POGZ (Pogo transposable element derived with ZNF domain) is known to function as a regulator of gene expression. While variations in the POGZ gene have been associated with intellectual disabilities and developmental delays in humans, the exact pathophysiological mechanisms re-main unclear. To shed light on this, we created two lines of conditional knockout mice for Pogz, one specific to excitatory neurons (Emx1-Pogz mice) and the other to inhibitory neurons (Gad2-Pogz mice) in the brain. Emx1-Pogz mice showed a decrease in body weight, similar to total Pogz knockout mice. Although the two lines did not display significant morphological ab-normalities in the telencephalon, impaired POGZ function affected the electrophysiological prop-erties of both excitatory and inhibitory neurons differently. These findings suggest that these mouse lines could be useful tools for clarifying the precise pathophysiological mechanisms of neurodevelopmental disorders associated with POGZ gene abnormalities.

We have previously reported that 60% sucrose diet-fed ChREBP knockout mice (KO) showed body weight loss resulting in lethality. We aimed to elucidate whether sucrose and fructose metabolism are impaired in KO. Wild type mice (WT) and KO were fed a diet containing 30% sucrose with/without 0.08% miglitol, an α-glucosidase inhibitor, and these effects on phenotypes were tested. Furthermore, we compared metabolic changes of oral and peritoneal fructose injection. Thirty percent sucrose diet feeding did not affect phenotypes in KO. However, miglitol induced lethality in 30% sucrose-fed KO. Thirty percent sucrose plus miglitol diet-fed KO showed increased cecal contents, increased fecal lactate contents, increased growth of lactobacillales and Bifidobacterium and decreased growth of clostridium cluster XIVa. ChREBP gene deletion suppressed the mRNA levels of sucrose and fructose related genes. Next, oral fructose injection did not affect plasma glucose levels and liver fructose contents; however, intestinal sucrose and fructose related mRNA levels were increased only in WT. In contrast, peritoneal fructose injection increased plasma glucose levels in both mice; however, the hepatic fructose content in KO was much higher owing to decreased hepatic Khk mRNA expression. Taken together, KO showed sucrose intolerance and fructose malabsorption owing to decreased gene expression.

In bioprocess development, the host and the genetic construct for a new biomanufacturing process are selected in the early developmental stages. This decision, made at the screening scale with very limited information about the performance of the selected cell factory in larger reactors, has a major influence on the performance of the final process. To overcome this, scaledown approaches are essential to run screenings that show the real cell factory performance at industrial like conditions. We present a fully automated robotic facility with 24 parallel mini-bioreactors that is operated by a model based adaptive input design framework for the characterization of clone libraries under scale-down conditions. The cultivation operation strategies are computed and continuously refined based on a macro-kinetic growth model that is continuously re-fitted to the available experimental data. The added value of the approach is demonstrated with 24 parallel fed-batch cultivations in a mini-bioreactor system with eight different Escherichia coli strains in triplicate. The 24 fed-batches ran under the desired conditions generating sufficient information to define the fastest growing strain in an environment with varying glucose concentrations similar to industrial scale bioreactors.

Presynaptic Ca²⁺-influx through voltage-gated Ca²⁺ channels (VGCC) is a key signal for synaptic vesicle release. Synaptic neurexins can partially determine the strength of transmission by regulating VGCCs. However, it is unknown whether neurexins modulate Ca²⁺-influx via all VGCC subtypes similarly. Here, we performed live cell imaging of synaptic boutons from primary hippocampal neurons with a Ca²⁺-indicator. We used the expression of inactive and active Cre recombinase to compare control to conditional knockout neurons lacking either all or selected neurexin variants. We found that reduced total presynaptic Ca²⁺-transients caused by the deletion of all neurexins were primarily due to the reduced contribution of P/Q-type VGCCs. The deletion of neurexin1α alone also reduced the total presynaptic Ca²⁺-influx but increased Ca²⁺-influx via N-type VGCCs. Moreover, we tested whether the decrease of Ca²⁺-influx induced by activation of cannabinoid receptor 1 (CB1-receptor) is modulated by neurexins. Unlike earlier observations emphasizing a role for β-neurexins, we found that the decrease of presynaptic Ca²⁺-transients induced by CB1-receptor activation depended more strongly on the presence of α-neurexins in hippocampal neurons. Together, our results suggest that neurexins have unique roles in the modulation of presynaptic Ca²⁺-influx through VGCC subtypes and that different neurexin variants may affect specific VGCCs.

Phospholipid metabolism, including phosphatidylcholine (PC) biosynthesis, is crucial for various biological functions and is associated to longevity. Phosphatidylethanolamine N-methyltransferase (PEMT) is a protein that catalyzes the biosynthesis of PC, the levels of which change in various organs such as brain and kidney during aging. However, the role of PEMT for systemic PC supply is not fully understood. To address how PEMT affects aging-associated energy metabolism in tissues responsible for nutrient absorption, lipid storage and energy consumption, we employed NMR-based metabolomics to study liver, plasma, intestine (duodenum, jejunum, ileum), brown/white adipose tissues (BAT, WAT), and skeletal muscle of young (9–10 weeks) and old (96–104 weeks) wild-type (WT) and PEMT knockout (KO) mice. We found that the effect of PEMT-knockout was tissue-specific and age-dependent. Deficiency of PEMT affected the metabolome of all tissues examined, among which the metabolome of BAT from both young and aged KO mice was dramatically changed in comparison to WT mice, whereas the metabolome of jejunum was only slightly affected. As for aging, the absence of PEMT increased the divergence of metabolome during aging of liver, WAT, duodenum and ileum and decreased the impact on skeletal muscle. Overall, our results suggest that PEMT plays a previously unexplored critical role in both aging and energy metabolism.

Methylmercury (MeHg) intoxication is a global health concern. Although MeHg neurotoxicity is well-recognized, less is known about MeHg's effects on metabolism. In this study, we evaluated MeHg intoxication (20mg/L in drinking water for 20 days) effects on liver and epididymal white fat (EWF) in young ApoE knockout (ko) and wild-type mice. The former is well-known to show spontaneous dyslipidemia. Hg levels in hair, liver, and EWF were measured to assess the degree of MeHg exposure. We also evaluated body weight gain, plasma triglycerides, total cholesterol levels, and liver injury by assessing steatosis score, AST, ALT, SOD, and TBAR levels. To evaluate EWF, we analyzed mean wet weight and adipocyte diameter, plasma leptin levels and metabolomics. Hg levels were markedly higher among intoxicated mice. ApoE ko mice showed higher Hg in the hair but lower levels in the liver and EWF than wild-type controls. Among wild-type mice, MeHg compromised weight gain and increased liver TBAR levels compared to non-challenged controls. Among non-intoxicated mice, ApoE deficiency significantly increased triglyceride, total cholesterol, and liver transaminases with reduced EWF wet weight, hepatic SOD, and plasma leptin levels. MeHg accumulation together with ApoE deficiency elevated total cholesterol, triglycerides, hepatic transaminases, and TBARS. We found distinct EWF metabolite activity in different scenarios of ApoE deficiency and MeHg intoxication, highlighting increased cardiovascular risk especially when both challenges occur. Further studies are required to elucidate the underlying mechanisms involved in these effects and the target nutritional interventions in most need to ameliorate them.

Memory and emotion are highly vulnerable to psychiatric disorders like post-traumatic stress disorder (PTSD), which has been linked to serotonin (5-HT) metabolism disruptions. In fact, over 90% of the 5-HT precursor tryptophan (Trp) is metabolized via the Trp-kynurenine (KYN) meta-bolic pathway, producing a variety of bioactive molecules. The aadat (kat2) gene encodes mito-chondrial kynurenine aminotransferase (KAT) isotype 2, responsible for kynurenic acid (KYNA) production. Little is known about its role in behavior. In CRISPR/Cas9-induced aadat knockout (kat2−/−) mice, we examined the effects on emotion, memory, motor function, Trp and its metabolite levels, enzyme activities in the plasma and the urine of 8-week-old males compared to wild-type mice. Transgenic mice showed more depressive-like behaviors in the forced swim test, but not in the tail suspension, anxiety, or memory tests. They also had fewer center field and corner entries, shorter walking distances, and fewer jumping counts in the open field test. Plasma metabolite levels are generally consistent with those of urine: KYN, antioxidant KYNs, 5-hydroxyindolacetic acid, and indole-3-acetic acid levels are lower; enzyme activities in KATs, kynureninase, and monoamine oxidase/aldehyde dehydrogenase are lower, but kynurenine 3-monooxygenase is higher; and ox-idative stress and excitotoxicity indices are higher. Transgenic mice show depression-like behavior in a learned helplessness model, emotional indifference, and motor deficits, coupled with a decrease in KYNA, a shift of Trp metabolism toward the KYN-3-HK pathway, and a partial decrease in the gut microbial Trp-indole pathway metabolite. This is the first evidence that deleting the aadat gene causes depression-like behaviors that are unique to despair experience, which appears to be linked to excitatory neurotoxic and oxidative stresses. This may lead to the development of a double-hit preclinical model in experience-based depression, better understanding of these complex condi-tions, and more effective therapeutic strategies by elucidating the relationship between Trp me-tabolism and PTSD pathogenesis.

Railway has been used as one of the most crucial means of transportation in public mobility and economic development. For efficiently operating railways, the electrification system in railway infrastructure, which supplies electric power to trains, is essential facilities for stable train operation. Due to its important role, the electrification system needs to be rigorously and regularly inspected and managed. This paper presents a supervised learning method to classify Mobile Laser Scanning (MLS) data into ten target classes representing overhead wires, movable brackets and poles, which are recognized key objects in the electrification system. In general, the layout of railway electrification system shows a strong regularity of spatial relations among object classes. The proposed classifier is developed based on Conditional Random Field (CRF), which characterizes not only labeling homogeneity at short range, but also the layout compatibility between different object classes at long range in the probabilistic graphical model. This multi-range CRF model consists of a unary term and three pairwise contextual terms. In order to gain computational efficiency, MLS point clouds is converted into a set of line segments where the labeling process is applied. Support Vector Machine (SVM) is used as a local classifier considering only node features for producing the unary potentials of CRF model. As the short-range pairwise contextual term, Potts model is applied to enforce a local smoothness in short-range graph. While, long-range pairwise potentials are designed to enhance spatial regularities of both horizontal and vertical layouts among railway objects. We formulate two long-range pairwise potentials as the log posterior probability obtained by Naïve Bayes classifier. The directional layout compatibilities are characterized in probability look-up tables which represent co-occurrence rate of spatial relations in horizontal and vertical directions. The likelihood function is formulated by multivariate Gaussian distributions. In the proposed multi-range CRF model, the weight parameters to balance four sub-terms are estimated by applying the Stochastic Gradient Descent (SGD). The results show that the proposed multi-range CRF can effectively classify detailed railway elements, representing the average recall of 97.66% and the average precision of 97.07% for all classes.

The branch prediction units (BPUs) generally have security vulnerabilities, which can be used by attackers to obtain the execution status, jump directions, and jump address of conditional branches, and the existing protection methods cannot defend against these attacks. Therefore, this article proposes a hardware security protection method for conditional branches of embedded systems. This method calculates the number of updates to the branch target buffer (BTB). When it exceeds the threshold, BTB is locked to prevent attackers from analyzing the execution status of branches based on the time difference of whether BTB is updated. Moreover, the hybrid physical unclonable function (PUF) circuit is designed to provide confidentiality protection for the jump directions, jump addresses, and their indexes, preventing attackers from stealing these critical data. If these mechanism fails and attackers successfully tamper with conditional branches, this paper proposes a control flow integrity (CFI) protection mechanism based on branch labels to timely detect tampering with instruction codes, jump addresses, and jump directions. The proposed method is implemented and tested on FPGA. The experimental results show that this method can achieve fine-grained security protection for conditional branches, with about 5.4% resource overhead and less than 5.5% performance overhead.

Aim: Complementary effects of dabigatran etexilate (DE), exercise training (ET) and combination (DE+ET) on the development and composition of the atherosclerotic lesions in diabetic apoE knockout (apoE-/-) mice. Methods: In 48 male apoE-/- diabetic mice, streptozotocin (STZ) was induced for 5 consecutive days. Mice received figh-fat diet (HFD) for 8 weeks and were randomized into 4 groups (1.Control/CG, 2.DEG: HFD with DE, 3.ETG: ET on treadmill, 4.DE+ETG: Combination DE and ET treatment). At the end of 8th week, all mice were euthanatized and morphometry of the aortic lesions at the level of aortic valve was obtained. Collagen, elastin, TNF-a, MCP-1, matrix-metalloproteinases (MMP-2,-3,-9), and TIMP-1 concentration within plaques at aortic valve were determined. Results: All active groups had significantly smaller aorta stenosis (DEG:7.9±2.2%, ETG:17.3±5.3%, DE+ETG:7.1±2.7%) compared to CG (23.3±5.5% p<0.05), reduced the relative intra-plaque concentrations of macrophages, MCP-1, MMP-3 and MMP-9, and considerably increased collagen, elastin and TIMP-1 (p<0.05). Group 4 showed the most pronounced results (p<0.05). Both DEG and DE+ETG significantly reduced MMP-2 and TNF-a concentrations compared to ETG and CG (p<0.010). Conclusion: DE and ET treatment in diabetic apoE-/- mice showed complementary amelioration of atherosclerotic lesions development and stability, mediated by the anti-inflammatory modulation of both DE and ET.

This study introduces a novel computational approach for testing conditional independence (BB CI test) within causal Directed Acyclic Graphs (DAGs), leveraging Bayesian non-parametric bootstrap and machine learning techniques. Our method offers an alternative for validating the assumptions underpinning causal DAGs. Through simulation studies and an industrial case analysis, we demonstrate the test procedure in accurately assessing conditional independence, comparing it with the Generalized Covariance Measure (GCM) test. Our findings suggest that the BB CI test is advantageous in scenarios where existing methods may falter due to violations of model assumptions. This research contributes to the causal inference literature by providing a computational tool for researchers and practitioners to validate causal models.

