Sporisorium scitamineum, the basidiomycetous fungus causing sugarcane smut that leads to severe losses in sugarcane quantity and quality, undergoes sexual mating to form dikaryotic hyphae capable of invading the host cane. Therefore, suppressing dikaryotic hyphae formation would potentially be an effective way to prevent host infection by the smut fungus, and the following disease symptom development. The phytohormone methyl jasmonate (MeJA) has been showed to induce plant defense against insects and microbial pathogens. In this study, we verified that exogenous addition of MeJA suppressed dikaryotic hyphae formation under in vitro culture condition, and effective in inhibiting maize smut disease symptom caused by Ustilago maydis. We constructed an Escherichia coli strain expressing plant JMT gene, encoding a jasmonic acid carboxyl methyl transferase that catalyzes conversion from jasmonic acid (JA) to MeJA. By GC-MS we confirmed that the transformed E. coli strain, designated as pJMT strain, was able to produce MeJA in the presence of JA and S-adenosylmethionine (SAM; as methyl donor). Furthermore, the pJMT strain was able to suppress S. scitamineum filamentous growth under in vitro culture condition. It waits to further optimize JMT expression under field condition, in order to utilize the pJMT strain as a biocontrol agent (BCA) of sugarcane smut disease. Overall, our study provides a potentially novel method for controlling crop fungal diseases by boosting phytohormone biosynthesis.

Gut luminal dysbiosis and pathobiosis result in compositional and biodiversify alterations in the microbial and host co-metabolites. The main mechanism of bacterial evolution is horizontal gene transfer (HGT) and acquisition of new traits can be achieved through mobile genetic element (MGEs) exchange. Introducing genetically engineered microbes (GEMs) might break the harmonized balance in the intestinal compartment. The present objectives are: 1. To reveal the role played by GEMs' horizontal gene transfers in changing the landscape of the enteric microbiome eubiosis 2. To expand on the potential detrimental effects of those changes on human genome and health. A search of articles published in PubMed/MEDLINE, EMBASE, and Scielo from 2000 to august 2023, using appropriate MeSH entry terms were performed. GEMs' horizontal gene exchanges might induce multiple human diseases. The new GEMs can change the long-term natural evolution of the enteric pro- or eukaryotic cells inhabitants. The worldwide regulatory authority's safety control of GEMs is not enough to protect public health. Viability and biocontainment and many other aspects are only partially controlled and harmful consequences for public health should be avoided. Always remember that prevention is the most cost- effective strategy and "primum non nocere" is the name of the game.

Sugarcane Streak Mosaic Virus (SCSMV) poses a significant threat to sugarcane productivity. PRG sugarcane is a product of genetic engineering aimed at enhancing resistance to various environmental stresses, pests, and diseases. This study aimed to test and compare the resistance of two PRG sugarcane SPS events to SCSMV infection. The study was conducted using a single-factor Completely Randomized Design (CRD), comprising four treatments: Bululawang sugarcane variety as a control, PS 882 as a susceptible variety, PRG Sugarcane SPS 1, and PRG Sugarcane SPS 3, with 15 replications of 60 sugarcane mules each. PCR results indicated that mosaic infection in the sugarcane plants was most likely caused by SCSMV. Based on the morphological identification of the SCSMV virus and RT-PCR testing, the sugarcane plants positively infected with SCSMV were SPS1 U1 R1, SPS3 U2 R4, SPS3 U3 R3, and PS882 U3 R4. The highest incidence rate of the disease was observed in the SPS3 variety, while the lowest incidence rate was in the Bululawang variety. The PS882 variety exhibited the slowest SCSMV incubation period, showing symptoms of infection, whereas the SPS1 variety showed the fastest incubation period. The highest disease severity was recorded in the SPS3 variety, and the lowest in the PS882 variety. The sugarcane varieties with the highest klorofil content were SPS3, while the SPS1 variety had the lowest klorofil content.

Determining the estrous cycle stages in mice is essential for optimizing breeding strategies, synchronizing experimental time lines, and facilitating studies in behavior, drug testing, and genetics. It is critical for reducing the production of genetically unmodified offspring in the generation and investigation of genetically modified animal models. An accurate detection of the estrus cycle is particularly relevant in the context of the 3Rs—Replacement, Reduction and Refinement. The estrous cycle, encompassing the reproductive phases of mice, is key to refining experimental designs and addressing ethical issues related to the use of animals in research. This study presents results from two independent laboratories on the efficacy of the Mouse Estrus Detector (MED) from Elmi Ltd. (Latvia) for the accurate determination of the estrus phase. The female mice of five strains/stocks (CD1, FVB/N, C57Bl6/J, B6D2F1, and Swiss) were used. The results showed that the MEDProTM is a low -traumatic, simple, rapid and painless method of estrus detection that supports the principles of the 3Rs. The use of the MEDProTM for estrus detection in mice caused minimal stress, enhanced mating efficiency, facilitated an increase in the number of embryos for the in vitro fertilization and allowed the production of the desired number of foster animals.

