedicine in cancer therapeutics. The rationale of the work lies in the growing needs for assessment of advanced alternative treatment of cancer employing functionalized nanoparticles as nanomedicine. Gold nanoparticles fabricated via green chemistry methods by leaves of a time-honored medicinal plant, Piper betle were ascertained for their synthesis and properties under the umbrella of characterization of nanoparticles, through various techniques like UV-vis spectroscopy, FTIR spectroscopy, X-ray diffraction, and scanning electron microscopy. The cytotoxicity assay of well-characterized gold nanoparticles was monitored against lung cancer cell line (A549) by metabolic and imaging assays. MTT assay or the metabolic assay was performed for a range of nanoparticles’ concentrations. The results were promising and proved to be a leading-edge venture, envisaging the possibility of gold nanoparticles for cancer therapeutics.

Knowledge is not merely the characteristic of certain pieces of information being deemed true and justifiable, but rather a process. Within an axiomatic system, the set of information that reaches the status of knowledge forms a universe that provides an interpretation of the reality one aims to describe. Language exchanges information through communication and the process of justification (exchange of information), if it consistently justifies a particular piece of information, it elevates it to knowledge. In this paper, we provide a framework for knowledge within an axiomatic model where we define the fundamental elements of communication and grammar. As a result, the structure dictates that knowledge, to be considered as such, must be investigateable by anyone who utilizes it in its entirety, both in form and content. Ultimately, the development of knowledge processing, referred to as \emph{knowmatics}, represents a clear evolution of the computer science that processes information (subset of knowledge).

Background: Barleria lupulina Lindl. (Hop-headed) is a small shrub, possess potent anti-inflammatory, analgesic, anti-leukemic, antitumor, anti-hyperglycemic, anti-amoebic, virucidal, diuretic, bactericidal and antibiotic properties. Methods: Cytotoxicity, bioactive assay and genetic analysis of B. lupulina were investigated in the present communication. The leaf extract was investigated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), Neutral red uptake (NRU), DNA fragment, reactive oxygen species (ROS) generation, mitochondrial membrane potential (MMP) assay, gene expression analysis and cDNA synthesis to evaluate anti-cancerous potency using cancerous THP-1 cell lines in vitro and in vivo. Results: HPTLC analysis reveals four spots and GC-MS analysis displayed the presence of eleven bioactive compounds among which benzofuranon, hexadecanoic acid, ethyl 9,12,15-octadecatrienoate, and 3,7,11,15-tetramethyl-2-hexadecanoic acid were the most prominent compounds. The ethanolic extract showed significant cytotoxicity (P<0.5) against THP-1 cell line at a concentration of 1mg/mL. The cells were also observed for apoptosis through DNA fragmentation in B. lupulina treated cells. Conclusions: It can be concluded that if the dose range was further refined within the range of 100-1000 µg/mL there could be dose at which the entire population of the THP-1 cell line would be apoptosis induced. The extract induced ROS in the cells after 30 minutes of exposure displaying cytotoxic effects and DNA fragmentation assay.

The MAP kinase ERK5 contains an N-terminal kinase domain and a unique C-terminal tail including a nuclear localization signal and a transcriptional activation domain. ERK5 is activated in response to growth factors and stresses, and regulates transcription at the nucleus by either phosphorylation or interaction with transcription factors. MEK5-ERK5 pathway plays an important role regulating cancer cell proliferation and survival. Therefore, it is important to define the precise molecular mechanisms implicated in ERK5 nucleo-cytoplasmic shuttling. We previously described that the molecular chaperone Hsp90 stabilizes and anchors ERK5 at the cytosol, and that ERK5 nuclear shuttling requires Hsp90 dissociation. Here, we show that MEK5 or Cdc37 overexpression -mechanisms that induce nuclear ERK5- induced ERK5 SUMO-2 modification at residues Lys6/Lys22 in cancer cells. We also show that overexpression of the SUMO protease SENP2 completely abolished endogenous ERK5 nuclear localization in response to EGF stimulation. Furthermore, mutation of these SUMO sites abolished the ability of ERK5 to translocate to the nucleus and to promote prostatic cancer PC-3 cell proliferation. These results allow us to propose a more precise mechanism: in response to MEK5 activation, ERK5 SUMOylation favors the dissociation of Hsp90 from the complex, allowing ERK5 nuclear shuttling and activation of transcription.

Hepatocellular carcinoma (HCC) is a heterogeneous malignancy with complex carcinogenesis. Although there has been significant progress in the treatment of HCC over the past decades, drug resistance to chemotherapy remains a major obstacle in its successful management. In this study we were able to reduce chemoresistance in cisplatin-resistant HepG2 cells by either silencing the expression of transglutaminase type 2 (TG2) using siRNA or by pre-treatment of cells with the TG2 enzyme inhibitor cystamine. Further analysis revealed that, whereas the full-length TG2 isoform (TG2-L) was almost completely cytoplasmic in its distribution, the majority of the short TG2 isoform (TG2-S) was membrane-associated in both parental and chemoresistant HepG2 cells. Following induction of cisplatin toxicity in non-chemoresistant parental cells, TG2-S together with cisplatin quickly relocated to the cytosolic fraction. Conversely, no cytosolic relocalisation of TG2-S or nuclear accumulation cisplatin was observed following identical treatment of chemoresistant cells, where TG2-S remained predominantly membrane-associated. This suggests that deficient subcellular relocalisation of TG2-S from membranous structures into the cytoplasm may limit the apoptic response to cisplatin toxicity in chemoresistant cells. Structural analysis of TG2 revealed the presence of binding motifs for interaction of TG-S with the membrane scaffold protein LC3/LC3 homologue that could contribute to a novel mechanism of chemotherapeutic resistance in HepG2 cells.

Proteins need to be located in appropriate spatiotemporal contexts to carry out their diverse biological functions. Mislocalized proteins may lead to a broad range of diseases, such as cancer and Alzheimer’s disease. Knowing where a target protein resides within a cell will give insights into tailored drug design for a disease. As the gold validation standard, the conventional wet lab uses fluorescent microscopy imaging, immunoelectron microscopy, and fluorescent biomarker tags for protein subcellular location identification. However, the booming era of proteomics and high-throughput sequencing generates tons of newly discovered proteins, making protein subcel-lular localization by wet-lab experiments a mission impossible. To tackle this concern, in the past decades, artificial intelligence (AI) and machine learning (ML), especially deep learning methods, have made significant progress in this research area. In this article, we review the latest advances in AI-based method development in three typical types of approaches, including sequence-based, knowledge-based, and image-based methods. We also elaborately discuss existing challenges and future directions in AI-based method development in this research field.

Abstract: Malaria transmission intensity affects the development of naturally acquired immunity to malaria. An absolute correlate of protection against malaria is lacking. However, anti-body-mediated functions against P. falciparum correlate with protection against malaria. In children, antibody-mediated functions against P. falciparum generally decline with a reduction in exposure; however, it is unclear whether adults maintain antibody-mediated functions in the context of re-duced exposure. This study assessed antibody-dependent respiratory burst (ADRB) in individuals from an area with declining malaria transmission. In an age-matched analysis, we compare ADRB activity during high versus low malaria transmission periods. Age significantly predicted higher ADRB activity in both the high and low malaria transmission periods. Within all age categories, ADRB activity was higher during the high compared to the low malaria transmission period, with only the adults during the high malaria transmission period having their mean ADRB activity above the ADRB cut-off. Interestingly, ongoing P. falciparum infection influenced ADRB activity during the low but not the high malaria transmission period. These findings propose that naturally acquired immunity to P. falciparum is affected in children and adults as malaria transmission declines, im-plying that vaccines will be necessary to induce and maintain protection against malaria.