Antioxidant, anti-inflammatory and chemo-preventive features have been reported for the carotenoid diatoxanthin. Diatoxanthin is only produced by a few groups of microalgae where it functions in photoprotection. Its large-scale production in microalgae is currently not feasible. In fact, rapid conversion into the inactive pigment diadinoxanthin is triggered when the cells are removed from the high-intensity light source, which will be the case during large-scale harvesting of microalgae biomass. Zeaxanthin epoxidase (ZEP) 2 and/or ZEP3 have been suggested to be responsible for the back-conversion of high-light accumulated diatoxanthin to diadinoxanthin in low light in diatoms. Using the CRISPR/Cas9 gene editing technology we knocked out the ZEP2 and ZEP3 genes in the already commercially used marine diatom Phaeodactylum tricornutum to investigate their role in the diadinoxanthin-diatoxanthin cycle, and to determine if one of the mutant strains could function as a diatoxanthin production line. Light shift experiments proved that ZEP3 encodes the enzyme converting diatoxanthin to diadinoxanthin in low light. Loss of ZEP3 caused the high-light accumulated diatoxanthin to be stable for several hours after the cultures had been returned to low light, suggesting that zep3 mutant strains could be suitable as commercial production lines of diatoxanthin.

Expectation maximization (EM) algorithm is a powerful mathematical tool for estimating statistical parameter when data sample contains hidden part and observed part. EM is applied to learn finite mixture model in which the whole distribution of observed variable is average sum of partial distributions. Coverage ratio of every partial distribution is specified by the probability of hidden variable. An application of mixture model is soft clustering in which cluster is modeled by hidden variable whereas each data point can be assigned to more than one cluster and degree of such assignment is represented by the probability of hidden variable. However, such probability in traditional mixture model is simplified as a parameter, which can cause loss of valuable information. Therefore, in this research I propose a so-called conditional mixture model (CMM) in which the probability of hidden variable is modeled as a full probabilistic density function (PDF) that owns individual parameter. CMM aims to extend mixture model. I also propose an application of CMM which is called adaptive regressive model (ARM). Traditional regression model is effective when data sample is scattered equally. If data points are grouped into clusters, regression model tries to learn a unified regression function which goes through all data points. Obviously, such unified function is not effective to evaluate response variable based on grouped data points. The concept “adaptive” of ARM means that ARM solves the ineffectiveness problem by selecting the best cluster of data points firstly and then evaluating response variable within such best cluster. In order words, ARM reduces estimation space of regression model so as to gain high accuracy in calculation.

Small interfering RNA (siRNA) holds significant therapeutic potential by silencing target genes through RNA interference. Current clinical applications of siRNA have been primarily limited to liver diseases, while achievements in delivery methods are expanding its applications to various organs, including the lungs. Cholesterol-conjugated siRNA emerges as a promising delivery approach due to its low toxicity and high efficiency. This study focuses on developing a cholesterol-conjugated anti-Il6 siRNA and the evaluation of its potency for the potential treatment of inflammatory diseases using the example of acute lung injury (ALI). The biological activities of different Il6-targeted siRNAs containing chemical modifications were evaluated in J774 cells in vitro. The lead cholesterol-conjugated anti-Il6 siRNA after intranasal instillation demonstrated dose-dependent therapeutic effects in a mouse model of ALI induced by lipopolysaccharide (LPS). The treatment significantly reduced Il6 mRNA levels, inflammatory cell infiltration, and the severity of lung inflammation. IL6 silencing by cholesterol-conjugated siRNA proves to be a promising strategy for treating inflammatory diseases, with potential applications beyond the lungs.

A comprehensive review on symmetry and conditional symmetry is made from the core conception of symmetry and conditional symmetry. For a dynamical system, the structure of symmetry means its robustness against the polarity change of some of the system variables. Symmetric systems typically show symmetrical dynamics and even when the symmetry is broken, symmetric pairs of coexisting attractors are born annotating the symmetry in another way. The polarity balance can be recovered by the combinations of the polarity reverse of system variables, and furthermore, it can also be restored by the offset boosting of some of the system variables if the variables lead to the polarity reverse from their functions. In this case, conditional symmetry is constructed giving a chance for a dynamical system outputting coexisting attractors. Symmetric strange attractors typically represent the flexible polarity reverse of some of the system variables, which brings more alternatives of chaotic signal and more convenience for chaos application. Symmetric and conditionally symmetric coexisting attractors can also be found in memristive systems and circuits. Therefore, symmetric chaotic system and those of conditional symmetry provide sufficient system options for chao-based applications.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

The tumor organoid (tumoroid) model in three-dimensional (3D) culture systems has been developed to reflect more closely the in vivo tumors than 2D-cultured tumor cells. Notably, extracellular vesicles (EVs) are efficiently collectible from the culture supernatant of gel-free tumoroids. Matrix metalloproteinase (MMP) 3 is a multi-functional factor playing crucial roles in tumor progression. However, roles of MMP3 within tumor growth and EVs have not unveiled. Here, we investigated the protumorigenic roles of MMP3 on integrities of tumoroids and EVs. We generated MMP3-knockout (KO) cells using the CRISPR/Cas9 system from rapidly metastatic LuM1 tumor cells. Moreover, we established fluorescent cell lines with palmitoylation signal-fused fluorescent proteins (tdTomato and enhanced GFP). Then we confirmed the exchange of EVs between cellular populations and tumoroids. LuM1-tumoroids released large EVs (300-1000 nm) and small EVs (50-200 nm) while the knockout of MMP3 resulted in the additional release of broken EVs from tumoroids. The loss of MMP3 leads to a significant reduction in tumoroid size and to the development of the necrotic area within tumoroids. MMP3 and CD9 (a category-1 EV marker tetraspanin protein) were significantly down-regulated in MMP3-KO cells and their EV fraction. These weakened phenotypes by MMP3 KO were markedly rescued by the addition of MMP3-rich EVs or conditioned medium (CM) collected from LuM1-tumoroids, which caused a dramatic rise in the expression of MMP3, CD9, and Ki-67 (a marker of proliferating cells) in the MMP3-null/CD9-low tumoroids. Notably, MMP3 enriched in tumoroids-derived EVs and CM deeply penetrated into recipient MMP3-KO tumoroids, resulting in a remarkable enlargement of solid tumoroids, while MMP3-null EVs did not. These data demonstrate that EVs can mediate molecular transfer of MMP3 resulting in increasing the proliferation and CD9+ tumorigenesis, indicating crucial roles of MMP3 in tumor progression.

Dipeptidyl peptidase 9 (DPP9) is a multifunctional intracellular protease with roles in tumour growth, inflammation and mitochondrial function. We developed a hepatocyte-specific DPP9 knockout mouse (DPP9-KO) to explore DPP9 in a mouse model of hepatocellular carcinoma (HCC). DPP9-KO mice were generated by crossing Albumin-Cre mice (Wt/Wt Cre+/+) with DPP9 floxed mice (Fl/Fl Cre-/-). Mice were treated with Diethylnitrosamine and Thioacetamide then an atherogenic High Fat Diet until 28 weeks of age. DPP9-KO mice had reduced liver and subcuta-neous adipose tissue mass and lower fasting plasma glucose, fewer small macroscopic liver nod-ules compared to DPP9-WT mice. However, there were no differences in the total number of mac-roscopic liver nodules, tumour burden, inflammation score and steatosis score. Consistent with the known ability of DPP9 to suppress NLRP1 activation, activated caspase-1 protein was ele-vated in DPP9-KO mouse liver. Additionally, Nfkbib, Cxcl10 and Ccl5 mRNA and protein levels of autophagy marker beclin1 and tumour suppressor p53 were increased. In conclusion, DPP9 de-pletion in hepatocytes may reduce liver cancer initiation, via mechanisms that may include in-creased autophagy and innate tumour suppression in this experimental model. Finally, the data supports DPP9 having a role in glucose regulation by the liver.

With the rapid development of intelligent transportation, Vehicle Ad hoc Networks (VANETs) is becoming increasingly important.As a critical component of intelligent transportation systems, the Conditional Privacy-Preserving Authentication (CPPA) scheme plays a significant role in ensuring drivers' privacy and security.However, current CPPA schemes still face limitations in terms of security and efficiency, with these schemes either imposing higher computational overhead for enhanced security or compromising some level of security to reduce overhead. Motivated by this challenge, we propose a CPPA scheme that strikes a better balance between efficiency and security.By leveraging the token mechanism to achieve multiple authentication and minimizing information leakage. Furthermore, our performance analysis demonstrates that our ECC-based algorithm can significantly reduce overhead, with pseudonymous generation requiring only 0.0039ms.

Conditional generative adversarial networks (CGANs) learn a mapping from conditional input to observed image and perform tasks in image generation, manipulation and translation. In-situ monitoring uses sensors to obtain real-time information of additive manufacturing (AM) processes that relate to process stability and part quality. Understanding the correlations between process inputs and in-situ process signatures through machine learning can enable experimental-driven predictions of future process inputs. In this research, in-situ data obtained during a metallic powder bed fusion AM process is mapped with a CGAN. A single build of two turbine blades is monitored using EOSTATE Exposure OT, a near-infrared optical tomography system of the EOS M290 system. Layerwise images generated from the in-situ monitoring system were paired with a conditional image that labeled the specimen cross-section, laser-scan stripe overlap and z-distance to part surfaces. A CGAN was trained using the turbine blade data set and employed to generate new in-situ layerwise images for unseen conditional inputs.

Dyadic data contains co-occurrences of objects, which is often modeled by finite mixture model which in turn is learned by expectation maximization (EM) algorithm. Objects in traditional dyadic data are identified by names, causing the drawback which is that it is impossible to extract implicit valuable knowledge under objects. In this research, I propose the so-called attributed dyadic data (ADD) in which each object has an informative attribute and each co-occurrence of two objects is associated with a value. ADD is flexible and covers most of structures / forms of dyadic data. Conditional mixture model (CMM), which is a variant of finite mixture model, is applied into learning ADD. Moreover, a significant feature of CMM is that any co-occurrence of two objects is based on some conditional variable. As a result, CMM can predict or estimate co-occurrent values based on regression model, which extends applications of ADD and CMM.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

Objective: Lower extremity ischemia-reperfusion injury (IRI) may occur with trauma-related vascular injury and various vascular diseases, during the use of a tourniquet, temporary clamping of the aorta in aortic surgery, and acute or bilateral acute femoral artery occlusion. Mitochondrial dysfunction and increased basal oxidative stress in diabetes may cause an increase in the effects of increased reactive oxygen species (ROS) and mitochondrial dysfunction due to IRI. It is of great importance to examine therapeutic approaches that can minimize the effects of IRI, especially for patient groups under chronic oxidative stress. Cerium oxide (CeO2) nanoparticles mimic the antioxidant enzymes and act as a catalyst that scavenges ROS. In this study, it was aimed to investigate whether CeO2 has protective effects on skeletal muscles in lower extremity IRI in mice with streptozocin-induced diabetes. Methods: A total of 38 Swiss albino mice were divided into six groups as follows: control group (group C, n=6), diabetes group (group D, n=8), diabetes-CeO2 (group DCO, n=8), diabetes-ischemia/reperfusion (group DIR, n=8), and diabetes-ischemia/reperfusion-CeO2 (group DIRCO, n=8). DCO and DIRCO groups were given doses of CeO2 0.5mg/kg intraperitoneally 30 minutes before the IR procedure. A 120-minute ischemia-120-minute reperfusion period with 100% O2 was performed. At the end of the reperfusion period, muscle tissues were removed for histopathological and biochemical examinations. Results: Total antioxidant status (TAS) levels were found to be significantly lower in group DIR compared with group D (p=0.047 and p=0.022, respectively). In group DIRCO and total oxidant status (TOS) levels were found to be significantly higher than in group DIR (p

The objective of this study is to examine a nonparametric estimate , using the kernel approach, of the conditional distribution function of a scalar response variable that is given a random variable whose values take place in a separable real Hilbert space. The observations will be dependent on one another in a quasi-associated fashion. The pointwise practically perfect consistencies with rates of this estimator are established by us under some broad conditions. The study’s major objective is to investigate the convergence rate of the proposed estimator and its application in the convergence rate and asymptotic normality of the hazard function. The asymptotic normality of the developed estimator is established precisely. Simulation studies were conducted to investigate the behavior of the asymptotic property in the context of finite sample data.

According to previous studies the median raphe region (MRR) is known to contribute significantly to social behavior. Beside serotonin, there are reports of a small population of dopaminergic neu-rons in this region. Dopamine is linked to reward and locomotion, but very little has been known about its role in the MRR. To address that, we first confirmed the presence of dopaminergic cells in the MRR of mice (immunohistochemistry, RT-PCR) and humans (RT-PCR). Next, we used chemogenetic technology in mice containing Cre enzyme under the promoter of the dopamine transporter (DAT). With the help of an adeno-associated virus, artificial receptors were expressed in the dopaminergic cells of the MRR (DAT-MRR). Four weeks later, extensive behavioral charac-terization started 30 minutes after the injection of the artificial ligand (Clozapine-N-Oxide). Stimu-lation of DAT-MRR decreased social interest without influencing aggression and with an increase in social discrimination. Additionally, inhibition of the same cells increased the friendly social be-havior during social interaction test. No behavioral changes were detected in anxiety, memory and locomotion. All in all, dopaminergic cells were present both in the mice and human MRR, and manipulation of dopaminergic neurons of the MRR elicited a specific social response.