This paper aims to investigate appropriate mathematical models devoted to optimization of some cleaning processes related to pharmaceutical contaminants removal. In our previous recent works has been reported that a possibility for removal from water sources of this type of micropollutants is to rehabilitate the existing cleaning plants by introducing efficient techniques such as adsorption on granulated active carbon filters, micro-, nano- or ultrafiltration. To have such processes under a better control and to pass from small to large scale treatment stations, specific mathematical models are necessary. Starting from Navier-Stokes equations and imposing proper boundary conditions, some mathematical physics problems are obtained for which adequate solving methods via variational methods and surjectivity results are proposed. The importance of these solution characterizations consists in their continuation in a numerical method and the possibility to visualize the result by using CFD program.

Despite advances in understanding of the molecular pathogenesis of glioma, outcomes remain dismal. Developing successful treatments for glioma requires faithful in vivo disease modeling and rigorous preclinical testing. Murine models, including xenograft, syngeneic, and genetically engineered models, are used to study gliomagenesis, identify methods of tumor progression, and test novel treatment strategies. Since the discovery of highly recurrent isocitrate dehydrogenase (IDH) mutations in lower-grade gliomas, there is increasing emphasis on effective modeling of IDH mutant brain tumors. Improvements in preclinical models that capture the phenotypic and molecular heterogeneity of gliomas are critical for the development of effective new therapies. Herein, we explore the current status, advancements, and challenges with contemporary murine glioma models.

Previously, we described a 19-base pair double-stranded RNA with 3'-trinucleotide overhangs, acting as immunostimulatory RNA (isRNA). This molecule demonstrated notable antiproliferative effects on cancer cells, inhibited tumor growth, and elicited immunostimulatory and antiviral responses by inducing cytokine and interferon production. Within this study, we compared the efficiency of lung fibrosis development, initiated in mice by BLM or LPS using different schemes of induction. Then we compared the effect of isRNA used in a preventive or therapeutic regimen on the development of fibrosis in selected BLM- and LPS-induced mouse models and showed that isRNA can be used in pathological conditions accompanied by the development of inflammation and the risk of fibrosis formation, without adverse side effects. Prophylactic regimen of isRNA application is beneficial for prevention of the development of pulmonary fibrosis.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

Glioblastoma (GBM) is the most aggressive brain cancer. To model GBM in research, orthotopic brain tumor models, including syngeneic models like GL261 and genetically engineered mouse models like TRP, are used. In longitudinal studies, tumor growth and treatment response are typ-ically tracked with in vivo imaging, including bioluminescence imaging (BLI), which is quick, cost-effective, and easily quantifiable. However, BLI requires luciferase-tagged cells, and recent studies indicate that the luciferase gene can elicit an immune response, leading to tumor rejection and experimental variation. We sought to optimize the engraftment of two luciferase-expressing GBM models, GL261 Red-FLuc and TRP-mCherry-FLuc, showing differences in tumor take, with GL261 Red-FLuc cells requiring immunocompromised mice for 100% engraftment. Immuno-histochemistry and MRI revealed distinct tumor characteristics: GL261 Red-FLuc tumors were well-demarcated with densely packed cells, high mitotic activity, and vascularization. In con-trast, TRP-mCherry-FLuc tumors were large, invasive, and necrotic, with perivascular invasion. Quantifying tumor volume using the HALO® AI analysis platform yielded results comparable to manual measurements, providing a standardized and efficient approach for reliable high-throughput analysis of luciferase-expressing tumors. Our study highlights the importance of considering tumor engraftment when using luciferase-expressing GBM models, providing in-sights for preclinical research design.