PG9, PG16, PGT121, and PGT145 antibodies were identified from culture media of activated memory B-cells of an infected donor and shown to neutralize many HIV-1 strains. Since HIV-1 spreads via both free virions and cell-cell fusion, we examined the effect of the antibodies on HIV-1 Env-mediated cell-cell fusion. Clone69TRevEnv cells that express Env in the absence of tetracycline were labeled with Calcein-AM Green, and incubated with CD4+ SupT1 cells labeled with CellTrace™ Calcein Red-Orange, with or without antibodies. Monoclonal antibodies PG9, PG16, 2G12, PGT121, and PGT145 (at up to 50 µg/mL) had little or no inhibitory effect on fusion between HIV-Env and SupT1 cells. By contrast, Hippeastrum hybrid agglutinin completely inhibited fusion. Our results indicate that transmission of the virus or viral genetic material would not be inhibited by these broadly neutralizing antibodies. Thus, antibodies generated by HIV-1 vaccines should be screened for their inhibitory effect on Env-mediated cell-cell fusion.

Pituitary adenylate cyclase-activating polypeptide receptor 1 (PAC1-R) has a higher affinity for pituitary adenylate cyclase- activating polypeptide (PACAP) than for vasoactive intestinal peptide (VIP). PACAP exerts its neuroprotective effects through PAC1-R. PAC1-R has become a target for drug development, and we targeted PAC1-R to screen small positive allosteric modulator 1 (SPAM1). SPAM1 has a neuroprotective effects, and in the D-galactose (D-gal) mouse model, SPAM1 improved the structure of the hippocampal dentate gyrus and restored the number of neurons. Compared with D-gal model mice, SPAM1 treatment upregulated the expression of Sirtuin 6 (SIRT6) and Lamin B1, and downregulated the expression of YinYang 1 (YY1) and p16. Consistent with this, the same results were obtained in senescent RGC-5 cells. Meanwhile, SPAM1 was also found to up-regulate SIRT6 and down-regulate YY1 expression in normal RGC-5 cells. Then, we further explored the mechanism of SPAM1 neuroprotection by whole transcriptome sequencing and proteomic analysis, and found that SPAM is involved in the longevity regulating pathway, and confirmed the up-regulation of neurofilament light polypeptide and neurofilament medium polypeptide by western blot, thus laying a pharmacological foundation for SPAM1 as a therapeutic agent for neurodegenerative diseases. polypeptide and neurofilament medium polypeptide. Thus, it lays a pharmacological foundation for SPAM1 as a therapeutic drug for neurodegenerative diseases.

Nanoparticles have been used as a novel drug delivery system. Drug-incorporated nanoparticles for local delivery might optimize the efficacy and minimize the side effects of drugs. The efficacy and safety of intratracheal administration of prostacyclin analog (beraprost)-incorporated nanoparticles and imatinib, a PDGF-receptor tyrosine kinase inhibitor, -incorporated nanoparticles in Sugen-hypoxia-normoxia or monocrotaline rat models of PAH and in human PAH-pulmonary arterial smooth muscle cells have been reported. The use of inhaled drug-incorporated nanoparticles might be a novel approach for treatment of PAH.

In this work, we pursued the biological characterization of the venom of Montivipera born-muelleri, a viper from the Lebanese mountains. In relativity to its antibacterial potential, the in-hibitory effect of this venom on the F1F0-ATPase enzymes of Gram-positive Staphylocoocus epider-midis and Gram-negative Escherichia coli bacteria was examined. In order to determine the de-gree of cytotoxicity of the venom on the HCT116 human colon cancer cell lines, the biological MTT proliferation and cell viability test were implemented. After validation of the enzymatic F1F0-ATPase model by the spectrophotometric method, using quercetin as the reference ligand, re-sults revealed that M. bornmuelleri venom is able to inhibit the activity of the enzyme of these two bacteria with a concentration of the order of 100-150 µg/mL. In addition, a venom concentration of 10 µg/mL was sufficient to kill the totality of HCT116 cell lines cultivated in vitro. These data show that M. bornmuelleri venom is a mixture of diverse molecules presenting activities of interest and is a potential source to explore in order to discover new drug candidates.

A series of novel asymmetrical mono-carbonyl analogs of curcumin (AMACs) were synthesized and evaluated for cytotoxic activity using the brine shrimp lethality test (BSLT) and the methyl thiazolyl tetrazolium assay against Vero, HeLa, and MCF7 cell lines. The structures of the synthesized compounds were confirmed by Fourier transform infrared spectrophotometry (FTIR), ¹H-nuclear magnetic resonance (NMR), ¹³C-NMR, and mass spectral data. The results of the cytotoxicity evaluation showed that the synthesized compounds exhibited moderate to very high toxic activity in BSLT, requiring a concentration of 13.06–714.49 µg/mL to kill half the population. Most of the compound exhibited cytotoxic activity against HeLa cell lines, comparable to the activity of cisplatin with a concentration of the synthesized compounds required to inhibit 50% of the growth of the cell lines (IC₅₀) value of 40.65–95.55 µM, and most of the compounds tested against MCF7 cell lines exhibited moderate to very high cytotoxic activity (IC₅₀ value 7.86–35.88 µM). However, the selectivity index of the compounds was low, less than 1–1.96. Among the synthesized compounds, compound 1b showed the highest cytotoxicity and selectivity against MCF7 cell lines. Compound 1b could be considered for further development to obtain more active and selective chemotherapeutic agents against breast cancer.

Historically, macrophages have been long implicated in the control of the severity of infectious diseases. This has been based on the observations of a higher risk of severe disease and death upon rechallenge with viral variants due to antibody dependent enhance-ment (ADE) of infection into macrophages. The question remains as to what can account for this potent heterologous protection in macrophages? Here it is argued that the elusive defense mechanism of M1-like pro-inflammatory macrophages may pertain to a novel virus anti-virus response. This system initiates with high replication of human endogenous retrovirus K102 (HERV-K102), a non-pathogenic, protector foamy retrovirus of humans which generates M1-like pro-inflammatory foamy macrophages, glycolysis, and epigenetic changes, all characteristic of trained immunity. This virus-anti-virus system kills virally infected cells by several mechanisms, amplifies the innate interferon response via ‘viral mimicry’, has many unique components that interfere with exoge-nous virus replication, and may be especially adept at neutralizing enveloped exogenous pandemic viruses, such as SARS-CoV-2 and HIV-1. The goal of this treatise is to introduce the multifaceted HERV-K102 protector system, to illustrate how SARS-CoV-2 may target the HERV-K102 protector system by ADE, and to explore how this innate defense system may be exploited for pandemic preparedness.