Tyrosyl-DNA phosphodiesterase 1 (TDP1) is a human DNA repair protein. It is a member of the phospholipase D family based on the structure similarity. TDP1 is a key enzyme involved in repairing stalled topoisomerase 1 (TOP1)-DNA complexes. Previously we obtained with the CRISPR/Cas9 method HEK293A cells with the homozygous knockout of the Tdp1 gene and used knockout cells as a cellular model for studying the mechanisms of anticancer therapy. In this work we studied for the first time by transcriptomic analysis the effect of Tdp1 gene knockout on genes expression changes in human HEK293A cell line. We received original data that may indicate a role of TDP1 in other process besides repair of DNA-TOP1 complex. The differentially expressed genes (DEGs) analysis revealed that TDP1 could be involved in different processes such as cell adhesion and communication, spermatogenesis, mitochondrial function, neurodegeneration, cytokine response, and MAPK pathway signaling.

Much research has been conducted to determine how hair regeneration is regulated, as this could provide therapeutic, cosmetic, and even psychological interventions for hair loss. The current study focused on the hair growth effect and effective utilization of fatty oil obtained from Bryde's whales through high-throughput DNA microarray approach in conjunction with immunohistochemical observations. The research also examined the mechanisms and factors involved in hair growth. In an experiment using female C57BL/6J mice, the vehicle control group (VC: propylene glycol: ethanol: water), the positive control group (MXD: 3% minoxidil), and the experimental group (WO: 20% Whale Oil) were topically applied to the back of the mouse. The results showed that 3% MXD and 20% WO were more effective than VC in promoting hair growth, especially 20% WO. Furthermore, in hematoxylin and eosin-stained skin tissue, an increase in the number of hair follicles and subcutaneous tissue thickness was observed with 20% WO. Whole-genome transcriptomic analysis also showed that 20% WO may have lower stress- and inflammation-related responses than 3% MXD. Therefore, whale oil can be expected to be used as a safe hair growth agent.

Matrix metalloproteinases have been implicated in muscular dystrophy progression and recent studies described the role of MMP-10 in skeletal muscle pathology of young dystrophic mice. Nevertheless, its implication in dystrophin deficient hearts is still missing. Here, we aimed at investigating MMP-10 implication in severe muscular dystrophic progression and characterize MMP-10 loss in skeletal and cardiac muscles of aged dystrophic mice. We examined the histopathological effect of MMP-10 ablation in aged mdx mice, both in the hind limb muscles and heart tissues. We have found that MMP-10 loss compromises survival rates of aged mdx mice, with skeletal and cardiac muscles developing a chronic inflammatory response. Our findings indicate that MMP-10 is implicated in severe muscular dystrophy progression, identifying a new area of investigation that could lead to future therapies for dystrophic muscles.

Conditional Privacy Preserving Authentication (CPPA) schemes are an effective way of securing communications in Vehicular Adhoc Networks (VANETs), as well as ensuring user privacy and accountability. Cryptanalysis plays a crucial role in pointing out the vulnerabilities in existing schemes to enable the development of more resilient ones. In 2019, Zhang proposed a CPPA scheme for VANET security (PA-CRT), based on identity batch verification (IBV) and Chinese remainder theorem (CRT). In 2023, this scheme was crypt-analyzed by Tao. In this paper we provide our own crypt analysis of Zhang’s scheme and propose counter measures to mitigate Tao’s attacks. Furthermore, in 2021, Xiong proposed a Certificateless Aggregate Signature (CLAS) scheme which was cryptanalyzed by Shim in 2023. Xiong subsequently proposed a modified CLAS scheme which is also cryptanalyzed in this paper.

With the ongoing fifth-generation cellular network (5G) deployment, electromagnetic field exposure has become a critical concern. However, measurements are scarce, and accurate electromagnetic field reconstruction in a geographic region remains challenging. This work proposes a conditional Generative Adversarial Network to address this issue. The main objective is to reconstruct the electromagnetic field exposure map accurately according to the environment’s topology from a few sensors located in an outdoor urban environment. The model is trained to learn and estimate the propagation characteristics of the electromagnetic field according to the topology of a given environment. In addition, the conditional Generative Adversarial Network based electromagnetic field mapping is compared with simple kriging. Results show that the proposed method produces accurate estimates and is a promising solution for exposure map reconstruction.

Classic game theory is an important field with a long tradition of useful results. Recently, the quantum versions of classical games, such as the Prisoner's Dilemma (PD), have attracted a lot of attention. Similarly, state machines and specifically finite automata have also been under constant and thorough study for plenty of reasons. The quantum analogues of these abstract machines, like the quantum finite automata, have been studied extensively. In this work, we examine some well-known game conditional strategies that have been studied within the framework of the repeated PD game. Then, we try to associate these strategies to proper quantum finite automata that receive them as inputs and recognize them with probability 1, achieving some interesting results. We also study the quantum version of PD under the Eisert-Wilkens-Lewenstein scheme, proposing a novel conditional strategy for the repeated version of this game.

This paper is devoted to change-point detection using only the ordinal structure of a time series. A statistic based on the conditional entropy of ordinal patterns characterizing the local up and down in a time series is introduced and investigated. The statistic requires only minimal a priori information on given data and shows good performance in numerical experiments.

Research for a theory of quantum gravity has recently led to the use of presheaf topos. Quantum uncertainty is linked to the truth values of intuitionistic logic. This paper proposes transposing this model into a classic probability context, that of conditional mathematical expectations. A simulation of Brownian motion is offered for illustrative purposes.

In this paper, a novel deep learning approach based on conditional FLOW is proposed for sea clutter augmentation. Sea clutter data augmentation is important for testing detection algorithms for maritime remote sensing and surveillance due to the expensive and time-consuming nature of sea clutter data acquisition. While the conventional parametric methods face challenges in finding appropriate distributions and modeling time correlations of the sea clutter data, the proposed deep learning approach, GCC-FLOW , can learn the data distribution from the data without explicitly defining a mathematical model. Furthermore, unlike the existing generative deep learning approaches, the proposed GCC-FLOW is able to synthesize sea clutter data of arbitrary length with the stable autoregressive structure using conditional FLOW . In addition, the proposed algorithm generates sea clutter data not only with the same characteristics of the training data, but also with the interpolated characteristics of different training data by introducing a global condition variable corresponding to the target characteristic such as sea state. Experimental results demonstrate the effectiveness of the proposed GCC-FLOW in generating sea clutter data of arbitrary length under different sea state conditions.

Facial recognition systems are widely used systems around the globe. Their applications in real world scenarios like law enforcement, surveillance, ID card identification, information security, access control and many more has made them very important in today’s world. These systems have shown promising results and excellent performance; however, these systems need tremendous number of facial images for training before they are implemented in the real-world scenarios. The problem arises when we face lack of training images due to which the performance of such systems decreases exponentially. The problem becomes even worse when there is only one image per subject for training our facial recognition system, the probe image might contain variation like illumination, expression and disguise which are hard to be accurately recognized. Generative models have achieved great success for handling the lack of training data by generating synthetic data that resembles the original data. We have created a new method by fine tuning the basic Conditional Generative Adversarial Network (CGAN) to generate synthetic facial images provided only single image per subject. These synthetic facial images contain six variations that are smile, anger, stare, illumination and disguise. We increased the size of the dataset and then applied a convolutional neural network for facial recognition, which improved the accuracy of our system from 0.76 to 0.99.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

This paper studies single change-point detection in the volatility of a class of parametric conditional heteroscedastic autoregressive nonlinear (CHARN) models. The conditional least-squares (CLS) estimators of the parameters are defined and are proved to be consistent. A Kolmogorov-Smirnov type-test for change-point detection is constructed and its null distribution is provided. An estimator of the change-point location is defined. Its consistency and its limiting distribution are studied in detail. A simulation experiment is carried out to assess the performance of the results which are also applied to two sets of real data.

It is a challenging issue to provide a secure and conditional anonymous authentication scheme in vehicle ad hoc networks(VANETs) with low storage space and computational cost. In 2008, Lu et al. [8] proposed an conditional privacy preservation scheme called ECPP protocol. The ECPP protocol provides conditional privacy preservation to vehicles in VANETs, that is, on one hand vehicles can achieve anonymous authentication in the network, on the other hand allow to be traced and revoked if necessary. However, ECPP scheme suffers from large storage and high computational cost. In our scheme, an improved protocol based on the concept of ECPP protocol has been proposed, which uses minimal interaction steps, little storage space and less computation overhead to achieve more efficiency conditional privacy preservation(MECPP) scheme in VANETs.

Automated skin lesion analysis is one of the trending fields that has gained attention among the dermatologists and healthcare practitioners. Skin lesion restoration is an essential preprocessing step for lesion enhancements for accurate automated analysis and diagnosis. Digital hair removal is a non-invasive method for image enhancement by solving the hair-occlusion artefact in previously captured images. Several hair removal methods were proposed for skin delineation and removal. However, manual annotation is one of the main challenges that hinder the validation of these proposed methods on a large number of images or using benchmarking datasets for comparison purposes. In the presented work, we propose a realistic hair simulator based on context-aware image synthesis using image-to-image translation techniques via conditional adversarial generative networks for generation of different hair occlusions in skin images, along with the ground-truth mask for hair location. Besides, we explored using three loss functions including L1-norm, L2-norm and structural similarity index (SSIM) to maximise the synthesis quality. For quantitatively evaluate the realism of image synthesis, the t-SNE feature mapping and Bland-Altman test are employed as objective metrics. Experimental results show the superior performance of our proposed method compared to previous methods for hair synthesis with plausible colours and preserving the integrity of the lesion texture.

UPF3B is a constituent of the classical nonsense-mediated mRNA decay (NMD) pathway that degrades both the aberrant transcripts and a set of physiological transcripts. In higher eukaryotes, UPF3B have significant biochemical functions in diverse cellular processes including NMD and translation. UPF3B plays a crucial role in neuronal development and differentiation. Next-generation sequencing technologies identified several loss-of-function mutations in the UPF3B gene that results in neuro-developmental disorders in humans. To uncover the mechanistic role of UPF3B in neuronal functions, we have generated the UPF3B-knockout mammalian cell line model system using CRISPR-Cas9 gene editing method. RNA-Sequencing Analysis of cellular transcriptome from UPF3B-KO cells identified specific genes involved in cell growth and neuronal functions. Altered expression of genes related to the axon guidance pathway delineated the UPF3B function to regulate the neuron-specific genes. Functional enrichment analysis identified the genes involved in the disorders related to mental health and intellectual disability. Our study has the potential to identify the direct players of intellectual disability and will have broader implications.

Excess consumption of a high-fat diet has been identified as one of the contributing factors for obesity. Women are at higher risk for adult obesity than men, predisposing them to a different set of detrimental disease conditions. Furthermore, aging studies show that physiological decline also has a serious impact on changes in the endocrine properties of white adipose tissue. Howev-er, there is still relatively little known about the factors associated with obesity and aging and their compounding impact on women’s health. To investigate adipocytokine secretion profile changes, female C3H/HeJ mice were induced to obesity through long-term consumption of a high-fat diet. Weight gain measurements and Echo MRI analysis of fat composition showed in-creases were a due solely to the high fat content in the diet. Adipocytokine secretions were ana-lyzed in media conditioned from harvested visceral fat tissue that was organ cultured ex-vivo. Adipocytokine analysis across diets and age showed significant increases in Adiponectin and Leptin secretion in high-fat diets, accelerated increases in Resistin secretion with high-fat diets. Aging induced increased secretion of Lipcalin-2, Pentraxin-3 and Serpin E1, MCP-1 and ICAM-1, regardless of diet. Furthermore, comparisons of organoid cultured protein secretions and flash-frozen tissue samples differed greatly, suggesting the WAT organoid cultures may yield information more reflective of in situ conditions. Taken together, our results show that diet and aging significantly impact secretions from adipose tissue, that may contribute to women’s health issues.

In estimating logistic regression models, convergence of the maximization algorithm is critical, however, this may fail. Numerous bias correction methods for maximum likelihood estimates of the parameters have been conducted for cases of complete data sets and also longitudinal models. For binary response fixed effects panel data model, the conditional logit estimator is consistent for balanced data. When faced with missing covariates problem, researchers opt for various imputation techniques to make the data complete and without loss of generality consistent estimates still suffice asymptotically. For maximum likelihood estimates of the parameters for logistic regression in cases of imputed covariates, the optimal choice of an imputation technique which yields the best estimates with minimum variance is still elusive. The main aim of this paper is to examine the behaviour of the Hessian matrix with optimal values of the imputed covariates vector which will make the Newton-Raphson algorithm to converge faster through a reduced absolute value of the product of the score function and the inverse fisher information component. We focus on a method used to modify the conditional likelihood function through partitioning of the covariate matrix. We also confirm from the moduli of the Hessian matrices that the log likelihood of a panel data logistic model has a global maximum as the parameter estimates. Simulation results reveal that model based simulation perform better than classical imputation techniques yielding estimates with smaller bias and higher precision for the conditional maximum likelihood estimation of nonlinear panel models with single fixed effects.

Congenital Disorders of Glycosylation (CDG) are a heterogenous group of primarily autosomal recessive mendelian diseases caused by disruptions in the synthesis of lipid linked oligosaccha-rides and their transfer to proteins. CDGs affect multiple organ systems and vary in presentation, even within families. Here we describe a chemically induced mouse mutant, tvrm76, with early onset photoreceptor degeneration. The recessive mutation was mapped to Chromosome 9 and as-sociated with a missense mutation in the Dpagt1 gene encoding UDP-N-acetyl-D-glucosamine:dolichyl-phosphate N-acetyl-D-glucosaminephosphotransferase (EC 2.7.8.15). The mutation is predicted to cause a substitution of aspartic acid with glycine at residue 166 of DPAGT1. Increased expression of Ddit3, and elevated levels of HSPA5 (BiP) sug-gest the presence of early-onset endoplasmic reticulum (ER) stress. These changes were associated with induction of photoreceptor apoptosis in tvrm76 retinas. Mutations in human DPAGT1 cause Myasthenic Syndrome 13 and severe forms of Congenital Disorder of Glycosylation Type Ij. In contrast, Dpagt1tvrm76 homozygous mice present with congenital photoreceptor degeneration without overt muscle or muscular junction involvement. Our results suggest the possibility of DPAGT1 mutations in human patients that present primarily with retinitis pigmentosa with little or no muscle disease. Variants in DPAGT1 should be considered when evaluating cases of non-syndromic retinal degeneration.