Adult T-cell leukemia (ATL) is an aggressive hematologic disease caused by human T-cell leukemia virus type 1 (HTLV-1) infection. Various animal models of HTLV-1 infection/ATL have been established to elucidate the pathogenesis of ATL and develop appropriate treatments. For analyses employing murine models, transgenic and immunodeficient mice are used because of the low infectivity of HTLV-1 in mice. HTLV-1 Tax and HBZ transgenic mice spontaneously develop tumors, and roles for both Tax and HBZ in cell transformation and tumor growth have been established. Severely immunodeficient mice were able to engraft ATL cell lines and have been used in preclinical studies of candidate molecules for the treatment of ATL. HTLV-1-infected humanized mice with an established human immune system are a suitable model to characterize cells in the early stages of HTLV-1 infection. This review outlines the characteristics of mouse models of HTLV-1 infection/ATL and describes progress made in elucidating the pathogenesis of ATL and developing related therapies using these mice.

Malaria comprises a spectrum of disease syndromes and the immune system is a major participant in malarial disease. This is particularly true in relation to the immune responses elicited against blood stages of Plasmodium-parasites that are responsible for the pathogenesis of infection. Mouse models of malaria are commonly used to dissect the immune mechanisms underlying disease. While no one mouse model of Plasmodium infection completely recapitulates all the features of malaria in humans, collectively the existing models are invaluable for defining the events that lead to the immunopathogenesis of malaria. Here we review the different mouse models of Plasmodium infection that are available, and highlight some of the main contributions these models have made with regards to identifying immune mechanisms of parasite control and the immunopathogenesis of malaria.

Rationale: Genetically modified (GM) foods have the potential to reduce food insecurity and address economic and environmental issues. Despite these benefits, GM foods continue to face significant criticism and there is limited information on public awareness and understanding of their nutritional and environmental health benefits in Nigeria. This study aims to fill this gap by investigating public knowledge and perceptions of GM foods in Victoria Island, Lagos. Methods: A convenience sampling method was used to recruit 369 respondents from Victoria Island, Lagos. Data were gathered using a structured questionnaire. The target population comprised employed adults either residing or working on Victoria Island. Statistical analyses were conducted to examine the relationship between sociodemographic factors and awareness of GM foods. Results: The study found that a majority of respondents (62.9%, n=232) were knowledgeable about GM foods and their associated issues. However, many believed that their community was not well-informed on the topic. Awareness of GM foods was significantly associated with sociodemographic factors such as marital status and education (P<0.01). Most respondents were well-informed about the environmental and health benefits of GM foods, with 61.8% believing that GM food production could sustainably reduce reliance on chemical pesticides, fertilizers, and other energy inputs, thus mitigating their ecological impacts. Additionally, most respondents did not feel that purchasing or consuming GM foods conflicted with their beliefs or would affect their food choices. Conclusion: The study concludes that while individual awareness of GM foods is relatively high, there is a perception that community awareness is low. Sociodemographic factors play a significant role in shaping public awareness and perceptions of GM foods. Recommendations: This includes government should actively educate the public on the ecological and health benefits of GM foods and address any safety concerns; Implement strict border controls and food labeling for GM products to protect consumer rights and preferences for organic foods, provide sufficient technical and financial assistance to farmers who participate in organic seed programs to enhance national food security. Significant Statement: This study highlights the importance of public education on GM foods and underscores the need for government intervention to ensure informed consumer choices and support for sustainable agricultural practices.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

Sarcoglycanopathies are among the most frequent and severe autosomal recessive forms of limb-girdle muscular dystrophies /LGMD/ with childhood onset. Mutations in , , and sarcoglycan genes lead to various kinds of LGMD. We present the clinical variability of LGMD 2C/R5 among a genetically homogeneous group of 56 patients, belonging to 35 pedigrees. Molecular genetic analysis showed thаt all 57 patients were homozygous for C283Y variant. The muscles of the pelvic girdle and the trunk were early and more severely affected, followed by the the shoulder girdle. Macroglossia, hypertrophy of the calves, scapular winging and lumbar hyperlordosis were common in the ambulatory phase. A great variability in the clinical presentation of LGMD 2C/R5 was observed both intra and interfamilial, despite the same underlying molecular defect. Females demonstrated a relatively milder clinical course, compared to males. Mean CK levels were 20 times above normal values. Muscle CT of MRI showed earlier and more severe involvement of the flexor proximal limb muscles in comparison to the extensor ones.