Green synthesis of silver nanoparticles (AgNPs) using raw Whey has never been reported. Silver nanoparticle formation involves a reduction reaction of silver salt solution with Whey extract. Extract and metal salt concentrations, and temperature can control this reaction. In this work, incubation period, extract, AgNO3, and NaOH concentrations were used as the independent factors using central composite design under response surface methodology. The aim was to elucidate the influence these factors have on the measured UV-Vis absorption spectra fitted with a Voigt function, and to optimize the conditions for nanoparticle formation. The fitting parameters, peak wavelength (λ0), peak area (A), and Full Width at Half Maximum (FWHM), were the responses. Silver nanoparticle formation was only possible in an alkaline environment (pH 10). The peak wavelength and the FWHM are influenced mainly by extract and AgNO3 concentrations. In contrast, the peak area is influenced by a total of 33.54 % from the interaction terms of AgNO3 and extract concentrations with NaOH. Metallic AgNPs were formed for the following parameter ranges: a) Whey (0.4 – 1.6 % v/v), b) AgNO3 (0.15 – 0.6 mM), c) NaOH (10 – 50 mM), and d) Time (20 – 60 min). Silver oxide nanoparticles were also observed.

Intrahepatic cholangiocarcinoma (ICCA) is a malignant epithelial neoplasm characterized by biliary differentiation within the liver. ICCA is molecularly heterogeneous and exhibits a broad spectrum of histopathological features. It is a highly aggressive carcinoma with high mortality and poor survival rates. ICCAs are classified into two main subtypes: small duct type and large duct types. These two tumor types have different cell origins and clinicopathological features. ICCAs are characterized by numerous molecular alterations, including mutations in KRAS, TP53, IDH1/2, ARID1A, BAP1, BRAF, SAMD4, and EGFR, and FGFR2 fusion. Two main molecular subtypes–inflammation and proliferation–have been proposed. Recent advances in high-throughput assays using next-generation sequencing have improved our understanding of ICCA pathogenesis and molecular genetics. The diagnosis of ICCA poses a significant challenge for pathologists because of its varied morphologies and phenotypes. Accurate diagnosis of ICCA is essential for effective patient management and prognostic determination. This article provides an updated overview of ICCA pathology, focusing particularly on molecular features, histological subtypes, and diagnostic approaches.

Angiogenesis is a critical physiological response to ischemia but becomes pathological when dysregulated and driven excessively by inflammation. We recently identified a novel angiogenic role for tripartite-motif-containing protein 2 (TRIM2) whereby lentiviral shRNA-mediated TRIM2 knockdown impaired endothelial angiogenic functions in vitro. This study sought to determine whether these effects could be translated in vivo and to determine the molecular mechanisms involved. CRISPR/Cas9-generated Trim2–/– mice that underwent a periarterial collar model of inflammation-induced angiogenesis exhibited significantly less adventitial macrophage infiltration relative to wildtype (WT) littermates, concomitant with decreased mRNA expression of macrophage marker Cd68 and reduced adventitial proliferating neovessels. Mechanistically, TRIM2 knockdown in endothelial cells in vitro attenuated inflammation-driven induction of critical angiogenic mediators, including nuclear HIF-1α, and curbed the phosphorylation of downstream effector eNOS. Conversely, in a hindlimb ischemia model of hypoxia-mediated angiogenesis, there were no differences in blood flow reperfusion to the ischemic hindlimbs of Trim2–/– and WT mice despite a decrease in proliferating neovessels and arterioles. TRIM2 knockdown in vitro attenuated hypoxia-driven induction of nuclear HIF-1α but had no further downstream effects on other angiogenic proteins. Our study has implications for understanding the role of TRIM2 in the regulation of angiogenesis in both pathophysiological contexts.

Under the guidance of our previous achievements, and in order to extend this small molecular library. In current work, other 21 novel structures of thieno[2,3-d]pyrimidines containing isoxazole-moiety (1a-1u) were firstly synthesized and the cytotoxicity to A549, HCT116 and MCF-7 cell lines was evaluated using the MTT method. The results showed that most target compounds exhibited good to excellent cytotoxicity to A549, HCT116 and MCF-7 cell lines, especially 6-Methyl-4-{[3-(4-chlorophenyl)-isoxazol-5-yl-]-methoxy-}-thieno[2,3-d]-pyrimidine (1e) exhibited a broad-spectrum and the most potent cytotoxicity to A549, HCT116 and MCF-7 cell lines (IC50s: 2.79, 6.69 and 4.21×10^-3 μM, respectively) as compared with the reference drug gefitinib (IC50s: 17.90, 21.55 and 20.68 μM, respectively). 1e can be seen as the best drug candidates for development of anticancer drugs.

Ovarian cancer is among the most common causes of female mortality. Despite improvements in diagnostic methods, non-specific symptoms and delayed gynecological exams can lead to late-stage ovarian tumor discovery. In this study, the effect of an anti-cancer compound, 3-amino-N-(3-chloro-2-methylphenyl)-5-oxo-5,6,7,8-tetrahydrothieno[2,3-b]quinoline-2-carboxamide (Compound 1) was examined. Cytotoxicity, apoptosis, and metabolomic changes in ovarian cancer cell lines SK-OV-3 and OVCAR-3, as well as glycosphingolipid (GSL) expression, both on cancer stem cells (CSCs), marked as CD49f+ and non-CSCs (CD49f-) were explored. Treatment with Compound 1 reduced the percentage of CSCs compared to non-treated cells (P &lt; 0.001). The expression of eight GSLs on CSCs and non-CSCs was examined using flow cytometry. Both cell lines showed a change in the glycophenotype of the cells, either up or down of its expression, after the treatment. These findings raise the possibility of specifically targeting CSCs in ovarian cancer therapy. Additionally, treatment of Compound 1 resulted in a statistically significant increase in both early and late apoptosis (P&lt;0.001) suggesting a pivotal role in initiating programmed cell death by the apoptotic pathway. The metabolic analysis revealed that the treated cancer cells showed reduced metabolic activity compared to the control group (P &lt; 0.001)

Aim: The overall aim of the study was to assess the reasons and experiences of participants involved in Antibody Mediated Prevention (AMP) HIV prevention clinical trial at University of North Carolina (UNC) Project, Lilongwe, Malawi. We determined the participants’ reasons for participating in HIV Prevention clinical trials; and the experiences of participants in HIV Prevention clinical trials. Methods: We adopted the qualitative cross-sectional study method. Data were collected using in-depth interviews (IDIs). Purposive sampling was used to select 12 study participants who consented to take part in the study. All participants were the ones taking part in the AMP HIV prevention study at the UNC Project. Data analysis was done concurrently with data collection using content analysis. Results: Individuals were motivated to participate in HIV research due to a range of perceived benefits. These included personal, health, and financial benefits. Participants' research experiences and their continued participation in HIV research were influenced by the research clinic context and the nature of their interactions with research staff. Conclusion: When the clinical trial study participants’ expectations are met through what they experience in the study, the chances of them adhering to the study visits and procedures are high. Even for those who did not have any expectations prior to the study, feeling welcomed and being able to open up to the study staff encouraged their continued participation. In the end, this outweighed the negative comments made by the people in their communities or their friends

As the natural resources are getting exhausted, the concept of sustainable development of region has received increasing attentions, especially for resource-dependent cities. In this paper an innovative method that emergy analysis and IPAT (Human Impact Population Affluence Technology) model were combined in order to analyze the quantitative relationship of economic growth and energy consumption and further to evaluate its overall sustainability level. Taiyuan, a traditional, resource-dependent city in China, is selected as the case study region. The main results show that total emergy of Taiyuan increased from 9.023× 1023 sej in 2007 to 9.116× 1023sej in 2014, with 38% reduction on non-renewable emergy and 125% growth on imported emergy. Regional emergy money ratio (RMB) was reduced by 48% from 5.31× 1013sej/$ in 2007 to 2.74× 1013sej/$ in 2014, indicating that the increasing speed of consuming resources and energy was faster than the increase of GDP, and that Taiyuan’s money purchasing power declined. The lower emergy sustainability index (ESI) indicates that Taiyuan was explored and produced large quantities of mineral resources, which puts more stress on the environment as a consequence, and that this is not sustainable in the long run. The IPAT analysis demonstrates that Taiyuan sticks to the efforts of energy conservation and environmental protection, in order to promote regional sustainable development, it is necessary to take an integrated effort. Policy insights suggest that resourceful regions should improve include energy and resource efficiency, optimizing energy and resourceful structure.