Purpose: Inducible Slc4a11 KO leads to corneal edema by disruption of the pump and barrier functions of the corneal endothelium (CE). The loss of Slc4a11 NH3-activated mitochondrial uncoupling leads to mitochondrial membrane potential hyperpolarization-induced oxidative stress. The goal of this study is to investigate the link between oxidative stress and failure of pump and barrier functions and test different approaches to revert the process. Methods: Mice homozygous for Slc4a11 Flox and Estrogen receptor –Cre Recombinase fusion protein alleles at 8 weeks of age were fed Tamoxifen (Tm) enriched chow (0.4 g/Kg) for 2 weeks, and controls were fed normal chow. During the initial 14 days, Slc4a11 expression, corneal thickness (CT), stromal [lactate], Na+-K+ ATPase activity, mitochondrial superoxide levels, expression of lactate transporters, and activity of key kinases were assessed. In addition, barrier function was assessed by fluorescein permeability, ZO-1 tight junction integrity, and cortical cytoskeleton F-actin morphology. Results: Tm induced a rapid decay in Slc4a11 expression that was 84% complete at 7 days and 96% at 14 days of treatment. Superoxide levels increased significantly by day 7; CT and fluorescein permeability by day 14. Tight junction ZO-1 distribution and cortical cytoskeleton were disrupted at day 14 concomitant with decreased expression of Cldn1 yet an increase in tyrosine phosphorylation. Stromal lactate increased by 60%, Na+-K+ATPase activity decreased by 40%, and expression of lactate transporters MCT2 and MCT4 significantly decreased, but MCT1 was unchanged at 14 days. Src kinase was activated but not Rock, PKCα, JNK, or P38Mapk. Mitochondrial antioxidant Visomitin (SkQ1, mitochondrial targeted antioxidant) or Src kinase inhibitor eCF506 significantly slowed the increase in CT, with concomitant decreased stromal lactate retention, improved barrier function, reduced Src activation and Cldn1 phosphorylation, and rescued MCT2 and MCT4 expression. Conclusions: Slc4a11 KO-induced CE oxidative stress triggered increased Src kinase activity that results in perturbation of pump components and barrier function of the CE.

Object segmentation on remotely-sensed images: aerial (or very high resolution, VHS) images and satellite (or high resolution, HR) images, has been applied to many application domains, especially road extraction in which the segmented objects are served as a mandatory layer in geospatial databases. Several attempts in applying deep convolutional neural network (DCNN) to extract roads from remote sensing images have been made; however, the accuracy is still limited. In this paper, we present an enhanced DCNN framework specifically tailored for road extraction on remote sensing images by applying landscape metrics (LMs) and conditional random fields (CRFs). To improve DCNN, a modern activation function, called exponential linear unit (ELU), is employed in our network resulting in a higher number of and yet more accurate extracted roads. To further reduce falsely classified road objects, a solution based on an adoption of LMs is proposed. Finally, to sharpen the extracted roads, a CRF method is added to our framework. The experiments were conducted on Massachusetts road aerial imagery as well as THEOS satellite imagery data sets. The results showed that our proposed framework outperformed Segnet, the state-of-the-art object segmentation technique on any kinds of remote sensing imagery, in most of the cases in terms of precision, recall, and F1.

The pervasive presence of atmospheric pollution, particularly polycyclic aromatic hydrocarbons such as 7,12-dimethylbenz(a)anthracene, instigates aberrant cellular and tissue conditions, precipitating oxidative damage and inflammatory cascades conducive to the onset of cancer, notably mammary cancer. Given the hepatic metabolism of 7,12-dimethylbenz(a)anthracene, the imperative of employing natural antioxidants becomes apparent. In this study, we delve into the antioxidant and hepato-protective properties of Pistacia lentiscus against 7,12-dimethylbenz(a)anthracene-induced toxicity, alongside exploring its potential anticancer attributes. Our investigations unveil Pistacia lentiscus's anti-proliferative efficacy against human breast cancer cell lines. Notably, 7,12-dimethylbenz(a)anthracene-intoxication escalates body weight, disrupts lipid profiles, and incites serum oxidative damage. Concurrently, hepatic and renal oxidative stress ensue, accompanied by heightened antioxidant enzyme activity in the 7,12-dimethylbenz(a)anthracene-exposed-group compared to controls (p<0.05). Nonetheless, Pistacia lentiscus co-administration rectifies biochemical imbalances, significantly attenuates oxidative stress aberrations, and augments antioxidant enzyme responses (p<0.05). Importantly, histological analysis evinces Pistacia lentiscus's shielding effect against 7,12-dimethylbenz(a)anthracene induced hepatocyte injury and steatosis. Our findings underscore Pistacia lentiscus's robust anti-proliferative, antioxidant, and hepato-protective capacities, mitigating metabolic disturbances, oxidative stress propagation in liver and kidney functions, and potential histological alterations, thereby impeding 7,12-dimethylbenz(a)anthracene-induced mammary cancer initiation. We posit that Pistacia lentiscus may serve as a prophylactic agent against breast cancer instigated by this carcinogen.

Generative models for images, audio, text and other low-dimension data have achieved great success in recent years. Generating artificial human movements can also be useful for many applications, including improvement of data augmentation methods for human gesture recognition. The object of this research is to develop a generative model for skeletal human movement, allowing to control the action type of generated motion while keeping the authenticity of the result and the natural style variability of gesture execution. We propose to use a conditional Deep Convolutional Generative Adversarial Network (DC-GAN) applied to pseudo-images representing skeletal pose sequences using Tree Structure Skeleton Image format. We evaluate our approach on the 3D-skeleton data provided in the large NTU RGB+D public dataset. Our generative model can output qualitatively correct skeletal human movements for any of its 60 action classes. We also quantitatively evaluate the performance of our model by computing Frechet Inception Distances, which shows strong correlation to human judgement. Up to our knowledge, our work is the first successful class-conditioned generative model for human skeletal motions based on pseudo-image representation of skeletal pose sequences.

In this work, we treat a prediction problem via the conditional hazard function of a scalar response variable Y given a functional random variable X by using the local linear technique. The main purpose of this paper is to investigate the asymptotic normality of the nonparametric estimator of the conditional hazard function, under some general conditions. A simulation study, conducted to assess finite sample behavior, demonstrates the superiority of our method than the standard kernel method

In this paper, a controlled-phase-flip (P-CPF) gate using the polarisation and orbital angular momentum degrees of freedom for single-photon two-qubit quantum logic is proposed. This is critical to the realisation of quantum cluster states and graph networks using transverse degrees of freedom. A generalisation of the proposed scheme to arbitrary number and kinds of degrees of freedom, for optical systems, as well as arbitrary operations to be conditionally performed is proposed.

In a recent article, Smoom et al. identified an important amino acid variation in the helicase RTEL1 of the Algerian mouse (Mus spretus). Since the latter has telomeres five times shorter than the laboratory mouse (belonging to the Mus musculus species), they introduced this variation in laboratory mice, in order to obtain an engineered strain with human-length telomeres. Succeeding in doing this, they established the “Telomouse” strain. Here I demonstrate that, in reality, Mus spretus does not show this variation: the key amino acid is conserved in all rodent species, which all have human-length telomeres (including wild Mus musculus species). This finding in no way compromises the value of the research of Smoom et al. and the utility of the Telomouse strain. Rather, it raises the question of how the telomere length of Mus musculus (as a species) should be considered and the important consequences it has on studies on inter-species comparison.

Ranaviruses have been associated with rising numbers of mass die-offs in amphibian populations globally. With life-stages occupying different environments and presenting distinct physiologies, amphibian of different ages are likely to play an important role in pathogen persistence. To assess the potential role of post-metamorphic amphibians as a Ranavirus reservoir, we performed a bath-exposure study on wood frogs using environmentally relevant doses (~10³ and ~10⁴ PFU/mL) of wild-type (WT) and knockout Frog virus 3 (FV3), deficient for the vIF-2α immune-evasion gene, the effects of which have never been addressed in post-metamorphic anurans. We observed 42% infection prevalence and low mortality (10%) across the virus challenges, with half of the mortalities attributable to ranavirosis. Prevalence and viral loads followed a dose-dependent pattern. Notably, when exposed to the vIF-2α knockout (DvIF-2α) FV3, individuals exhibited significantly decreased growth and increased lethargy in comparison to WT FV3 treatments. Although 85% of individuals in the virus treatments exhibited stereotypic signs of ranavirosis throughout the experiment, at termination (40 days post exposure) most individuals were clear of signs of infection. Overall, this study provides evidence that even a single short time exposure to environmentally relevant doses of Ranavirus may cause sublethal infections in post-metamorphic amphibians, thus indicating their possible role as a reservoir for this pathogen.

microRNAs can cause male infertility by impacting sperm quality and impaired spermatogenesis. Since the miR-125 family plays an important role in regulating embryo development, but the function of miR-125b-2 in male reproduction remains unknown. In this study, we prepared a model of miR-125b knockout (KO) mice. Among the KO mice, the progeny test showed that litter sizes decreased significantly and the rate of non-parous females increased significantly (p<0.05). At the same time, the testosterone concentration increased significantly (p<0.01), with the remarkable decrease for estradiol (p<0.05). Moreover, sperm count decreased obviously (p<0.05) and the percentage of abnormal sperms increased significantly (p<0.01). Testicular transcriptome sequencing demonstrated that there were 173 up-regulated genes, including Papolb (PAP), and 151 down-regulated genes in KO mice compared with wild type (WT). KEGG and GO analysis showed many of these genes were involved in sperm mitochondrial metabolism and other cellular biological processes. Meanwhile, the sperm mitochondria DNA (mtDNA) copy number was increased significantly (p<0.01) in KO mice, but the integrity of mtDNA and nuclear DNA (nDNA) had no change. In the top 10 up-regulated genes, as a testis specific expressing gene, PAP can affect the process of spermatogenesis. Western blotting and Luciferase Assay validated that PAP was the target of miR-125b-5p. Intriguingly, we also found that both miR-125b and PAP were only highly expressed in germ cells (GC) instead of Leydig cells (LC) and Sertoli cells (SC), and miR-125b-5p could target PAP to regulate TM3 cell secretion of testosterone (p<0.05). Our study firstly demonstrated that miR-125b-2 could regulate testosterone secretion by directly targeting PAP and increase sperm mtDNA copy number to affect semen quality. The study indicated that miR-125b-2 had a positive influence on the reproductive performance of animal and could be a potential therapeutic target for male infertility.

Background: Obesity and its attendant conditions have become major health problems worldwide and is currently ranked as the fifth most common leading cause of death globally. Complex environmental and genetic factors are the cause of the current obesity epidemic. Diet, lifestyle, chemical exposures, and other confounding factors are difficult to manage in humans. The mice model is helpful in researching genetics BW gain because genetic and environmental risk factors can be controlled in mice. Studies in mouse strains with various genetic backgrounds and established genetic structures provide unparalleled opportunities to find and analyze trait-related genomic loci. In this study, we used the Collaborative Cross (CC), a large panel of recombinant inbred mouse strains, to present a predictive study using CC mice SMAD4 knockout profiles to understand and effectively identify predisposition to body weight gain. Materials and Methods: Male C57Bl / 6J Smad4+/- mice were mated with female mice from 10 different CC lines to create F1 mice (Smad4+/- x CC). Body weight (BW) was measured weekly until week 16, then monthly until the end (week 48). The heritability H2 of the assessed traits was estimated and presented. Comparative analysis of various machine learning algorithms for predicting the BW changes and genotype of mice was conducted. Results and conclusions: Our data showed that the body weight records of F1 mice with different CC lines differed between wildtype and mutant Smad4 mice during the experiment. Genetic background affects weight gain and some lines gained more weight in the presence of Smad4 knockout, while others gained less, but in general, the mutation caused overweight mice, except for a few lines. In both control and mutant groups, female %BW had a higher heritability H2 value than males. Additionally, both sexes with wildtype genotypes showed higher heritability values than the mutant group. Logistic Regression provides the most accurate mouse genotype predictions using machine learning. We plan to validate the proposed method on more CC lines and mice per line to expand machine learning for BW prediction.

Yerba maté, an herbal tea derived from Ilex paraguariensis, has previously been reported to be protective against obesity-related and other cardiometabolic disorders. Using high-resolution respirometry and reverse-phase high-performance liquid chromatography, the effects of four weeks of yerba maté consumption on mitochondrial efficiency and cellular redox status in skeletal muscle, adipose, and liver, tissues highly relevant to whole body metabolism, were explored in healthy adult mice. Yerba maté treatment increased mitochondrial oxygen consumption in adipose, but not in other tissues examined. Yerba maté increased ATP concentration in skeletal muscle and decreased ATP concentration in adipose. Combined with observed changes in oxygen consumption, these data yielded a significantly higher ATP:O2, a measure of mitochondrial efficiency, in muscle and a significantly lower ATP:O2 in adipose, which were consistent with yerba maté-induced weight loss. Yerba maté treatment also altered the hepatic glutathione (GSH)/glutathione disulfide (GSSG) redox potential to a more reduced redox state, suggesting potential protective effects against oxidative stress and preservation of cellular function. Together, these data indicate beneficial, tissue-specific effects of yerba maté supplementation on mitochondrial bioenergetics and redox states in healthy mice that are protective against obesity.