Heavy metals are dangerous contaminants constituting a threat to human health because they persist in soils and are easily transferred into the food chain, causing damages to human health. Among heavy metals, nickel appears to be one of the most dangerous responsible for different disorders. Public health protection requires nickel detection in environment and food chains; a simple, rapid and sensitive method to detect nickel contamination is represented by biosensors. In this paper we report the setup of a whole-cell based system, in which protoplasts, obtained from Nicotiana tabacum leaves, were used as transducers to detect the presence of heavy metal ions and, in particular, nickel ions. Protoplasts were genetically modified with a plasmid containing the GFP reporter gene under the promoter region of a sunflower small HSP gene control. By this device the presence of heavy metal ions was detected. Thus, the possibility to use this whole-cell system as a novel tool to detect the presence of nickel ions in food matrices was assessed.

In this review, we have included current information on the use of photodynamic therapy in the treatment of gliomas. We mainly focused on the discussion and regarding the use of photodynamic therapy in patients with genetically determined syndromes that are associated with an increased risk of glioma. The review also uses information on genetic syndromes that are associated with an increased risk of glioma.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

Tobacco mosaic virus (TMV) was the first virus to be studied in detail and for many years TMV and other tobamoviruses, particularly tomato mosaic virus (ToMV) and tobamoviruses infecting pepper (Capsicum spp.), were serious crop pathogens. By the end of the twentieth and for the first decade of the twenty-first century tobamoviruses were under some degree of control due to introgression of resistance genes into commercial tomato and pepper lines. However, tobamoviruses remained as important models for molecular biology, biotechnology and bio-nanotechnology. Recently, tobamoviruses have again become serious crop pathogens due to the advent of tomato brown rugose fruit virus, which overcomes tomato resistance against TMV and ToMV, and the slow but apparently inexorable worldwide spread of cucumber green mottle mosaic virus, which threatens all cucurbit crops. This review discusses a range of mainly molecular biology-based approaches for protecting crops against tobamoviruses. These include cross-protection (using mild tobamovirus strains to ‘immunize’ plants against severe strains), expressing viral gene products in transgenic plants to inhibit the viral infection cycle, inducing RNA silencing against tobamoviruses by expressing virus-derived RNA sequences in planta or by direct application of double-stranded RNA molecules to non-engineered plants, gene editing of host susceptibility factors, and the transfer and optimization of natural resistance genes.

Ketogenic diet (KD) is getting in the focus as auxiliary cancer therapy, since it provides sufficient energy supply for healthy cells, while impairing energy production in tumor cells underlying the Warburg effect. Thereby, it can assist in inhibiting tumor growth and simultaneously counteract cachexia, which is frequently observed in cancer patients under chemotherapy. In order to provide molecular evidence for the proposed synergistic inhibition of tumor growth, we applied untargeted quantitative metabolome analysis on a breast cancer xenograft mouse model. Healthy mice and such bearing breast cancer xenografts and receiving chemotherapy were compared after treatment with control diet and KD. Metabolomic profiling was performed on plasma samples, applying high-performance liquid chromatography coupled to tandem mass spectrometry. Statistical analysis revealed metabolic fingerprints comprising numerous significantly regulated features in the group of mice bearing breast cancer. This fingerprint disappeared after treatment with KD, resulting in recovery to the metabolic status observed in healthy mice receiving control diet. Moreover, amino acid metabolism as well as fatty acid transport were found to be affected by both, the tumor and the applied KD. Our results provide clear evidence of a significant molecular effect of KD in the context of tumor growth inhibition.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Brain metastasis is the most common intracranial malignancy in adults. The prognosis is extremely poor, partly because most patients have more than one brain lesion, and the currently available therapies are nonspecific or inaccessible to those occult metastases due to an impermeable brain-tumor-barrier (BTB). Phosphatidylserine (PS) is externalized on the surface of viable endothelial cells (ECs) in tumor blood vessels. In this study, we have applied a PS-targeting antibody to assess brain metastases in mouse models. Fluorescence microscopic imaging revealed that extensive PS exposure was found exclusively on vascular ECs of brain metastases. The highly sensitive and specific binding of the PS antibody enables individual metastases, even micrometastases containing an intact BTB, to be clearly delineated. Furthermore, conjugation of the PS antibody with a fluorescence dye, IRDye 800CW, or a radioisotope, ¹²⁵I, allowed clear visualization of individual brain metastases by optical imaging and autoradiography, respectively. In conclusion, we demonstrated a novel strategy of targeting brain metastases based on our finding that abundant PS exposure occurs on blood vessels of brain metastases but not normal brain, which may be useful for the development of imaging and targeted therapeutics for brain metastases