Clinical and pre-clinical studies of neuropsychiatric (NP) disorders show altered astrocyte properties and synaptic networks. These are refined during early postnatal developmental (PND) stages. Thus, investigating early brain maturational trajectories is essential to understand NP disorders. However, animal experiments are highly time-/resource-consuming, thereby calling for alternative methodological approaches. The function of MEGF10 in astrocyte-mediated synapse elimination (pruning) is crucial to refine neuronal networks during development and adulthood. To investigate the impact of MEGF10 during PND in the rat prefrontal cortex (PFC) and its putative role in brain disorders, we established and validated an Organotypic Brain Slice Culture (OBSC) system.Using Western blot, we characterized the expression of MEGF10 and the synaptic markers synaptophysin and PSD95 in the cortex of developing pups. We then combined immunofluorescent-immunohistochemistry with Imaris-supported 3D-analysis to compare age- and sex-dependent astrocyte-mediated pruning within the PFC in pups and OBSCs. We thereby validated this system to investigate age-dependent astrocyte-mediated changes in pruning during PND. However, further optimizations are required to use OBSCs for revealing sex-dependent differences. In conclusion, OBSCs offer a valid alternative to study physiological astrocyte-mediated synaptic remodelling during PND and might be exploited to investigate pathomechanisms of brain disorders with aberrant synaptic development.

Determination of antibody titre of dogs vaccinated against canine distemper in Jos North and South local Government Areas of Plateau State was carried out by collection of sera of vaccinated dogs and administration of well-structured questionnaires to dog owners. The samples collected were analyzed using the immune-blot ELISA Kit to determining the antibody titre (immunoglobulin G). It indicated that dogs vaccinated against the disease mounted adequate protective immunity. The result revealed that 54 (90.0%) of the sampled dogs have protective immunity, with those given more than one dose having higher level of protective antibody. Statistically, the result showed that the antibody titre did not differ significantly in relation to immunity and sex, breed, age and location but significant difference was seen in relation to number of primary vaccination. The result also revealed that those dogs that received booster doses (secondary vaccination) had more protective antibody. The study was aimed at evaluating the antibody titre of dogs vaccinated against canine distemper in Jos, Plateau State.

IgE-mediated wheat allergy is a gluten-related disorder. Wheat is one of the five most common food allergens in children. However, the natural history of IgE-mediated wheat allergy has seldom been described in the research literature. This study presents the current state of knowledge about the IgE-mediated wheat allergy in children.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Ageing is associated with a decline in both Nrf2 activity and DNA repair efficiency, leading to the accumulation of DNA damage and an increased risk of cancer. Understanding the mechanisms behind the increased level of damaged DNA during ageing is crucial for developing interventions to mitigate age-related cancer risk and improve overall health in older individuals. (Poly)phenols are plant-derived bioactive compounds that undergo metabolism into simpler phenolic catabolites following ingestion. While these compounds have been associated with various health benefits, further analysis of their bioavailable catabolites is necessary. To this end, four phenolic catabolites derived from colonic microbiota were investigated for their ability to reduce DNA damage in response to oxidative challenge and modulate the Nrf2-Antixoidant Response Element pathway. Normal and adenocarcinoma colonocyte cell lines (CCD 841 CoN, & HT29 respectively) were exposed to sub cytotoxic concentrations (>10 µM,) of hydroxylated (4-hydroxybenzoic acid, 3-(3’-hydroxyphenyl) propionic acid) and non-hydroxylated (benzoic acid or 3-phenylpropionic acid) phenolic acids. Using the COMET assay, each catabolite demonstrated significant (p<0.001) geno-protective activity, albeit with varying potency. They also significantly modulated expression of key genes in the Nrf2-ARE pathway, including Nrf2, Heme oxygenase-1 (HO-1), and NAD(P)H dehydrogenase quinone 1 (NQO1). Hydroxylation of the phenolic acids appeared to have a limited effect with respect to bioactivity. Overall, the colon derived phenolic metabolites, when assessed at physiologically relevant concentrations, reduced DNA damage in both normal and adenocarcinoma colonic cells in response to oxidative challenge, mediated – at least in part via upregulation of the Nrf2-ARE pathway.

Aflatoxins, which have been classified as a group-1 carcinogen are the well-known mycotoxins produced by Aspergillus flavus. Aflatoxins have been linked to liver diseases, acute hepatic necrosis, resulting in cirrhosis or hepatocellular carcinomas due to which it incurs a loss of value in international trade for peanuts contaminated with it. The four main aflatoxins are B1, B2, G1, and G2 of which B1 is predominant. In plants, the cell wall is the primary barrier against pathogen invasion. Cell wall fortifications such as deposition of callose, cellulose, lignin, phenolic compounds and structural proteins help to prevent the pathogen infection. Further, the host cell’s ability to rapidly repair and reinforce its cell walls will result in a reduction of the penetration efficiency of the pathogen. Peanut seed coat acts as a physical and biochemical cell wall barrier against both pre and post-harvest pathogen infection. The structure of seed coat and the presence of polyphenol compounds have been reported to inhibit the growth of A. flavus, however, not successfully employed to develop A. flavus resistance in peanut. A comprehensive understanding of peanut seed coat development and biochemistry will provide information to design efficient strategies for the seed coat mediated A. flavus resistance and Aflatoxin contamination.

Background and Objectives: High job strain is worsening the outcome in coronary artery disease, CAD. Severe dissatisfaction on workplace, imbalance between high demands , and low rewards, are affecting the quality of life, and diminishing the duration of life, especially in CAD patients. Our study included two samples : CAD patients (experimental group), and without CAD patients, but with traditional risk factors (control group). The main objective of the study was the role played by high sensitivity C reactive protein, hs CRP, and microalbuminuria, as mediators of job strain and CAD relationship. Secondary objectives were the following: identification of the most vulnerable patients( with significant job strain) and intervention towards this category, for cardiovascular events prevention (primary or secondary). Materials and Methods: The utilized methods were the following : clinical exam; electrocardiogram; echocardiogram; non contrast enhanced computed chest tomography; laboratory findings ( lipid profile, glycemia, hs CRP, microalbuminuria); type D scale, DS 14; depression questionnaire, PHQ-9; and satisfaction with work scale, SWWS. Results: The highest values for hs CRP and microalbuminuria were noticed in patients with the lowest Likert score, for both samples CAD, and without CAD patients. The highest job strain was noticed in females. More than half of CAD patients ,with low Likert scores, revealed myocardial infarction. Conclusions: Microalbuminuria and hs CRP were statistical significant in the study as intercessors, in job strain and CAD relationship. The most vulnerable patients for vascular events were females, in both groups : CAD and “CAD waiting desk”. In CAD sample, the vascular vulnerability was also increased by high job strain.