Background and Objective: In an experiment designed to explore the mechanisms of fludrocortisone-induced high blood pressure, we serendipitously observed aortic aneurysms in mice infused with fludrocortisone. The purpose of this study was to investigate whether fludrocortisone induces aortic pathologies in both normocholesterolemic and hypercholesterolemic mice. Methods and Results: Male adult C57BL/6J mice were infused with either vehicle (85% polyethylene glycol 400 (PEG-400) and 15% dimethyl sulfoxide (DMSO); N=5) or fludrocortisone (12 mg/kg/day dissolved in 85% PEG-400 and 15% DMSO; N=15) for 28 days. Fludrocortisone-infused mice had higher systolic blood pressure, compared to mice infused with vehicle. Fludrocortisone induced aortic pathologies in 4 of 15 mice with 3 having pathologies in the ascending and aortic arch regions and 1 having pathology in both the ascending and descending thoracic aorta. No pathologies were noted in abdominal aortas. Subsequently, we infused either vehicle (N=5/group) or fludrocortisone (N=15/group) into male ApoE -/- mice fed a normal laboratory diet or LDL receptor -/- mice fed either normal or Western diet. Fludrocortisone increased systolic blood pressure, irrespective of mouse strain or diet. In ApoE -/- mice infused with fludrocortisone, 2 of 15 mice had ascending aortic pathologies, but no mice had abdominal aortic pathologies. In LDL receptor -/- mice fed normal diet, 5 had ascending/arch pathologies, 1 had pathologies in the ascending, arch, and suprarenal aortic regions. In LDL receptor -/- mice fed Western diet, 2 died of aortic rupture in either the descending thoracic or abdominal region, and 2 of the 13 survived mice had ascending/arch aortic pathologies. Aortic pathologies included hemorrhage, wall thickening or thinning, or dilation. Given the low incidence, only ascending aortic diameter in LDLR -/- mice fed Western diet reached statistical significance, compared to their vehicle. Conclusion: Fludrocortisone induces aortic pathologies independent of hypercholesterolemia. The findings in mouse studies have the potential to provide caution to people who are taking or have taken fludrocortisone that could have an increased risk of aortic pathologies.

: The interaction of the Activating Transcription Factor 6 (ATF6), a key effector of the unfolded protein response (UPR) in the endoplasmic reticulum, with the neuronal calcium sensor Downstream Regulatory Element Antagonist Modulator (DREAM) is a potential therapeutic target in neurodegeneration. Modulation of the interaction ATF6-DREAM with repaglinide (RP) induced neuroprotection in a model of Huntington´s disease. Amyotrophic Lateral Sclerosis (ALS) is a neurodegenerative disorder with no cure, characterized by the progressive loss of motoneurons resulting in muscle denervation, atrophy, paralysis and death. The aim of this work was to investigate the potential therapeutic significance of DREAM as a target for intervention in ALS. We found that the expression of the DREAM protein was reduced in the spinal cord of SOD1G93A mice compared to wild type littermates. RP treatment improved motor strength and reduced the expression of the ALS progression marker collagen type XIX1 (Col191 mRNA) in the quadriceps muscle in SOD1G93A mice. Moreover, treated SOD1G93A mice showed reduced motoneuron loss and glial activation and increased ATF6 processing in the spinal cord. These results indicate that the modulation of the DREAM-ATF6 interaction ameliorates ALS symptoms in SOD1G93A mice.

Proteinuria is known to be associated with all-cause and cardiovascular mortality, and nephrotic syndrome is defined by the level of proteinuria and hypoalbuminemia. With advances in medicine, new causative genes for genetic kidney diseases are being discovered increasingly frequently. We reviewed articles on proteinuria/nephrotic syndrome, focal segmental glomerulosclerosis, membranous nephropathy, diabetic kidney disease/nephropathy, hypertension/nephrosclerosis, Alport syndrome, and rare diseases, which have been studied in mouse models. Significant progress has been made in understanding the genetics and pathophysiology of kidney diseases thanks to advances in science, but research in this area is ongoing. In the future, genetic analyses of patients with proteinuric kidney disease/nephrotic syndrome may ultimately lead to personalized treatment options.

Background: Genome-wide association studies have identified the chromosome 9p21 locus as one of the most important genetic risk factors for cardiovascular disease. However, the mechanism by which this locus promotes disease remains unclear due to difficulty identifying the causal genes and lack of a suitable animal model. Methods and Results: A total of 180 coronary artery autopsy specimens were analyzed histopathologically. The genotype of 9p21 (rs1333049) was not associated with any coronary risk factors nor the vulnerable plaque phenotype, but carriers of 9p21 risk allele did demonstrate more lesional calcification. To extend these studies into an animal model, mice with a targeted deletion of the orthologous 70-kb non-coding interval on chromosome 4 (chr4^D70kb/D70kb) were bred onto ApoE^-/- and fed with high fat diet. Targeted deletion of the 9p21 risk interval increased susceptibility to atherosclerotic plaque progression, but did not affect plaque rupture in the tandem stenosis model. Coronary risk factors such as body weight, blood pressure, lipid, and glucose levels did not differ between genotypes. Von Kossa staining revealed that chr4^D70kb/D70kb, ApoE^-/- developed more calcification in the plaque compared with chr4^+/+, ApoE^-/- mice, and that this this change was accompanied by increased aortic mRNA expression of Runx2, a key osteogenic transcription factor. Primarily cultured smooth muscle cells from chr4^D70kb/D70kb were hyperproliferative, and showed a calcification-prone phenotype after exposure to high-phosphate medium. Treatment with Palbociclib, a selective inhibitor of cyclin-dependent kinase 4/6, reduced mRNA expression of osteogenic genes in smooth muscle cells. Conclusion: Results from human and mouse studies indicate that the 9p21 non coding risk interval is associated with larger atherosclerotic plaque burden, but not with plaque rupture. 9p21 may promote lesion expansion by inducing the proliferation of de-differentiated and osteogenic smooth muscle cells.

Cysteine-glutathione mixed disulfide (CySSG), a prodrug of glutathione (GSH) --the “Master Antioxidant”, was found to be orally bioavailable in mice, and protected against a toxic dose of acetaminophen. If oral bioavailability can also be demonstrated in humans, this suggests a wide range of applicability for CySSG.

Rats, including those of the Sprague Dawley strain, may kill mice. Because of this muridical behavior, it is standard practice in many research animal housing facilities to separate mice from rats (i.e., the predators) to minimize stress for the mice. We therefore tested the effect of cohousing on the stress levels of mice from either the C57BL/6J (BL6) or the CD1 strain and Sprague Dawley (SD rat) by determining their fecal corticosterone or cortisol metabolites (FCM) concentration and investigated how cohousing impacts a behavioral assay, i.e., conditioned place preference for intragenus (i.e., mouse-mouse or rat-rat) dyadic social interaction (DSI CPP) that had been shown be sensitive to social factors, especially to handling by humans. We found that the two delivery batches of BL6 mice or SD rats, respectively, had different stress levels at delivery that were statistically significant for the BL6 mice. Even so, the BL6 mice cohoused with rats had significantly increased FCM concentrations, indicative of higher stress levels, as compared to (1) BL6 mice housed alone or (2) BL6 mice at delivery. In contrast to their elevated stress levels, the attractiveness for contextual cues associated with mouse-mouse social interaction (DSI CPP) even increased in rat-cohoused BL6 mice, albeit nonsignificantly. Thus, cohousing BL6 mice and rats did not impair a behavioral assay in BL6 mice that had proved to be sensitive to handling stress by humans in our laboratory. SD rats cohoused with BL6- or CD1 mice and CD1 mice cohoused with SD rats showed DSI CPP that was not different from our previously published data on SD rats and BL6 mice of the Jackson- or NIH substrain obtained in the absence of cohousing. Our findings suggest that the effect of cohousing rats and mice under the conditions described above on their stress levels as opposed to their behavior might be less clearcut than generally assumed and might be overriden by conditions that cannot be controlled, i.e., different deliveries. Our findings can help to use research animal housing resources, which usually are limited, more efficiently.

One of the ways to regulate the sensitivity of human cells to the influenza virus is to knock out genes of the innate immune response. Promising targets for the knockout are genes of the interferon-inducible transmembrane protein (IFITM) family, in particular the IFITM3 gene, whose product limits the entry of a virus into the cell by blocking the fusion of the viral and endosomal membranes. In this study, by means of genome-editing system CRISPR/Cas9, monoclonal cell lines with an IFITM3 knockout were obtained based on WI-38 VA13 cells (human origin). It was found that such cell lines are more sensitive to infection by influenza A viruses of various subtypes. Nonetheless, this feature is not accompanied by an increased titer of newly formed viral particles in a culture medium.

Pituitary adenylate cyclase-activating polypeptide receptor 1 (PAC1-R) has a higher affinity for pituitary adenylate cyclase- activating polypeptide (PACAP) than for vasoactive intestinal peptide (VIP). PACAP exerts its neuroprotective effects through PAC1-R. PAC1-R has become a target for drug development, and we targeted PAC1-R to screen small positive allosteric modulator 1 (SPAM1). SPAM1 has a neuroprotective effects, and in the D-galactose (D-gal) mouse model, SPAM1 improved the structure of the hippocampal dentate gyrus and restored the number of neurons. Compared with D-gal model mice, SPAM1 treatment upregulated the expression of Sirtuin 6 (SIRT6) and Lamin B1, and downregulated the expression of YinYang 1 (YY1) and p16. Consistent with this, the same results were obtained in senescent RGC-5 cells. Meanwhile, SPAM1 was also found to up-regulate SIRT6 and down-regulate YY1 expression in normal RGC-5 cells. Then, we further explored the mechanism of SPAM1 neuroprotection by whole transcriptome sequencing and proteomic analysis, and found that SPAM is involved in the longevity regulating pathway, and confirmed the up-regulation of neurofilament light polypeptide and neurofilament medium polypeptide by western blot, thus laying a pharmacological foundation for SPAM1 as a therapeutic agent for neurodegenerative diseases. polypeptide and neurofilament medium polypeptide. Thus, it lays a pharmacological foundation for SPAM1 as a therapeutic drug for neurodegenerative diseases.

The interpretation of land use and land cover (LULC) is an important issue in the fields of high-resolution remote sensing (RS) image processing and land resource management. Fully training a new or existing convolutional neural network (CNN) architecture for LULC classification requires a large amount of remote sensing images. Thus, fine-tuning a pre-trained CNN for LULC detection is required. To improve the classification accuracy for high resolution remote sensing images, it is necessary to use another feature descriptor and to adopt a classifier for post-processing. A fully connected conditional random fields (FC-CRF), to use the fine-tuned CNN layers, spectral features, and fully connected pairwise potentials, is proposed for image classification of high-resolution remote sensing images. First, an existing CNN model is adopted, and the parameters of CNN are fine-tuned by training datasets. Then, the probabilities of image pixels belong to each class type are calculated. Second, we consider the spectral features and digital surface model (DSM) and combined with a support vector machine (SVM) classifier, the probabilities belong to each LULC class type are determined. Combined with the probabilities achieved by the fine-tuned CNN, new feature descriptors are built. Finally, FC-CRF are introduced to produce the classification results, whereas the unary potentials are achieved by the new feature descriptors and SVM classifier, and the pairwise potentials are achieved by the three-band RS imagery and DSM. Experimental results show that the proposed classification scheme achieves good performance when the total accuracy is about 85%.

Increased sugar intake is implicated in Type-2 diabetes and fatty liver disease. Mechanisms by which glucose and fructose components promote these conditions are unclear. We hypothesize that alterations in intestinal metabolite and microbiota profiles specific to each monosaccharide are involved. Two groups of six adult C57BL/6 mice were fed for 10-weeks with a diet where either glucose or fructose was the sole carbohydrate component (G and F, respectively). A third group was fed with normal chow (N). Fecal metabolites were profiled every 2-weeks by ¹H NMR and microbial composition was analysed by real-time PCR (qPCR). Glucose tolerance was also periodically assessed. N, G and F mice had similar weight gains and glucose tolerance. Multivariate analysis of NMR profiles indicated that F mice were separated from both N and G, with decreased butyrate and glutamate and increased fructose, succinate, taurine, tyrosine and xylose. Compared to N and G, F mice showed a shift in microbe populations from gram-positive Lactobacillus spp. to gram-negative Enterobacteria species. Substitution of normal chow carbohydrate mixture by either pure glucose or fructose for 10 weeks did not alter adiposity or glucose tolerance. However, F G and N mice generated distinctive fecal metabolite signatures with incomplete fructose absorption as a dominant feature of F mice.

Norepinephrine plays an important role in modulating memory consolidation and evocation through its beta-adrenergic receptors (Adrβ: β1, β2 and β3), which are expressed in the hippocampus (HC) and amygdala (AMY). Here we hypothesized that multisensory stimulation would reverse the memory impairment caused by the inactivation of the Adrβ3 with consequent inhibition of sustained glial-mediated inflammation and glutamatergic depuration. To test this, 21- and 86-day-old Adrβ3KO mice and respective controls underwent to (i) gustative and olfactive stimuli of positive and negative valence associated with (ii) intellectual challenges to reach the food in addition to (iii) objects in hidden places (iv) foraging for 8 weeks followed by (v) analysis of GFAP, Iba-1 and EAAT2 protein expression in the HC and AMY. While this protocol restored the memory impairment when applied to Adrβ3KO animals immediately after weaning, it had no effect when applied to adult animals. In fact, we observed that aging worsens the memory of Adrβ3KO mice. Although no significant expression of GFAP and Iba1 were observed in HC of young and old mice, Adrβ3KO increased EAAT2 expression HC of old mice, while MS didn’t change EAAT2 in young mice but enhanced it expression in older. Relative to AMY of old mice Adrβ3KO increased GFAP expression compared whit WT mice and MS sustained the GFAP expression and increased the EAAT2 expression compared with WT group. These results suggest that a richer and more diverse environment helps to correct memory impairment when applied right after weaning Adrβ3KO animals, also show that the changes in GFAP, Iba1 and EAAT2 expression levels in young and old mice indicate a functional significance in the process of learning and memory and that the control of neuroinflammation in limbic areas mediates this response. They also reinforce the idea that disruption of noradrenergic signaling could be involved in the cognitive impairment observed later in life.