The age-related loss of muscle mass and strength is referred to as “sarcopenia”. The combined effect of sarcopenia and osteoporosis is a devastating threat to the old adult, accounting for reduced mobility, risk for falls and subsequent fractures. In previous studies, we observed a high degree of inter-individual variability of paraspinal muscle fatty infiltration, one most relevant index of muscle wasting. This aspect solicited us to develop a computerized method to quantitatively characterize muscle fatty infiltration in aging and diseases. Magnetic resonance images of paraspinal muscles from 58 women of different age (age range 23-85 years) and physio-pathological status (healthy young, pre-menopause, post-menopause, and os-teoporosis), were used to set up the method. It is based on fractal analysis of lean muscle area (contractile muscle) to estimate muscle fatty infiltration. In particular, lacunarity was computed by parameter β from our hyperbola model function, used to fit the GBA (gliding box algorithm) curvilinear plot. Succolarity was estimated by parameter µ, for the four main directions, through an algorithm implemented on purpose. Results show that fractal lacunarity, by quantifying muscle fatty infiltration, can discriminate be-tween osteoporosis and healthy aging while succolarity can separate the other three groups showing similar lacunarity. Therefore, fractal features of contractile muscle, by measuring fatty infiltration, can represent good indices of sarcopenia in aging and disease.

Important tumor biomarkers, therapeutic targets, and mechanisms of tumorigenesis were discovered in animal models. Mouse models of malignant gliomas were represented by transplantable, chemically-induced, and genetically-engineered cells. The aim of the study was to investigate the morphological, molecular, and immunological characteristics of two original glioblastoma (GB) strains, M2 and M6. These are new, chemically-induced, trans-plantable tissue models of malignant diffuse mouse glioma. Tissues from M2 GB and M6 GB were transplanted into immunocompetent C57BL/6 mice. The clinical manifestations of M2 GB and M6 GB growth in mice include motility disorders, cachexia, and priapism. Morphologically, M2 GB and M6 GB are characterized by diffuse proliferation, cellular and nuclear polymorphism, high mitotic activity, and pathological forms of mitosis due to the aggressive nature of these tumors. Flow cytometry showed that CD3+ T lymphocytes (~32%) and F4/80+ macrophages (~28-50%) highly infiltrated both tumors. M2 GB had higher levels of F4/80+ macrophages than M6 GB. Cdkn2a, S100b, Mki67, Pten, Vegfa, Hif1a, Sox2, Abcb1, and Gfap genes were overexpressed in both tumors. Cd133, Tp53, and Pdgfra expression was increased in M2 GB. High expression of Pi3k and Gdnf was observed in M6 GB. Expression of Cd44, Pi3k, Hif1a, Gdnf and Egfr was higher in the M6 GB tissues com-pared to M2 GB, while Cdkn2a, Tp53, Cd133 and Pdgfra were higher in the M2 GB tissue compared to M6 GB. The transplantable M2 GB and M6 GB tissue models have intratumor immune responses, clinical and morphological features similar to human GB, as well as gene expression patterns that are important for further studies on tumorigenesis. These models can be used to develop diagnostic and therapeutic procedures and study carcino-genesis.

CD44 regulates cell adhesion, proliferation, survival, and stemness and has been considered a tumor therapy target. CD44 possesses the shortest CD44 standard (CD44s) and a variety of CD44 variant (CD44v) isoforms. Since the expression of CD44v is restricted in epithelial cells and carcinomas compared to CD44s, CD44v has been considered a promising target for monoclonal antibody (mAb) therapy. We previously developed an anti‐CD44v10 mAb, C44Mab-18 (IgM, kappa) to recognize the variant exon 10-encoded region. In the present study, a mouse IgG2a version of C44Mab-18 (C44Mab-18-mG2a) was generated to evaluate the antitumor activities against CD44-positive cells compared with previously established anti-pan CD44 mAb, C44Mab-46-mG2a. C44Mab-18-mG2a exhibited higher reactivity compared with C44Mab-46-mG2a to CD44v3–10-overexpressed CHO-K1 (CHO/CD44v3–10) and oral squamous cell carcinoma cell lines (HSC-2 and SAS) in flow cytometry. C44Mab-18-mG2a exerted a superior antibody‐dependent cellular cytotoxicity (ADCC) against CD44v3–10. In contrast, C44Mab-46-mG2a showed a superior complement‐dependent cytotoxicity (CDC) against CD44v3–10. A similar tendency was observed in ADCC and CDC against HSC-2 and SAS. Furthermore, administering C44Mab-18-mG2a or C44Mab-46-mG2a significantly suppressed CD44v3–10, HSC-2, and SAS xenograft tumor growth compared with the control mouse IgG2a. These results indicate that C44Mab-18-mG2a could be a promising therapeutic regimen for CD44v10-positive tumors.

Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection, with septic cardiomyopathy being a common and severe complication. Despite its significant clinical impact, the molecular mechanisms underlying sepsis-induced cardiomyopathy (SICM) remain incompletely understood. In this study, we performed a comparative analysis of whole transcriptome profiles in two widely used mouse models of septic cardiomyopathy, the cecal ligation and puncture (CLP) model and the lipopolysaccharide (LPS) model. Our aim was to identify key genes and pathways involved in the development of septic cardiomyopathy and to evaluate the similarities and differences between the two models. Our findings suggested that 1) both methods can induce septic heart dysfunction within 24 hours; 2) distinct whole transcriptome expression profiles are revealed; 3) potentially different pathways are involved in causing heart failure in sepsis. The comprehensive comparison provides valuable insights into the molecular basis of septic cardiomyopathy and contributes to the ongoing search for effective treatment strategies, triggered by different factors for SICM.

The zebrafish is now an important model organism for cancer biology studies and provides some unique and complementary opportunities in comparison to the mammalian equivalent. The translucency of zebrafish has allowed in vivo live imaging studies of tumour initiation and progression at the cellular level thus providing novel insights into our understanding of cancer. Here we summarise and discuss available transgenic zebrafish tumour models and what we have gleaned from them with respect to cancer inflammation. In particular, we focus on the host inflammatory response toward transformed cells during the pre-neoplastic stage of tumour development. We discuss features of tumour associated macrophages and neutrophils in mammalian models and present evidence which supports the idea that these inflammatory cells promote early stage tumour development and progression. Direct live imaging of tumour initiation in zebrafish models has shown that the intrinsic inflammation induced by pre-neoplastic cells is tumour promoting. Signals mediating leukocyte recruitment to pre-neoplastic cells in zebrafish correspond to signals mediating leukocyte recruitment in mammalian tumours. The activation state of macrophages and neutrophils recruited to pre-neoplastic cells appears to be heterogenous, as seen in mammalian models, which provides an opportunity to study the plasticity of innate immune cells during tumour initiation. Although several potential mechanisms are described that might mediate the trophic function of innate immune cells during tumour initiation in zebrafish, there are several unknowns that are yet to be resolved. Rapid advancement of genetic tools and imaging technologies for zebrafish will facilitate research into the mechanisms that modulate leukocyte function during tumour initiation and identify targets for cancer prevention.

Gene therapy has seen major progress in recent years. Viral vectors have made a significant contribution through efficient engineering for improved delivery and safety. A large variety of indications such as cancer, cardiovascular, metabolic, hematological, neurological, muscular, ophthalmological, infectious diseases, and immunodeficiency have been targeted. Viral vectors based on adenoviruses, adeno-associated viruses, herpes simplex viruses, retroviruses including lentiviruses, alphaviruses, flaviviruses, measles viruses, rhabdoviruses, Newcastle disease virus, poxviruses, picornaviruses, reoviruses, and polyomaviruses have been used. Proof-of-concept has been demonstrated for different indications in animal models. Therapeutic efficacy has also been achieved in clinical trials. Several viral vector-based drugs have been approved for the treatment of cancer, and hematological, metabolic, and neurological diseases. Moreover, viral vector-based vaccines have been approved against COVID-19 and Ebola virus disease.

Abstract: This study aimed at investigating the effects of Valencia KK4-type peanut skin ethanolic extract (KK4-PSE) in combination with cisplatin or 5-fluorouracil (5-FU) against HeLa cells in vitro and in xenograft models. MTT assay showed that KK4-PSE, cisplatin, and 5-FU suppressed proliferation of HeLa cells in a dose and time dependent manner. Drug interactions by Chou-Talalay method demonstrated that KK4-PSE enhanced antiproliferative activity of 5-FU against HeLa cells with combination index (CI) values of 0.49 (48 h) and 0.60 (72 h), indicating a synergistic effect, while KK4-PSE combined with cisplatin exhibited an additive effect (CI = 1.02) (72 h) and antagonistic effect at 24 and 48 h exposures (CI = 1.12 and 1.18, respectively). In nude mouse xenograft models, the combination of 5-FU and KK4-PSE markedly reduced HeLa tumor weights compared with control and single agent treatments. The combination of KK4-PSE and 5-FU achieved greater tumor growth inhibition than that of the KK4-PSE-cisplatin combination. KK4-PSE mitigated hepatotoxicity induced by both cisplatin and 5-FU in nude mice. The spleen hyaloserositis was significantly reduced in the combination treatment of 5-FU and KK4-PSE. These findings suggest a potential of KK4-PSE to inhibit cervical cancer cell growth while alleviating the toxicities of cisplatin and 5-FU.