Background: As cancer progresses, cells acquire traits that allow them to disperse and disseminate to distant locations in the body – a process known as metastasis. While in the vasculature, these cells are referred to as circulating tumour cells (CTCs) and can manifest either as single cells or clusters of cells (i.e., CTC clusters), with the latter being the most aggressive. The increased metastatic potential of CTC clusters is generally associated with cooperative group benefits in terms of survival, such as increased resistance to shear stress, anoikis, immune attacks and drugs. However, the adoption of a group phenotype poses a challenge when exiting the vasculature (extravasation) as the large size can hinder the passage through vessel walls. Despite their significant role in the metastatic process, the mechanisms through which CTC clusters extravasate remain largely unknown. Based on the observed in vivo association between CTC clusters and platelets, we hypothesized that cancer cells take advantage of the platelet-derived Transforming Growth Factor Beta 1 (TGF-β1) – a signalling factor that has been widely implicated in many aspects of cancer, to facilitate their own dissemination. To address this possibility, we evaluated the effect of exogenous TGF-β1 on an experimentally evolved non-small lung cancer cell line that we previously developed and used to investigate the biology of CTC clusters. Results: We found that exogenous TGF-β1 induced the dissociation of clusters into adherent single cells. Once adhered, cells released their own TGF-β1 and were able to individually migrate and invade in the absence of exogenous TGF-β1. Based on these findings we developed a model that involves a TGF-β1-mediated plastic switch between a cooperative phenotype and a single-celled stage that enables the extravasation of CTC clusters. Conclusions: This model allows for the possibility that therapies can be developed against TGF-β1 signalling components and/or TGF-β1 target genes to suppress the metastatic potential of CTC clusters. Considering the negative impact that metastasis has on cancer prognosis and the lack of therapies against this process, interfering with the ability of CTC clusters to switch between cooperative and individual behaviours could provide new strategies to improve patient survival.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

Bio-molecular reagents like antibodies required in experimental biology are expensive and their effectiveness, among other things, is critical to the success of the experiment. Although such resources are sometimes donated by one investigator to another through personal communication between the two, there is no previous study to our knowledge on the extent of such donations, nor a central platform that directs resource seekers to donors. In this paper, we describe, to our knowledge, a first attempt at building a web-portal titled Bio-Resource Exchange that attempts to bridge this gap between resource seekers and donors in the domain of experimental biology. Users on this portal can request for or donate antibodies, cell-lines and DNA Constructs. This resource could also serve as a crowd-sourced database of resources for experimental biology. Further, in order to index donations outside of our portal, we mined scientific articles to find instances of donations of antibodies and attempted to extract information about these donations at the finest granularity. Specifically, we extracted the name of the donor, his/her affiliation and the name of the antibody for every donation by parsing the acknowledgements sections of articles. To extract annotations at this level, we propose two approaches – a rule based algorithm and a bootstrapped relation learning algorithm. The algorithms extracted donor names, affiliations and antibody names with average accuracies of 57% and 62% respectively. We also created a dataset of 50 expert-annotated acknowledgements sections that will serve as a gold standard dataset to evaluate extraction algorithms in the future. Contact: [email protected], [email protected] Database URL: http://tonks.dbmi.pitt.edu/brx Supplementary information: Supplementary data are available at Database online.

Caspase-3, onto which there is a convergence of the intrinsic and extrinsic apoptotic pathways, is the main executioner of apoptosis. We here review the current literature on the intervention of the protease in the execution of naturally occurring neuronal death (NOND) during cerebellar development. We will consider data on the most common altricial species (rat, mouse and rabbit), as well as humans. Among the different types of neurons and glia in cerebellum, there is ample evidence for an intervention of caspase-3 in the regulation of NOND of the post-mitotic cerebellar granule cells (CGCs) and Purkinje neurons as a consequence of failure to establish proper synaptic contacts with target (secondary cell death). It seems possible that also the GABAergic interneurons undergo a similar type of secondary cell death, but the intervention of caspase-3 in this case still remains to be clarified in full. Remarkably, CGCs also undergo primary cell death at the precursor/pre-migratory stage of differentiation, in this case without the intervention of caspase-3. Glial cells as well undergo a process of regulated cell death, but it seems possible that expression of caspase-3, at least in the Bergmann glia, is related to differentiation rather than death.

Here we first report, how cholera toxin (CT) A subunit (CTA), the bacterial enzyme moiety responsible of cell signaling alteration, can take over the exosomal pathway, spread extracellularly and be transmitted in a cell population. A first evidence for long-term transmission of CT toxic effect via extracellular vesicles was obtained in CHO cells. To follow CT intracellular route towards exosome secretion we adopted a strategy apt to convert multivesicular body (MVB) derived exosomes in traceable fluorescent vectors. CT treated Me665 cells, a human melanoma cell line highly expressing caveolin-1 (Cav-1) and GM1, were used to purify and characterize fluorescent exosomes. Our results clearly show association of CT with exosomes together with typical exosomal markers and the HSP90 and PDI molecules, the required membrane translocation elements of CTA to the cytoplasm. Confocal microscopy proved direct CT containing fluorescent exo transfer into CHO cells coupled with the morphological cell change characteristic of CT action. Moreover, direct assessment of cAMP levels in Me665 cells treated with CT containing exo showed an efficient induction of cAMP increase comparable with CT alone. From our results, we can infer that CT can exploit exosome-mediated cell communication to target and extend its pathophysiological action throughout cell tissues.

Diffuse large B cell lymphoma (DLBCL), the most frequent type of non-Hodgkin lymphoma in adulthood, remains challenging clinical issues. Despite enhanced remission rates can be achieved, there are one-third of patients who will not respond to current treatment or will relapse with resistant disease, necessitating ongoing efforts on effective treatment strategies and agents. The vacuole H+-ATPase inhibitor bafilomycin A1 is broadly used to block late stage of autophagy flux at high concentration. In this study, we show that, to our surprise, bafilomycin A1 effectively inhibited and killed DLBCL cells at nanomolar concentrations (5nM). Bafilomycin A1 targeted cell cycle regulators cyclin D1 and cyclin E2 to induce cell cycle arrest in G0/G1 phase. Meanwhile, it induced caspase-dependent apoptosis with concomitant cleaved caspase-3 and Parp. Furthermore, we found that bafilomycin A1 inhibited autophagy flux at both early and late stages of the autophagy flux through activating ERK and mammalian target of rapamycin signaling, as well as by inhibiting the degradation of autolysosomes. We speculated that bafilomycin A1 as autophagy inhibitor might enhance the effect of DLBCL chemotherapeutic drug rituximab. Accordingly, our results provided evidence that the combination of bafilomycin A1 with rituximab enhanced the inhibition of DLBCL cells notably. Taken together, our data suggest that bafilomycin A1 may be a promising candidate drug in the therapy of diffuse large B cell lymphoma.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

UPF3B is a constituent of the classical nonsense-mediated mRNA decay (NMD) pathway that degrades both the aberrant transcripts and a set of physiological transcripts. In higher eukaryotes, UPF3B have significant biochemical functions in diverse cellular processes including NMD and translation. UPF3B plays a crucial role in neuronal development and differentiation. Next-generation sequencing technologies identified several loss-of-function mutations in the UPF3B gene that results in neuro-developmental disorders in humans. To uncover the mechanistic role of UPF3B in neuronal functions, we have generated the UPF3B-knockout mammalian cell line model system using CRISPR-Cas9 gene editing method. RNA-Sequencing Analysis of cellular transcriptome from UPF3B-KO cells identified specific genes involved in cell growth and neuronal functions. Altered expression of genes related to the axon guidance pathway delineated the UPF3B function to regulate the neuron-specific genes. Functional enrichment analysis identified the genes involved in the disorders related to mental health and intellectual disability. Our study has the potential to identify the direct players of intellectual disability and will have broader implications.