To explore the effect of lily polysaccharide (LP) on immune function and intestinal flora in immunosuppressive mice.The immunosuppressive model was established by intraperitoneal injection of cyclophosphamide (CTX) in mice, and the immunological indexes were measured. The cecal contents of mice were taken, and the DNA of intestinal flora was extracted for 16S DNA sequence analysis.Compared with CTX group, the body weight and thymus index of mice in each treatment group increased significantly, the liver index decreased significantly,the hepatocyte morphology, liver plate and hepatic sinus arrangement of mice in high and low concentration LP groups were relieved in varying degrees, and the contents of IgA and IgG in serum of mice in low concentration LP group and positive control group increased significantly; The contents of TNF-α and IL-6 in colon decreased, while the contents of IL-10 increased significantly. The contents of AST, ALT and MDA in liver decreased significantly, while the content of SOD increased significantly. Compared with the blank group, LP can improve the intestinal flora of immunosuppressive mice , mainly by increasing the abundance of beneficial bacteria such as s24-7, Bacteroides and butyrimionas and reducing the abundance of harmful bacteria such as Prevotella, dorea and adlercreutzia.

The search for more efficacy and fewer toxic effects in cancer treatments is the main objective of research into new therapies. Vincristine (VCR) is a chemotherapeutic used in different types of tumors. Epigallocatechin gallate (EGCG) is a green tea metabolite that has shown an antineoplastic effect in different investigations, so the objective of this work was to evaluate the antitumor effect of the EGCG/VCR combination on tumor volume and survival. To achieve this objective, the solid model of lymphoma L5178Y was used in BALB/c mice with different doses of VCR, EGCG and their combination; Tumor grow and survival time were recorded. Once the tumors were obtained, they were measured and immunohistochemistry was performed for p53, Bcl2 and CD1. The results showed that the EGCG/vincristine combination had a greater antitumor effect that vincristine and EGCG. This can be partly attributed to the fact that the greatest Bcl2 inhibition was present in the combination of EGCG with vincristine. Therefore, it can be concluded that the combination of EGCG with vincristine has a better antineoplastic effect by inhibiting tumor development and increasing survival than both substances independently.

The mouse visual system recently became the most popular model to study the cellular and circuit mechanisms of sensory processing. However, the importance of eye movements in mice only started to be appreciated recently. Eye movements provide a basis for active sensing and deliver insights into various brain functions and dysfunctions. A plethora of knowledge on the central control of eye movements and their role in perception and behaviour arose from work on primates. However, an overview of the known eye movement types in mice and a comparison to primates is missing.Here, we review the eye movement types described to date in mice and compare them to those observed in primates. We discuss the central neuronal mechanisms for their generation and control. Furthermore, we review the mounting literature on eye movements in mice during head-fixed and freely moving behaviours. Finally, we highlight gaps in our understanding and suggest future directions for research.

Background Epidemiological studies have associated plasma galectin-4 (Gal-4) levels with prevalent and incident diabetes, and with increased risk of coronary artery disease, but data regarding possible associations with stroke are lacking. Methods We tested Gal-4 association with prevalent stroke in a population-based cohort, and whether Gal-4 increases after ischemic stroke in mice fed a high-fat diet (HFD). Results Gal-4 was higher in subjects with compared to without prevalent ischemic stroke, and was associated with prevalent ischemic stroke (odds ratio 1.52; 95% confidence interval 1.01-2.30; p=0.048) adjusted for age, sex and covariates of cardiometabolic health. Plasma Gal-4 increased after stroke in both controls and HFD-fed mice, but HFD exposure was devoid of impact in Gal-4 levels. Conclusions This study demonstrates higher plasma Gal-4 levels in both a stroke mouse model and individuals with prevalent stroke.

B lymphocyte development has two DNA recombination processes: V(D)J recombination of the immunoglobulin (Igh) gene variable region and class switching of the Igh constant regions from IgM to IgG, IgA, or IgE. V(D)J recombination is required for successful maturation of B cells from pro-B to pre-B to immature-B and then to mature B cells in the bone marrow. CSR occurs outside of the bone marrow when mature B cells migrate to peripheral lymphoid organs, such as spleen and lymph nodes. Both V(D)J recombination and CSR depend on an “open chromatin” state that makes DNA accessible to specific enzymes, recombination activating gene (RAG), and activation-induced cytidine deaminase (AID). Acetyltransferases GCN5 and PCAF possess redundant functions acetylating histone H3 lysine 9 (H3K9). Here, we generated a mouse model that lacks both GCN5 and PCAF in B cells. We found that double-deficient mice possess low levels of mature B cells in the bone marrow and peripheral organs, an accumulation of pro-B cells in bone marrow, and reduced CSR levels. We conclude that both GCN5 and PCAF are required for B cell development in vivo.

To evaluate the relative importance of IGF-I expression in various cell types for endochon-dral ossification, we quantified the trabecular bone at the secondary spongiosa and epiphysis of the distal femur in 8-12-week-old male mice with a global knockout of the Igf-I gene as well as conditional deletion of the Igf-I gene in osteoblasts, chondrocytes, osteo-blasts/chondrocytes, and their corresponding control wild type littermates. The osteoblast-, chondrocyte- and osteoblast/chondrocyte-specific Igf-I conditional knockout mice were generated by crossing Igf-I floxed mice with Cre transgenic mice in which Cre expression is under the control of Col1α2 or Col2α1 promoter. We found that global disruption of Igf-I resulted in 80% and 70% reduction in bone size, which is defined as total volume, at the secondary spongiosa and epiphysis of the distal femur, respectively. Abrogation of Igf-I in Col1α2-producing osteoblasts, but not Col2α1-producing chondrocytes, decreased bone size by 25% at both the secondary spongiosa and epiphysis while deletion of the Igf-I globally or specifically in osteoblasts or chondrocytes reduced trabecular bone mass by 25%. By contrast, global Igf-I knockout but not conditional knockout of Igf-I in osteoblasts and/or chondrocytes reduced trabecular bone mass in the epiphysis. The reduced trabecu-lar bone mass at the secondary spongiosa in osteoblast- and/or chondrocyte-specific Igf-I conditional knockout mice is caused by reduced trabecular number and increased trabec-ular separation. Immunohistochemistry studies revealed that expression levels of chon-drocyte (COL10, MMP13) and osteoblast (BSP) markers were reduced in the secondary spongiosa and the epiphyses in the global Igf-I knockout mice. Our data indicate that local and endocrine IGF-I actions in bone are pleiotropic and dependent on cell type as well as the bone compartment where IGF-I acts.

To characterize the mechanisms by which the highly-conserved exocyst trafficking complex regulates eye physiology in zebrafish and mice, we focused on exoc5 (aka sec10), a central exocyst component. We analyzed both exoc5 zebrafish mutants and retinal pigmented epithelium (RPE)-specific Exoc5 knockout mice. Exoc5 is present in both the non-pigmented epithelium of the ciliary body and in the RPE. In this study we set out to establish an animal model to study the mechanisms underlying the ocular phenotype and to establish if loss of visual function is induced by postnatal RPE Exoc5-deficiency. Exoc5-/- zebrafish showed smaller eyes, with decreased number of melanocytes in the RPE and shorter photoreceptor outer segments. At 3.5 days post fertilization, loss of rod and cone opsins were observed in zebrafish Tg:exoc5 mutants. Mice with postnatal RPE-specific loss of Exoc5 showed retinal thinning associated with compromised visual function, and loss of visual photoreceptor pigments. This retinal phenotype in Exoc5-/- mice was present at 20-weeks, and the phenotype was more severe at 27-weeks, indicating progressive disease phenotype. We previously showed that the exocyst is necessary for photoreceptor ciliogenesis and retinal development. Here, we report that exoc5 mutant zebrafish and mice with RPE-specific genetic ablation of Exoc5 develop abnormal RPE pigmentation, resulting in retinal cell dystrophy and loss of visual pigments associated with compromised vision. As RPE cells are “downstream” of photoreceptor cells in the visual process, these data suggest exocyst-mediated retrograde communication and dependence between the RPE and photoreceptors.

The evolution of knowledge in biological and medical areas which made possible scientific and technological advances are attributed to anatomical studies, physiology and immunology in animals, contributing to the discovery of prophylactic measures and treatments of diseases that affect humans and animals. Currently, substitution is suggested by alternative methods that do not use laboratory animals, however in vitro methods may never be able to provide similar results to in vivo methods. Mice and rats are the most used animals in experimental researches, the anatomical, histological and genetic differences between species should be carefully evaluated, to better apply the study model and avoid unnecessary waste avoid. This study, aimed at an anatomical comparative and histological relationship between a rat´s and a mouse´s organs, is of great importance in experimental studies. For such, 30 Mus musculus (Swiss) mice and 15 Rattus norvegicus (Wistar) male and heterogenic rats, were used. All animals were kept free of pathogenic microorganisms, with the absence of surgical interventions that could cause anatomical and physiological changes. It was possible to observe significant anatomical and histological differences between spleens, brains, hearts, stomachs and intestines, livers, eyes, lungs and kidneys among species, which will serve as a basis to assist in choosing the most satisfactory research model. Few studies relate specific characteristics among laboratory animals, being restricted to a few veterinary and zoology books. The greater the organic, physiological and anatomical similarities are with the human being, the greater is the applicability of the animals in studies. However, it is not possible to lay down general rules to validate the extrapolation from one species to another.

Osteoporosis is an abnormal bone remodeling condition characterized by decreased bone density, which leads to high risks of broken bones. Previous studies have demonstrated that Lycii Radicis Cortex (LRC) extract inhibits bone loss in ovariectomized (OVX) mice by enhancing the osteoblast differentiation. A bioactive compound, Kukoamine B (KB), was identified from a fractionation of LRC extract as a candidate component responsible for an anti-osteoporotic effect. This study investigated the anti-osteoporotic effects of KB using in vitro and in vivo osteoporosis models. KB treatment significantly increased the osteoblastic differentiation and mineralized nodule formation of osteoblastic MC3T3-E1 cells, while it significantly decreased the osteoclast differentiation of primary-cultured monocytes derived from mouse bone marrow. The effects of KB on osteoblastic and osteoclastic differentiations under more physiological conditions were also examined. In the co-culture of MC3T3-E1 cells and monocytes, KB promoted osteoblast differentiation but did not affect osteoclast differentiation. For the in vivo experiments, KB significantly inhibited OVX-induced bone mineral density loss and restored the impaired bone structural properties in osteoporosis model mice. These results suggest that KB may be a potential therapeutic candidate for the treatment of osteoporosis.

Hydrogen sulfide (H2S) is an environmental toxicant of health concern. The brain is a major target in acute H2S poisoning. This study was to test the hypothesis that acute and subchronic ambient H2S exposures alter the brain metabolome. Male 7-8 week-old C57BL/6J mice were exposed by whole-body inhalation to 1000 ppm H2S for 45 min and euthanized at 5 min or 72 h for acute exposure. For subchronic study, mice were exposed to 5 ppm H2S 2 h/day, 5 days/week for 5 weeks. The brainstem was removed for metabolomic analysis. Enrichment analysis showed the metabolomic profiles in acute and subchronic H2S exposures matched with those of cerebral spinal fluid from patients with seizures or Alzheimer’s disease. Acute H2S exposure decreased excitatory neurotransmitters, aspartate and glutamate, while the inhibitory neurotransmitter, serotonin, was increased, which may explain H2S-induced loss of consciousness. Branched-chain amino acids and glucose were increased by acute H2S exposure. Subchronic H2S exposure within OSHA guideline surprisingly decreased serotonin altering central nervous system. In subchronic H2S exposure, glucose was decreased while polyunsaturated fatty acids, inosine, and hypoxanthine were increased. Collectively, these results provide important mechanistic clues of acute and subchronic ambient H2S poisonings and show that H2S alters brainstem metabolome.

The retinal pigment epithelium (RPE) is an important monolayer of cells present in the outer retina forming a major part of the blood-retina-barrier (BRB). It performs many essential tasks for the maintenance of retinal integrity and function. With increasing knowledge of the retina, it is getting clearer that both common retinal disorders, like age related macular degeneration, and rare genetic disorders originate in the RPE. This calls for a better understanding of the functions of various proteins within the RPE. In this regard, mice enabling an RPE-specific gene deletion are a powerful tool to study the role of a particular protein within the RPE cells in their native environment, simultaneously negating any potential influences of systemic changes. Moreover, since the RPE cells interact closely with the adjacent photoreceptors, these mice also provide an excellent avenue to study the importance of a particular gene function within the RPE to the retina as a whole. In this review, we outline and compare the features of various Cre mice created for this purpose, allowing researchers a well-informed decision on the choice of Cre mouse to use in relation to their research needs.

Pure silver as well as silver compounds have been used as antiseptics for centuries. Nowadays, the most frequently applied form of silver is a nanoparticle form. Several studies demonstrate the ability of silver nanoparticles and silver salts to accumulate in the brain of laboratory ani-mals as well as the ability of silver nanoparticles to influence behavioral and cognitive functions of laboratory mammals. For the first time, the influence of a silver salt, in particular, silver citrate on the change dynamics of behavioral and cognitive functions of laboratory mice at the daily oral exposure during 30, 60, 120 and 180 days is investigated in the present research. We observed the anxiety increase after 30 days of the exposure as well as the ability of mice to adapt to the prolonged oral exposure of silver citrate manifested in the anxiety decrease, increase of locomotor activity and the tendency of long-term contextual memory improvement. Increase of locomotor activity and memory improvement might be associated with the sensitivity increase and regarded as compensatory mechanism to anxiety increase. The observed phenomenon is classified as a hormetic effect. A comparison with the analogous study implemented polyvi-nylpyrrolidone coated silver nanoparticles is carried out. It was concluded that the nanoform is more neurotoxic.