Following the detection of highly pathogenic avian influenza (HPAI) virus in countries bordering Kenya to the west, we conducted surveillance among domestic and wild birds along the shores of Lake Victoria. In addition, between 2018 and 2020, we conducted surveillance among poultry and poultry workers in live bird markets and among wild migratory birds in various lakes that are resting sites during migration to assess introduction and circulation of avian influenza viruses in these populations. We tested 7,464 specimens (oropharyngeal and cloacal swabs) from poultry and 6,531 fresh fecal specimens from wild birds for influenza A viruses by real-time RT-PCR. Influenza was detected in 3.9% (n=292) of specimens collected from poultry and 0.2% (n=10) of fecal specimens from wild birds. On hemagglutinin subtyping, most of the influenza A positives from poultry (274/292, 93.8%) were H9. Of 34 H9 specimens randomly selected for further subtyping, all were H9N2. On phylogenetic analysis, these viruses were genetically similar to other H9 viruses detected in East Africa. Only two of the ten influenza A positive specimens from the wild bird fecal specimens were successfully subtyped; sequencing analysis of one specimen collected in 2018 was identified as low pathogenicity avian influenza H5N2 virus of the Eurasian lineage and the second specimen, collected in 2020, was subtyped as H11. A total of 18 OP/NS swabs from poultry workers with ARI (12%) were collected; none were positive for influenza A virus. We observed significant circulation of H9N2 influenza viruses in poultry in live bird markets in Kenya. During the same period, low pathogenic H5N2 virus was detected in a fecal specimen collected in a site hosting a variety of migratory and resident birds. Although HPAI H5N8 was not detected in this survey, these results highlight the potential for introduction and establishment of highly pathogenic avian influenza viruses in poultry populations and the associated risk of spillover to human populations.

The social fear conditioning (SFC) paradigm, which is an animal model of social anxiety disorder, has been extensively used to investigate the cellular and molecular mechanisms underlying the psychopathology of this disorder. Studies using the SFC paradigm have suggested that the lateral septum plays a pivotal role in regulating social fear. While several lines of evidence have indicated the involvement of various neuronal mechanisms within the LS in modulating social fear, the role played by LS astrocytes in the tripartite synapses in regulating social fear expression is not yet fully understood. Over the years, astrocytes have emerged as key players in regulating synaptic transmission and a plethora of animal behaviors. Given their dynamic morphological and molecular response to various stimuli, studying astrocyte morphology remains an excellent tool for understanding their role in brain function and disease. By applying immunofluorescent-immunohistochemical methods, here we describe a protocol to characterize changes in the morphology of astrocytes in response to social fear acquisition using confocal microscopy.

Methylation is a biochemical process involving the addition of a methyl group (-CH3) to various chemical compounds. It plays a crucial role in maintaining the homeostasis of the endothelium, which lines the interior surface of blood vessels and has been linked, among other conditions, to coronary artery disease (CAD). Despite significant progress in CAD diagnosis and treatment, intensive research continues into genotypic and phenotypic CAD biomarkers. This review explores the significance of the methylation pathway and folate metabolism in CAD pathogenesis, with a focus on endothelial dysfunction resulting from deficiency in the active form of folate (5-MTHF). We discuss emerging areas of research into CAD biomarkers and factors influencing the methylation process. By highlighting genetically determined methylation disorders, particularly the MTHFR polymorphism, we propose the potential use of the active form of folic acid (5-MTHF) as a novel CAD biomarker and personalized pharmaceutical for selected patient groups. Our aim is to improve the identification of individuals at high risk of CAD and enhance their prognosis.

Necroptosis is an inflammatory form of lytic programmed cell death that is thought to have evolved to defend against pathogens. Genetic deletion of the terminal effector protein – MLKL – shows no overt phenotype in the C57BL/6 mouse strain under conventional laboratory housing conditions. Small molecules that inhibit necroptosis by targeting the kinase activity of RIPK1, one of the main upstream conduits to MLKL activation, have shown promise in several murine models of non-infectious disease and in phase II human clinical trials. This has triggered multi-billion-dollar investments into the emerging class of necroptosis blocking drugs, and the potential utility of targeting the terminal effector is being closely scrutinised. Here we review murine models of disease, both genetic deletion and mutation, that investigate the role of MLKL. We summarize a series of examples from several broad disease categories including ischemia reperfusion injury, sterile inflammation, pathogen infection and haematological stress. Elucidating MLKL’s contribution to mouse models of disease is an important first step to identify human indications that stand to benefit most from MLKL-targeted drug therapies.