T-cell mediated immune responses should be regulated to avoid the development of autoimmune or chronic inflammation diseases. Several mechanisms have been described to regulate this process, namely death of overactivated T cells by cytokine deprivation, suppression by T regulatory cells (Treg), induction of expression of immune checkpoint molecules such as CTLA-4 and PD-1, or activation-induced cell death (AICD). In addition, activated T cells release membrane microvesicles called exosomes during these regulatory processes. In this review, we revise the role of exosome secretion in the different pathways of immune regulation described to date and its importance in the prevention of autoinmune disease. Expression of membrane-bound death ligands on the surface of exosomes during AICD, or the more recently described transfer of miRNA or even DNA inside T-cell exosomes are molecular mechanisms that will be analyzed.

Our aim was to determine the secondary antibody deficiency profiles of patients in a mesoregion of São Paulo state, Brazil, focusing on infectious diseases. Demographic characteristics, clinical and laboratory data were obtained from electronic files; infections were classified as organ-specific and graded as mild, moderate, life-threatening, and fatal. Non-Hodgkin lymphoma (NHL) accounted for 30% of patients, nephrotic syndrome (NS) 25%; chronic lymphocyte leukemia 20%, and multiple myeloma 15%. Patients with NS were younger than those in other groups, and hypo-γ-globulinemia was detected in 94.1%, IgG <400 mg/dL in 60.0%, IgA <40 mg/dL in 55.0%, and CD19 <20 cells/mm³ in 30.0%. One hundred and one infections were found; 82.1% were classified as mild or moderate, 7.9% as life-threatening, and 1.9% as fatal. Respiratory tract infections were more prevalent (41.5%), and pneumonia accounted for 19.8%. Lower levels of infections were found in patients with NS compared with NHL (P=0.0001). Most patients progressed to hypo-γ-globulinemia and secondary antibody deficiency after treatment with immunosuppressants, and mild and moderate infections were predominant. These therapies are increasing in patients with different diseases, therefore monitoring hypo-γ-globulinemia and infections may help to identify patients at high risk for severe complications, antibiotic prophylaxis or treatment, and immunoglobulin replacement

Excessive activation of frog eggs (overactivation) is a pathological process that renders eggs unfertilizable. Its physiological inducers are unknown. Previously, oxidative stress was shown to cause time- and dose-dependent overactivation of Xenopus laevis frog eggs [1]. Here, we demonstrate that the oxidative stress-induced egg overactivation is a calcium-dependent phe-nomenon which can be attenuated in the presence of the selective calcium chelator BAPTA. Degradation of cyclin B2, which is known to be initiated by calcium transient in fertilized or parthenogenetically activated eggs, can also be observed in the overactivated eggs. Decline in mitochondrial membrane potential, ATP depletion and termination of protein synthesis manifest in the eggs within one hour of triggering overactivation. These intracellular events occur in the absence of caspase activation. Furthermore, plasma membrane integrity is compromised in the overactivated eggs, as evidenced by ATP leakage and egg swelling. In sum, our data demonstrate that oxidative stress-induced overactivation of frog eggs causes fast and dramatic disruption of cellular homeostasis, resulting in robust and expedited cell death by a calcium-dependent non-apoptotic mechanism.

Abstract: Mast cell (MC) specific proteases are of particular interest for space biology and medicine due to their biological activity in regulating targets of a specific tissue microenvironment. MC tryptase and chymase obtain the ability to remodel connective tissue through direct and indirect mechanisms. Yet, MC specific protease expression under space flight conditions has not been adequately investigated. Using immunohistochemical stainings, we analyzed in this study the protease profile of the jejunal, gastric and hepatic MC populations in three groups of Mongolian gerbils - vivarium control, synchronous experiment, and 12-day orbital flight on the Foton-M3 spacecraft, - and in two groups - vivarium control and anti-orthostatic suspension - included in the experiment simulating effects of weightlessness in the ground-based conditions. After a space flight, there was a decreased number of MCs in the studied organs combined with an increased proportion of chymase-positive MCs and MCs with a simultaneous content of tryptase and chymase; the secretion of specific proteases into the extracellular matrix increased. These changes in the expression of proteases were observed both in the mucosal and connective tissue MC subpopulations of the stomach and jejunum. Notably, the relative content of tryptase-positive MCs in the studied organs of the digestive system decreased. Space flight conditions simulated in the synchronous experiment caused no similar significant changes in the protease profile of MC populations. The space flight conditions resulted in an increased chymase expression combined with a decreased total number of protease-positive MCs apparently due to participating in the processes of extracellular matrix remodeling and regulating the state of the cardiovascular system.

Oleuropein, glycosylated secoiridoid present in the olive leaves, is known as an important antioxidant phenolic compound. We studied the antioxidant effect of low dose of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggest that growth arrest and cell dead of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects myogenesis of C2C12 cells; because the MyoD mRNA levels and the differentiation process are restored after treatment with 3,4-DHPEA-EA(P). Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process by functioning as an efficient antioxidant.

During choriogenesis in insects, chorion (eggshell) is formed by surrounding follicular epithelial cells in ovarioles. However, the regulatory endocrine factor(s) activating choriogenesis and the chemical components on eggshell deserve further exploration. In two representative Coleopterans, a Coccinellid Henosepilachna vigintioctopunctata and a Chrysomelid Leptinotarsa decemlineata, genes encoding the 20-hydroxyecdysone (20E) receptor heterodimer, ecdysone receptor (EcR) and ultraspiracle (USP), and two chitin biosynthesis enzymes UDP-N-acetylglucosamine pyrophosphorylase (UAP) and chitin synthase (ChS1), were highly expressed in ovaries of the young females. RNA interference (RNAi)-aided knockdown of either HvEcR or Hvusp in H. vigintioctopunctata inhibited oviposition, suppressed the expression of HvChS1, and lessened the positive signal of Calcofluor staining on the chorions, which suggests the reduction of a chitin-like substance (CLS) deposited on eggshells. Similarly, RNAi of LdEcR or Ldusp in L. decemlineata constrained oviposition, decreased the expression of LdUAP1 and LdChS1, and declined CLS contents in the resultant ovaries. Knockdown of LdUAP1 or LdChS1 caused similar defective phenotypes, i.e., reduced oviposition and CLS contents in the L. decemlineata ovaries. These results, for the first time, indicate that 20E signaling activates choriogenesis in two Coleopteran species. Moreover, our findings propose the deposition of a CLS on the chorions.