Non-alcoholic steatohepatitis (NASH) is diagnosed by the occurrence of fat buildup, inflammation, and fibrotic changes within the liver. NASH has the capacity to proceed to the advancement of decompensated cirrhosis and carcinoma by inflammation and oxidative stress. Although Agrimonia pilosa has traditionally been used medicinal purposes, its effects on the liver remains incompletely elucidated. In this research, we assessed the therapeutic outcomes of Agrimonia pilosa extract (APE) on free fatty acid (FFA)-treated HepG2 cellular hepatic steatosis and in a choline-deficient, L-amino acid-defined, high-fat diet with 0.1% methionine (CDAHFD)-induced NASH mouse model. In FFA-treated cells, APE inhibited intracellular lipid accumulation, and regulated the mRNA and protein expressions of modulators of fatty acid (FA) synthesis as well as FA oxidation proteins, through down-regulation of the AMP-activated protein kinase/sirtuin 1 signaling pathway. In the CDAHFD-induced NASH mouse model, APE significantly enhanced liver histology and serum levels of liver damage. APE also significantly attenuated hepatic expression of mRNA and proteins related to FA synthesis, inflammation, and fibrosis. Furthermore, APE mitigated the expression levels of oxidative stress and endoplasmic reticulum stress. Overall, these discoveries indicate that Agrimonia pilosa has the potential to treat NASH by regulating hepatic lipid metabolism, alleviating inflammation, and mitigating oxidative stress.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

The number of obese people worldwide is rising dramatically, with 51% of the global population expected to be obese or overweight by 2035. And it is usually involved in a variety of chronic diseases, including diabetes, hypertension, cardiovascular and cerebrovascular diseases. In the process of obesity, adipose tissue expands indefinitely, which induces metabolic dysfunction. Here, we confirm the role of succinate in the intervention of obesity. Through adding succinate to drinking water, high-fat diet induced obese mice were associated with the lower fat mass, and improved glucose tolerance and energy expenditure. These metabolic changes are accompanied by increased expression of lipolysis genes and decreased lipogenesis genes, especially in subcutaneous adipose tissue. In summary, supplement of succinate improves lipid deposition and metabolic health in obese mice.

Energy metabolism, including alterations in energy intake and expenditure, is closely related to aging and longevity. Metabolomics studies have recently unraveled changes in metabolite composition in plasma and tissues during aging and have provided critical information to elucidate the molecular basis of aging process. However, the metabolic changes in tissues responsible for food intake and lipid storage have remained unexplored. In this study, we aimed to investigate aging-related metabolic alterations in these tissues. To fill this gap, we employed NMR-based metabolomics in several tissues, including different parts of the intestine (duodenum, jejunum, ileum) and brown/white adipose tissues (BAT, WAT) of young (9-10 weeks) and old (96-104 weeks) wild-type (mixed genetic background of 129/J and C57BL/6) mice. We further included plasma and skeletal muscle of the same mice to verify previous results. Strikingly, we found that duodenum, jejunum, ileum, and WAT do not metabolically age. In contrast, plasma, skeletal muscle, and BAT show a strong metabolic aging phenotype. Overall, we provide first insights into the metabolic changes of tissues essential for nutrient uptake and lipid storage and have identified biomarkers for metabolites that could be further explored to study the molecular mechanisms of aging.

The theory that an itch inhibits pain has been refuted; however, previous research did not investigate this theory for interleukin-31 (IL-31)-induced itch. Previously, we have found that morphine-induced antinociception was partially reduced in IL-31 receptor A (IL-31RA)-deficient (IL-31RAKI) mice, indicating that IL-31RA may play an important role in morphine-induced peripheral antinociception. In the present study, we evaluated the effect of IL-31-induced analgesia on a 2,4,6-trinitrochlorobenzene (TNCB)-sensitized mice using a hot-plate test. This test evaluated the antinociceptive activity of morphine, and non-steroidal anti-inflammatory drugs (NSAIDs). Repeated pretreatment with IL-31 showed significant antinociceptive action. Furthermore, its combination with morphine, but not with NSAIDs, increased the analgesic action. In contrast, treatment with TNCB and capsaicin decreased antinociception. Moreover, TNCB increased IL-31RA expression in the dorsal root ganglia at 24 h, whereas capsaicin inhibited it. The comparative action of several analgesics on TNCB or capsaicin was evaluated using a hot-plate test, which revealed that the antinociceptive activity was decreased or disappeared in response to capsaicin-induced pain and in IL-31RAKI mice. These results indicate that the analgesic action of IL-31 involves the peripheral nervous system, which affects sensory nerve. These results provide a basis for developing novel analgesics using this mechanism.

Aquaporin-11 (AQP11) is an intracellular water channel expressed at the endoplasmic reticulum (ER) of the kidney proximal tubule. Its gene disruption in mice leads to intracellular vacuole formation at one week old and the subsequent development of polycystic kidneys at three week old. As the damaged proximal tubular cells with intracellular vacuoles later form cysts, autophagy may play a role in their survival. We examined the autophagy activity before and after the development of cysts in AQP11(-/-) kidneys. We first observed an enhanced expression of LC3 gene (Map1lc3b) as well as other autophagy-related genes in AQP11(-/-) mice by quantitative PCR analysis. We then examined the formation of autophagosomes visualized by a green fluorescent fusion protein, GFP–LC3 in its transgenic mice. The expression of GFP-LC3 puncta was increased in the proximal tubule of AQP11(-/-) mice before the cyst formation. Interestingly, they were also observed in the cyst-lining epithelial cell. Further PCR analyses revealed the enhanced expression of apoptosis- and ER stress-related caspase genes before and after the cyst formation suggesting that ER stress may have enhanced autophagy. We conclude that autophagy will play an important role in the development and the survival of the kidney cysts in AQP11(-/-) mice.

Base excision repair (BER) is the predominant pathway to remove most forms of hydrolytic, oxidative and alkylative DNA damage. The precise functioning of BER is achieving by the regulation of each step by regulatory/accessory proteins, with the most important of which being poly(ADP-ribose) polymerase 1 (PARP1). The PARP1 regulatory functions extend to many cellular processes including regulation of mRNA stability and decay. PARP1 can therefore affect BER both at the level of the BER proteins and at the level of their mRNAs. Systematic data on how the PARP1 content affects the activities of key BER proteins and the levels of their mRNAs in human cells are extremely limited. In this study the CRISPR/Cas9 based technique has been used to knocked out the PARP1 gene in the human HEK 293FT line. The obtained cell clones with putative PARP1 deletion were characterized by several approaches including: PCR analysis of deletions in genomic DNA, Sanger sequencing of genomic DNA, qPCR analysis of PARP1 mRNA, western-blot analysis of whole-cell-extract proteins with anti-PARP1 antibodies, and the PAR synthesis in the whole-cell-extracts. qPCR analysis of mRNAs coding the BER related proteins: PARP2, uracil DNA glycosylase 2, AP endonuclease 1, DNA polymerase β, DNA ligase III and XRCC1 did not reveal crucial influence of PARP1 knockout. The corresponding catalytic activities in the whole-cell extracts (WCEs) evaluated in parallel did not differ significantly between mutant and parental cell lines. No considerable influence of poly(ADP-ribose) synthesis on the activity of the above WCE enzymes was revealed.

Introduction. The use of probiotics demonstrate efficacy against obesity and metabolic syndrome (MetS). Detection effective probiotic strains for hyperglycemia and immunity associated with is important task. The aim of the study was to evaluate an influence of Lactobacillus casei IMV B-7280 separately and composition L. casei IMV B-7280 / Bifidobacterium animalis VKB / B. animalis VKL on the levels of blood glucose and immunity in obese mice. Meterials and methods. Obesity was induced by fat-enriched diet (FED) in male BALB/c mice. Obese mice were transferred to standard diet and received per os probiotic strains daily during 10 days. We measured tumor necrosis factor-a (TNF-a) in blood serum using enzyme-linked immunosorbent assay and functional activity of peritoneal exudate macrophages (PEMs). Glucose levels in blood was defined with glucometer. Results. We ascertained that all probiotic strains induced reducing mice weight and visceral fat, normalization of TNF-a production and functional activity of PEMs. Treatment with L. casei IMV B-7280 was associated with decreasing blood glucose levels. No normalization of glucose and TNF-a levels in obese mice, transferred to standard diet without probiotic treatment, although we revealed decreasing their weight and visceral fat and partial recover of functional activity of PEMs. Conclusions. Probiotic strain L. casei IMV B-7280 (separately) and composition L. casei IMV B-7280 / B. animalis VKB / B. animalis VKL can re-equilibrate metabolic and inflammation indices in mouse obesity model. L. casei IMV B-7280 alone was more efficient in decreasing glucose levels than composition of strains.

Oxytocin (OXT), a pro-social peptide, is increasingly recognized as a potential protective substance against drug addiction. In the context of ethanol, previous researches have shown OXT properties to reduce self-administration, alleviate motor impairment in rodents, and reduce craving in humans. However, its role in behavioral sensitization, a neuroadaptive response resulting from repeated drug exposure linked to increased drug incentive, remains unexplored. OXT is also associated with modulating the Hypothalamic-Pituitary-Adrenal (HPA) axis, with corticosterone well-known as a significant factor in behavioral sensitization development. This study aimed to investigate the effects of Carbetocin (CBT), an analogue of OXT, on the expression of behavioral sensitization to ethanol and concurrent alterations in plasma corticosterone levels in male and female Swiss mice. We also aimed to confirm previous studies on OXT impact on ethanol consumption in male mice, but with a focus on CBT, using the two-bottle choice model and drinking in the dark (DID) methodology. For the sensitization study, mice received either ethanol (1.8 g/kg, ip) or saline treatments daily for 15 consecutive days, followed by treatment with carbetocin (0.64 mg/kg, ip) or a vehicle for 6 days. Subsequently, on day 22, all animals underwent an ethanol challenge to assess the expression of behavioral sensitization. Plasma corticosterone levels were measured on days 21 and 22. CBT effectively prevented the expression of ethanol-induced behavioral sensitization in both male and female subjects, with no alterations detected in corticosterone levels. In the ethanol consumption study, following an initial phase of ethanol acquisition, mice underwent a 6-day treatment with CBT i.p or saline before being reexposed to ethanol. We also found a reduction in ethanol consumption due to CBT treatment. In conclusion, carbetocin emerges as a promising and effective intervention in mitigating ethanol-induced behavioral sensitization and reducing ethanol intake, highlighting its potential significance in alcohol addiction treatment.

Febuxostat (FBX), a selective xanthine oxidase inhibitor, belongs to BCS class II showing low solubility and high permeability with a moderate F value (&lt; 49%). Recently, FBX/L-pyroglutamic acid cocrystal (FBX-PG) was developed with improving 4-fold increase of the FBX solubility. Nevertheless, in vivo pharmacokinetic property of FBX-PG has not been evaluated yet. Therefore, the pharmacokinetic feasibility of FBX in FBX and FBX-PG-treated rats and mice was compared in this study. The results showed that the F values of FBX were 210% and 159% in FBX-PG rats and mice, respectively. The 2.10-fold greater AUC of FBX was due to the increased absorption (i.e., 2.60-fold higher Cmax,1 at 15 min) and entero-hepatic circulation of FBX (i.e., 1.68-fold higher Cmax,2 at 600 min) in FBX-PG rats compared to the FBX rats. The 1.59-fold greater AUC of FBX was due to a 1.65-fold higher Cmax,1 at 5 min, and 1.15-fold higher Cmax,2 at 720 min of FBX in FBX-PG mice than those in FBX mice. FBX was highly distributed in the liver, stomach, small intestine, and lungs in both groups of mice, and the FBX distributions to the liver and lungs were increased in FBX-PG mice compared to FBX mice. The results suggest the FBX-PG has a suitable pharmacokinetic profile of FBX for improving its oral F value.

We aimed to investigate the mechanism underlying social stress (SS)-induced erectile dysfunction (ED) and evaluate the effects of a single sub-anesthetic dose of ketamine on SS-related ED. Male FVB mice were exposed to retired male C57BL/6 mice for 60 minutes daily over a 4-week period. In the third week, SS mice received intraperitoneal injections of either saline (SSS group) or ketamine (SSK group). Erectile function was assessed by measuring intra-cavernosal pressure (ICP) during electrical stimulation at the major pelvic ganglia. Corpus cavernosum (CC) strips were utilized for wire myography to assess their reactivity. Both SSS and SSK mice exhibited significantly lower ICP in response to electrical stimulation than control. SS mice showed increased contractility of CC induced by phenylephrine. Acetylcholine-induced relaxation was significantly reduced in SSS and SSK mice. Sodium nitroprusside-induced relaxation was higher in SSS mice compared to control and SSK mice. Nicotine-induced neurogenic and nitric oxide (NO)-dependent relaxation was significantly impaired in both SSS and SSK mice. Immunohistochemically analysis revealed co-localization of tyrosine hydroxylase and neuronal nitric oxide synthase (nNOS)-immunoreactive fibers in the CC. These findings highlight the complex nature of SS-related ED and suggest the limited efficacy of ketamine as a therapeutic intervention in this condition.