Biologic scaffolds have become an attractive approach for repairing the infarcted myocardium and have been shown to facilitate constructive remodeling in injured tissues. This study aimed to investigate the possible utilization of bacterial cellulose membrane patch containing cocultured cells to limit the myocardium's post-infarction pathology. Myocardial infarction was induced by ligating the left anterior descending coronary artery in 45 Wistar rats, and patches with or without cells were attached to the hearts. After one week, the animals underwent echocardiography for assessing ejection fraction and left ventricular end-diastolic and end-systolic volumes. Following the patch formation, cocultured cells retained viability of >90% over 14 days in culture. The patch was applied to the myocardial surface of the infarcted area after staying 14 days in culture. Interestingly, the bacterial cellulose membrane without cellular treatment showed higher preservation of cardiac dimensions; however, we did not observe improvement in the left ventricular ejection fraction of this group compared to coculture treated membranes. Our results demonstrated an important role for bacterial cellulose in supporting cells known to produce cardioprotective soluble factors and may thus provide effective future therapeutic outcomes for patients suffering from ischemic heart disease.

Background: Cancer stem cells (CSCs) exhibit self-renewal activity and give rise to other cell types in tumors. Due to the infinite proliferative potential of CSCs, drugs targeting these cells are necessary to completely inhibit cancer development. beta-lapachone (bL) has been widely used to treat cancer development, but its effect on cancer stem cells remain elusive. Thus, we investigated the effect of bL on mammosphere formation using breast cancer stem cell (BCSC) marker positive cells, MDA-MB-231. Methods: MDA-MB-231 Cells, which is negative for NQO1 expression, was constructed to stably express NQO1(NQO1 stable cells) to see the effect of bL. The effect of bL on cells were evaluated by wound healing and Transwell cell culture chambers, and ALDEFLUOR assay. Results: Here, we show that bL inhibited the proliferative ability of mammosphere derived from BCSC marker-positive cells, MDA-MB-231, in an NQO1-dependent manner. bL treatment efficiently downregulated expression level of BCSC markers CD44, ALDH1A1, and DLGAP5 that recently identified as a stem cell proliferation marker in both cultured cells and mammosphered cells. Moreover, bL efficiently downregulates cell proliferation and migration activities. Conclusions: These results strongly suggest that bL could be a therapeutic agent targeting breast cancer stem cells with proper NQO1 expression.

The synthesis of four samples of new polyurethanes was evaluated by changing the ratio of the diol monomers used, poly(propylene glycol) (PPG) and D-isosorbide, in the presence of aliphatic isocyanates such as the isophorone diisocyanate (IPDI) and 4,4′-methylenebis(cyclohexyl isocyanate) (HMDI). The thermal properties of the four polymers obtained were determined by DSC, exhibiting Tg values in the range 55-70 ºC, and their molecular structure characterized by FTIR, 1H and 13C NMR spectroscopies. The diffusion coefficients of these polymers in solution were measured by the Pulse Gradient Spin Echo (PGSE) NMR method, enabling the calculation of the corresponding hydrodynamic radii in diluted solution (1.62–2.65 nm). The molecular weights were determined by GPC/SEC and compared with the values determined by quantitative 13C NMR analysis. Finally, the biocompatibility of the polyurethanes was assessed using the HaCaT keratinocyte cell line by the MTT reduction assay method showing values superior to 70% cell viability.

Alterations in gene expressions are often due to epigenetic modifications that can lead to significant influence on cancer development, growth, and progression. The main epigenetic modifications observed in human are methylation and acetylation. In this regard, the HDAC inhibitors (HDACi) such as SAHA (Vorinostat), which can exert epigenetic alterations through impacting the acetylation status of histones, are in clinical trials as a new class of drugs with promising effects on the cancer growth and metastatic process. The small molecule RG7388 is a newly developed inhibitor that is specific for an oncogene-derived protein called MDM2, which is in clinical trials for the treatment of various types of cancers. One of the common characteristics for these two drugs is their ability to induce p21 expression through distinct mechanisms in MCF-7 and LNCaP cells. This difference was expected trigger cell cycle arrest and cell death through intra-cellular mechanisms that are not identical. Hence, the molecular mechanism whereby SAHA can induce cell cycle arrest and trigger necrosis, apoptosis or necroptosis is still evolving. Similarly, the ability of RG7388 for producing anticancer effect is undergoing thorough investigation, since it can produce p53 dependent and p53 independent effects. In this study we performed experiments to measure the cell cycle arrest effects of SAHA and RG7388 on using MCF-7 and LNCaP cells. The cytotoxicity, cell cycle arrest and apoptosis/necroptosis effects of the treatments were assessed by using Trypan Blue Dye Exclusion (TBDE) method, MTT assay, Fluorescence assay with DEVD-amc fluorogenic substrate and Immunoblotting methods. Our results from MCF-7 and LNCaP cells confirmed that SAHA and RG7388 treatments were able to induce cell death via combination of cell cycle arrest and cytotoxic mechanisms. We are speculating that our findings could lead to the development of newer treatments for breast and prostate cancers using this type of combinations.

Salt stress is one of the major abiotic stresses that lead to crop yield reduction worldwide. Melatonin (MT), an endogenous hormone synthesized in plants, plays an important role in responding to abiotic stimuli such as drought, salinity, heat, cold, etc. However, the molecular mechanisms of MT-mediated abiotic stresses remain to be better understood. In order to explore the key genes and pathways of melatonin in alleviating salt stress, physiological and biochemical indicators as well as transcriptomics profile were conducted in alfalfa seedlings. The results showed that the germination rate, bud length and fresh weight of alfalfa seedlings added with melatonin were higher than those treated with salt alone. In addition, Malondialdehyde (MDA) and Superoxide anion (O2-) contents also displayed a decreasing trend. The activity and content of Superoxide dismutase (SOD)、peroxidase (POD) and Glutathione (GSH) increased to varying degrees. In order to further reveal the molecular mechanism of MT-mediated salt tolerance of alfalfa, transcriptome analysis was performed on alfalfa seedlings. 2,181 differentially expressed genes (DEGs) were obtained in the salt-treated group, including 780 upregulated genes and 1,401 down-regulated genes, while 4,422 DEGs were obtained in the MT group, among which 1,438 were upregulated and 2,984 were downregulated. By using GO functional annotation and KEGG pathway enrichment, we found that DEGs were mainly enriched in the biosynthesis of flavonoids, isoflavones, plant hormones, Glutathione (GSH), soluble sugars and other substances, as well as in the ABC transporter and MAPK signaling pathways. Among them, the DEGs in the MT group was more enriched in these pathways, suggesting that MT can combat salt stress by regulating the expression of genes related to phytohormone and antioxidant capacity, which has important reference value for the breeding of salt-tolerant alfalfa and other crops.

Chronic inflammatory diseases are considered the most significant cause of death worldwide. Current treatments for inflammatory diseases are limited due to the lack of understanding of the biological factors involved in early-stage disease progression. Nerve growth factor (NGF) is a neurotrophic factor directly associated with inflammatory and autoimmune diseases like osteoarthritis, multiple sclerosis, and rheumatoid arthritis. It has been shown that NGF levels are significantly upregulated at the site of inflammation and play a crucial role in developing a robust inflammatory response. However, little is known about NGF's temporal expression profile during the initial progressive phase of inflammation. This study aimed to determine the temporal expression pattern of NGF in rat skin during Adjuvant-Induced Arthritis (AIA). Sprague Dawley rats were randomly divided into control and Complete Freund's Adjuvant (CFA) treated groups. Levels of NGF were evaluated following unilateral AIA at different time points and it was found that peripheral inflammation due to AIA significantly upregulated the expression of NGF mRNA and Protein in a biphasic pattern. These results suggest that NGF signaling is crucial for initiating and maintaining peripheral neurogenic inflammation in rats during AIA.

Aims: To study the effects of pyridoxal phosphate (PLP) on oxidative stress in isolated pancreatic acinar cells. We have previously shown that PLP has cytoprotective and insulinotropic effects on mice islet cells in vivo and in vitro studies. Main methods: Acinar cells were isolated from three months old WNIN male rats and were cultured in vitro for a period of 24 h in CO₂ incubator. Later the cells were divided into four groups as untreated (group 1), H₂O₂ treatment (group 2)_, PLP treatment (group 3) and PLP followed by H₂O₂ treatment (group 4). Cell viability was confirmed using MTT assays, oxidative stress levels were measured with ROS assay, change in different protein levels were recorded by flow cytometry. The acinar cells insulin secretion assay was performed with ELISA. The amylase protein expression was assessed using confocal microscopy. Key findings: The cell viability of acinar cell in group 1 was considered as 100%, while in group 2 it was reduced to 82% due to H₂O₂ effect, and in group 3 (99.8%) and group 4 (99.5%) were near to group 1 due to the cytoprotective effect of PLP. The ROS levels were increased by 1.47 folds in group 2, while PLP decreased to 1.02 fold in group 4, which was comparable with the changes in group 1. Beneficial effects of PLP were also observed from the increased expression levels of acinar cells are amylase -2.01, neurogenin-3-9.51, PDX-1- 23.6 and insulin-13.5 in group 3 compared to group 1. The specificity of PLP’s response was confirmed by amino oxy acetic acid (AOAA), a specific PLP inhibitor. The increased amylase protein localization with PLP was confirmed by confocal microscopy. Insulin secretion efficiency of acinar cells was observed to be 6.13 folds higher at basal and 24.63 fold higher at stimulated levels in group3 compared to group1. Significance: Our results advocate the antioxidant and cytoprotective effects of PLP on the pancreatic acinar cell along with increased pancreatic marker expressions of amylase,PDX-1, neurogenin-3 and insulin proteins.

Antibody-dependent cell-mediated cytotoxicity (ADCC) by natural killer (NK) lymphocytes eliminates cells infected with viruses. Antiviral ADCC requires three components: 1) antibody; 2) effector lymphocytes with the Fc-IgG receptor CD16A; and 3) viral proteins in infected cell membranes. Fc-afucosylated antibodies bind with greater affinity to CD16A than fucosylated antibodies; individuals’ variation in afucosylation contributes to differences in ADCC. Current assays for afucosylated antibodies involve expensive methods. We report an improved bioassay for antibodies that support ADCC which encompasses afucosylation. This assay utilizes externalization of CD107a by NK-92-CD16A cells after antibody recognition. We used anti-CD20 monoclonal antibodies, GA101 WT or glycoengineered (GE), 10% or ~50% afucosylated, and CD20-positive Raji target cells. CD107a increased detection 7-fold compared to flow cytometry to detect Raji-bound antibodies. WT and GE antibody effective concentrations (EC50s) for CD107a externalization differed by 20-fold, with afucosylated GA101-GE more detectable. The EC50s for CD107a-externalization vs. 51Cr cell death were similar for NK-92 CD16A and blood NK cells. Notably, the %CD107a-positive cells negatively correlated with dead Raji cells and was nearly undetectable at high NK:Raji ratios required for cytotoxicity. This bioassay is very sensitive and adaptable to assess anti-viral antibodies but unsuitable as a surrogate assay to monitor cell death after ADCC.

Genetic engineering has become an essential element in developing climate-resilient crops and environmental sustainable solutions to respond to the increasing need for global food security. Genome editing using CRISPR/Cas [Clustered regulatory interspaced short palindromic repeat (CRISPR)-associated protein (Cas)] technology is being applied to a variety of organisms, including plants. This technique has become popular because of its high specificity, effectiveness, and low production cost. Therefore, this technology has the potential to revolutionize agriculture and contribute to global food security. Over the past few years, increasing efforts have been seen in its application in developing higher-yielding, nutrition rich, disease resistant, stress-tolerant “crops” fruits and vegetables. Cas proteins such as Cas9, Cas12, Cas13, and Cas14, among others, have distinct architectures and have been used to create new genetic tools that improve features that are important for agriculture. The versatility of Cas has accelerated genomic analysis and facilitated the use of CRISPR/Cas to manipulate and alter nucleic acid sequences in cells of different organisms. This review provides the evolution of CRISPR technology exploring its mechanisms and contrasting it with traditional breeding and transgenic approaches to improve different stress tolerance. We have also discussed the CRISPR/Cas system and explored three Cas proteins that are currently known to exist: Cas12, Cas13, and Cas14 and their potential to generate foreign DNA free or non-transgenic crops that could be easily regulated for commercialization in most countries.

Hypoxia, a condition of low oxygenation frequently found in triple-negative breast tumors (TNBC), promotes extracellular vesicle (EV) secretion and favors cell invasion, a complex process in which cell morphology is altered, dynamic focal adhesion spots are created, and ECM is re-modeled. Here, we investigated the invasive properties triggered by TNBC-derived hypoxic small EV (SEVh) in vitro in cells cultured under hypoxic and normoxic conditions, using pheno-typical and proteomic approaches. SEVh characterization demonstrated increased protein abundance and diversity over normoxic SEV (SEVn), with enrichment in pro-invasive pathways. In normoxic cells, SEVh promotes invasive behavior through pro-migratory morphology, in-vadopodia development, ECM degradation and matrix metalloprotease (MMP) secretion. Pro-teome profiling of normoxic cells exposed to SEVh determined enrichment in metabolic processes and cell cycle, modulating cell health to escape apoptotic pathways. In hypoxia, SEVh was re-sponsible for proteolytic and catabolic pathway inducement, interfering with integrin availabil-ity and gelatinase expression. Overall, our results demonstrate the importance of hypoxic signal-ing via SEV in tumors for the early establishment of metastasis.

Hierarchical tungsten oxide assemblies such as spindle-like, flowers with sharp petals, nanowires and regular hexagonal structures are successfully synthesized via a solvothermal reduction method by simply adjusting the reaction conditions. On the basis of the experimental results, it is determined that the reaction time significantly influences the phase transition, microstructure and photocatalytic activity of the prepared samples. The possible mechanisms for the phase transition and morphology evolution process have been systematically proposed. Moreover, the as-prepared products exhibit significant morphology-depended photocatalytic activity. The flower-like W18O49 prepared at 6 h possesses large specific surface area (150.1 m²g^-1), improved separation efficiency of electron-hole pairs and decreased electron-transfer resistance by the photoelectrochemical measurements. As a result, the flower-like W₁₈O₄₉ prepared at 6 h exhibits the highest photocatalytic activity for the degradation of Methyl orange aqueous solution. The radical trap experiments showed that the degradation of MO was driven mainly by the participation of h⁺ and •O²⁻ radicals.