In the present study, we studied the effect of apolipoprotein A-1 (APOA1) on the spatial and molecular characteristics of bone marrow adipocytes, using well-characterized ApoA1 knockout mice. APOA1 is a central regulator of high-density lipoprotein cholesterol (HDL-C) metabolism, and thus HDL; our recent work showed that deficiency of APOA1 increases bone marrow adiposity in mice. We found that ApoA1 deficient mice have greatly elevated adipocytes within their bone marrow compared to wild type counterparts. Morphologically, the increased adipocytes were similar to white adipocytes, and displayed proximal tibial-end localization. Marrow adipocytes from wild type mice were significantly fewer and did not display bone-end distribution pattern. The mRNA levels of the brown/beige adipocyte-specific markers Ucp1, Dio2, Pat2, Pgc1a, and the expression of leptin were greatly reduced in the ApoA1 knock-out in comparison to the wild-type mice. In the knock-out mice adiponectin was remarkably elevated. In keeping with the close ties of hematopoietic stem cells and marrow adipocytes, we found that the elevated adiposity in the ApoA1 knock out mice is associated with a significant reduction of the hematopoietic stem cells and common myeloid, but not common lymphoid, progenitors. Moreover, the “beiging”-related marker osteopontin and the angiogenic factor VEGF were also reduced in the ApoA1 knock-out mice, further supporting the notion that APOA1, and most probably HDL-C, regulate bone marrow microenvironment, favouring beige/brown adipocyte characteristics.

3,4-methylenedioxypyrovalerone (MDPV) is a new psychoactive substance (NPS) and the most widespread and life-threatening synthetic cathinone of the “bath salts”. Preclinical research has proven the cocaine-like psychostimulant effects of MDPV and its potential for abuse. Cannabidiol (CBD) is a non-psychotropic phytocannabinoid that has emerged as a new potential treatment for drug addiction. Here, we tested the effects of CBD (20 mg/kg) on MDPV (2 mg/kg)-induced conditioned place preference and MDPV (0.05 and 0.075 mg/kg/infusion) self-administration paradigm. We also assessed the effects of the combination of CBD, and MDPV (3 and 4 mg/kg) on anxiety-like behaviour using the elevated plus maze (EPM). CBD mitigated the MDPV-induced conditioned place preference. On the contrary, CBD administration throughout the MDPV (0.075 mg/kg/infusion) self-administration increased drug-seeking and taking behaviours, but only in the high-responders group of mice. Additionally, CBD exerted anxiolytic-like effects, but only in MDPV-treated mice. Taken together, our results indicate that CBD modulation of MDPV-induced motivational responses in mice vary depending on the requirements of the learning task, resulting in a complex response. More research attempting to decipher the behavioural and molecular interactions between CBD and MDPV is needed.

Ulcerative colitis has a significant impact on the quality of life for the patients, and can substantially increase the risk of colon cancer in patients suffering long-term. Conventional treatments provide only modest relief paired with a high risk of side effects, while complementary and alternative medicines can offer safe and effective options. Over the past decade, we have shown that American ginseng has anti-oxidant and anti-inflammatory properties that can suppress mouse colitis and prevent colitis associated colon cancer. With the goal of isolating a single active compound, we further fractionated the hexane fraction, and found the most abundant molecule in this fraction was the polyacetylene, Panaxynol. After isolating and characterizing Panaxynol, we tested the efficacy of Panaxynol in the treatment and prevention of colitis in mice and studied the mechanism of action. We demonstrate here that Panaxynol effectively treats colitis in a Dextran Sulfate Sodium mouse model by targeting macrophages for DNA damage and apoptosis. Positive outcomes from this study could take American ginseng one-step further towards becoming a conventional drug for the treatment of colitis, and possibility exploring other autoimmune diseases associated with macrophage dysfunction.

Chagas disease (CD) is one of the most devasting parasitic diseases in the Americas affecting 7 to 8 million people worldwide. In vitro and in vivo experiments have demonstrated that decreased growth hormone (GH) serum levels occur as CD progresses. Interestingly, inactivating mutations in the GH receptor in humans induce Laron syndrome (LS), a clinical entity characterized by increased GH and decreased insulin growth factor-1 (IGF-1) serum levels. The largest cohort of LS subjects lives in the southern provinces of Ecuador. Remarkably, CD prevalence in these individuals is diminished despite living in highly endemic areas. In the current ex vivo study, we employed serum from GHR -/- mice, also known as LS mice (a model of GH resistance with high GH and low IGF-1 levels), and serum from bovine GH (bGH) transgenic mice (high GH and IGF-1), to test the effect on T. cruzi infection. We infected mouse fibroblast L-cells treated with serum from each type of mouse with metacyclic trypomastigotes from Trypanosoma cruzi (etiological CD infectious agent). Treatment with GHR-/- serum (LS mice) significantly decreased infection by 28% compared to 48% seen in control wild-type mouse serum (WT). Treatment with bGH mouse serum significantly decreased infection by only 41% compared to 54% from WT controls. Our results suggest that high GH and low IGF-1 in blood circulation, as typically seen in LS individuals, confers partial protection against T. cruzi infection.

Over the years influenza B virus (IBV) contribute annual disease and can lead to serious respiratory disease among humans. More attention should be paid to the mammalian adaptive processes of B viruses and development of vaccines against current influenza. Because of preclinical trials of anti-influenza drugs are conducted mainly on mice, we developed adequate animal model using antigenically-relevant IBV strain for testing anti-influenza drugs and protective efficacy of flu vaccines. We serially passaged Victoria lineage (clade 1A) IBV 17 times in BALB/c mice. The adaptive amino acid substitutions were found in HA (T214I) and NA (D432N). By the electron microscopic examination, we showed spherical and elliptical shapes of IBV. Light microscopy showed that mouse-adapted B virus caused influenza pneumonia on day 6 post inoculation. We evaluated the illness pathogenicity, viral load and histopathological features of mouse-adapted IBV and estimated anti-influenza drugs and vaccine efficiency in vitro and in vivo. Assessment of investigational anti-influenza drug oseltamivir ethoxisuccinate and flu vaccine Ultrix® revealed effectivity against our mouse-adapted influenza B virus.

A variety of environmental factors contribute significantly to age-related cognitive decline and Alzheimer’s Disease (AD). Nutrition can alter epigenetics, improving health outcomes, which transmitted across generations; this process is called epigenetic inheritance. We investigate the beneficial effects of maternal resveratrol supplementation in offspring. We feed females SAMP8 with resveratrol-enriched diet during two months prior to mating. Direct exposed F1 generation and the transgenerational F2 generation were investigated. Object novel recognition and Morris water maze demonstrated improvements in cognition in the 6-month-old F1 and F2 generations from resveratrol fed mothers. A significant increase in global DNA methylation with a decrease in hydroxymethylation in F1 and F2 were found. Accordingly, Dnmt3a/b and Tet2 gene expression changed. Methylation levels of Nrf2 and NF-kβ genes promoters raised in offspring, inducing changes in target genes expression, as well as hydrogen peroxide levels. Offspring resulted from resveratrol fed mother showed increase AMPKα activation, mTOR inhibition and an increase in Pgc-1α gene expression and Beclin-1 protein levels. Endoplasmic reticulum stress sensors were found changed both in F1 and F2 generations. Overall, our results demonstrated that maternal resveratrol supplementation could prevent cognitive impairment in the SAMP8 mice offspring through epigenetic changes and cell signaling pathways.

Liver X receptors (LXR) are deemed as potential drug targets for atherosclerosis, whereas a role in adipose tissue expansion and its relation to insulin sensitivity remains unclear. To assess the metabolic effects of LXR activation, C57BL/6 mice on a high-fat diet (HFD) were treated with the dual LXRα/β agonist T0901317 (30 mg/kg per day) for 3 weeks. Differentiated 3T3-L1 was used for analysing the effect of T0901317 on glucose uptake.T0901317 reduced fat mass, accompanied by a massive fatty liver and lower adipokine levels in circulation of HFD mice. Increased adipocyte apoptosis and macrophage infiltration were found in epididymal fat of T0901317-treated HFD mice. In addition, T0901317 treatment promoted basal lipolysis, but blunted the anti-lipolytic action of insulin. Furthermore, LXR activation antagonized PPARγ target genes in epididymal fat and PPARγ-PPRE binding activity in 3T3-L1 adipocytes. Although the glucose tolerance was comparable to that in vehicle-treated HFD mice, the insulin tolerance was significantly decreased in T0901317-treated HFD mice, indicating decreased insulin sensitivity by T0901317 administration, and which was further supported by impaired insulin signalling found in epididymal fat and decreased insulin-induced glucose uptake in 3T3-L1 by T0901317administration. These findings reveal that LXR activation impairs adipose expansion which contributes to decreased insulin sensitivity.

Demethyleneberberine is an active component extracted from the Chinese herbal drug Cortex Phellodendri. It is also a metabolite of the berberine in animals and humans. However, the pharmacokinetics, tissue distribution and excretion of demethyleneberberine have not been reported. The present study aimed to investigate the pharmacokinetic parameters of demethyleneberberine by developing a method of high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS). The detection was performed by using positive ion electrospray ionization in multiple reaction monitoring mode. The MS/MS ion transitions were monitored at m/z 324.4→308.3 for demethyleneberberine and 465.5→350.3 for IS. After oral administration of demethyleneberberine in rats and mice, the pharmacokinetics, tissue distribution, and excretion of desmethylberberine in rats and mice were comparatively studied for the first time. The plasma concentration of desmethylberberine reached its peak within 5 min after oral administration in both rats and mice. The bioavailability of rats and mice was comparable, ranging from 4.47% to 5.94%, higher than that of berberine. The total excretion of desmethylberberine in urine, feces and bile is 7.28~9.77%. These findings provide valuable insights into the pharmacological and clinical research on desmethylberberine.

Ultraviolet (UV) radiation has both harmful and beneficial effects on human health. It can cause skin damage and cancer, but also provides the primary source of vitamin D. Additionally, UV radiation affects energy metabolism in mice with metabolic diseases and has protective effects on hypertension and cardiovascular diseases.Metabolic Syndrome is a collection of metabolic dysfunctions such as dyslipidemia, hypertension, hyperglycemia, abdominal/central obesity, and insulin resistance. Chronic UVR exposure suppressed obesity and type 2 diabetes in high-fat diet-fed mice, while vitamin D supplementation did not replicate these effects. On the other hand, topical application of nitric oxide (NO) donors replicated UV effects on mice, and NO scavengers prevented the positive impact of UV. UVR may prevent the development of obesity and metabolic syndrome through mechanisms that depend on UVR-induced NO, not vitamin D. Exposure to sunshine has a protective impact on blood pressure and cardiovascular disease. Although lower vitamin D concentration is linked to increased hypertension and the incidence of CVD, oral vitamin D supplementation does not decrease blood pressure or the risk of CVD, indicating that vitamin D may not mediate the beneficial effects of sun exposure. Instead, NO plays a crucial role as an endogenous vasodilator, produced by the vascular endothelium. Solar UVA may release nitrogen oxides from skin storage into the bloodstream, lowering blood pressure and cardiovascular mortality.In conclusion, UVR exposure could be a promising non-pharmacological intervention for metabolic syndrome, hypertension, and CVD prevention, and NO may play a crucial role in mediating these effects. Further research is needed to explore the precise mechanisms and identify the optimal doses and exposure times of UVR.

We describe the development and validation of a HPLC-MS/MS method to assess the pharmacokinetics and tumour distribution of fenretinide, a synthetic retinoid chemically related to all-trans-retinoic acid, after administration of a novel oral nanoformulation of fenretinide, called bionanofenretinide (BNF). BNF was developed to overcome the major limitation of fenretinide: its poor aqueous solubility and bioavailability due to its hydrophobic nature. The method proved to be reproducible, precise, and highly accurate for the measurement of the drug and the mains metabolites. The lower limit of quantification resulted 1 ng/mL. The curve range of 1-500 ng/mL and 50-2000 ng/mL, for plasma and tumor homogenate respectively, was appropriate for the analysis, as demonstrated by the accuracy between 96.8% and 102.4% for plasma and 96.6-102.3% for tumor. The inter-days precision and accuracy determined on quality controls at 3 different levels were in ranges of 6.9%-7.5% and 99.3-101.0% and 0.96-1.91% and 102.3-105.8% for plasma and tumour, respectively.

Morphine-induced antinociception is partially reduced in interleukin-31 (IL-31) receptor A (IL-31RA)-deficient mice, indicating that IL-31RA is crucial for morphine-induced peripheral antinociception. Herein, we examined the combined effects of IL-31 and morphine on antinociceptive activity and itch-associated scratching behavior (LLS) in mice, and elucidated the regulatory mechanisms. A hot-plate test was used to assess antinociception. LLS was automatically detected and recorded via computer. IL-31RA mRNA expression was assessed using real-time polymerase chain reaction. Repeated pre-treatment with IL-31 resulted in significant antinociceptive activity. Repeated administration of morphine decreased the morphine-induced antinociceptive activity, LLS counts, and regular dose, and inhibited IL-31-induced LLS. These results suggested that repeated administration of morphine depleted inter-neuronal IL-31RA levels, preventing morphine-induced antinociception. Therefore, IL-31 may be helpful as an adjunct analgesic to morphine. To explore the benefits of IL-31, its influence on morphine-induced antinociceptive tolerance in mice was examined. IL-31 and morphine combination increased analgesic action which increased the expression of DRG neuronal IL-31RA, elucidating the site of peripheral antinociception of morphine. This site may induce exocytosis of IL-31RA in the sensory nervous system. Collectively, the suppressive effect of IL-31 on morphine-induced antinociceptive tolerance may result from IL-31RA supplementation in sensory nerves.

Mice are one of the frequently used animal models in science research whose behavioral characteristics can provide much valuable information in biology, neuroscience, and pharmacology. Nowadays, artificial intelligence is widely used in mice behavior analysis. Integrated AI systems such as ChatGPT and VisualGPT are already available, and we discuss the feasibility of MiceGPT to help researchers identify and classify mouse behavior more easily. We review the applications of mice behavior analysis, analyze the tasks of deep learning on these applications based on an AI pyramid, and finally summarize the AI approaches to solve these tasks. Based on these summaries, we propose three MiceGPT architectures to demonstrate the theoretical feasibility of MiceGPT.