The development of plant-based meat analogues has become a significant challenge for the food industry in recent years due to the increasing demand for sustainable and healthier proteins in the context of a global protein transition. Plant-based meat analogues imitate the visual, textural, and chemical properties of traditional meat products and are required to closely resemble meat to appeal to consumers. In addition, consumers demand natural, clean-label, and nutritional and healthy products. To address these challenges, the food industry must develop highly healthy, nutritious, and E-number-free meat analogue products. Understanding the functionality of each ingredient and its role in the food matrix is crucial to being a key player in the innovation of the meat analogues market. This review provides updated information on the primary ingredients utilized for the development of plant-based burger meat alternatives and their functionality. The key components of meat analogue burgers are outlined, including plant proteins, binding agents, fats and oils, flavorings, colorings, preservatives, fortificants, and clean-label considerations.

This study focuses on mimicking constitutive phosphorylation in the N-terminus of the myosin regulatory light chain (S15D-RLC) as a rescue strategy for the mutation-induced cardiac dysfunction in transgenic (Tg) models of restrictive (RCM) and dilated (DCM) cardiomyopathy caused by mutations in myosin essential (ELC) or regulatory (RLC) light chains. S15D-RLC phosphomimetic was reconstituted in left ventricular papillary muscle (LVPM) fibers from two mouse models of cardiomyopathy, RCM-E143K ELC and DCM-D94A RLC, along with their corresponding Tg-ELC and Tg-RLC wild type (WT) mice. The beneficial effects of S15D-RLC in rescuing cardiac function were manifested by S15D-RLC-induced destabilization of the super-relaxed (SRX) state that was observed in both models of cardiomyopathy. S15D-RLC promoted a shift from the SRX state to the disordered relaxed (DRX) state, increasing the number of heads readily available to interact with actin and produce force. Additionally, S15D-RLC reconstituted fibers demonstrated significantly higher maximal isometric force per cross-section of muscle compared with reconstitution with WT-RLC protein. The effects of the phosphomimetic S15D-RLC were compared to those observed for Omecamtiv Mecarbil (OM), a myosin activator shown to bind to the catalytic site of cardiac myosin and increase myocardial contractility. A similar SRX↔DRX equilibrium shift was observed in OM=treated fibers as in S15D-RLC-reconstituted preparations. Additionally, treatment with OM resulted in significantly higher maximal pCa 4 force per cross-section of muscle fibers in both cardiomyopathy models. Our results suggest that both treatments with S15D-RLC and OM may improve the function of myosin motors and cardiac muscle contraction in RCM-ELC and DCM-RLC mice.

Non-homologous end joining (NHEJ) is the main DNA repair mechanism for the repair of double strand breaks (DSBs) throughout the course of the cell cycle. DSBs are generated in developing B and T lymphocytes during V(D)J recombination to increase the repertoire of B and T cell receptors. DSBs are also generated during the class switch recombination (CSR) process in mature B lymphocytes, providing distinct effector functions of antibody heavy chain constant regions. Thus, NHEJ is important for both V(D)J recombination and CSR. NHEJ comprises core Ku70 and Ku80 subunits that form the Ku heterodimer, which binds DSBs and promotes the recruitment of accessory factors (e.g., DNA-PKcs, Artemis, PAXX, Mri) and downstream core factors (XLF, Lig4 and XRCC4). In recent decades, new NHEJ proteins have been reported, increasing complexity of this molecular pathway. Numerous in vivo mouse models have been generated and characterized to identify the interplay of NHEJ factors and their role in development of adaptive immune system. This review summarizes the currently available mouse models lacking one or several NHEJ factors, with a particular focus on early B cell development. We also underline genetic interactions and redundancy in the NHEJ pathway in mice.

Background: In response to inflammation, the absorption of nutritional iron is restricted. Multiple inflammation-related signaling pathways can lead to ferroptosis, an iron-dependent mechanism of programmed cell death. Since the pathophysiological significance of the presence and uptake of iron in chronic inflammation is still unknown, we tested the effect of a low iron diet on the clinical course of arthritis in the mouse model of collagen-induced arthritis (CIA). Methods: Six- to eight-week-old male DBA/1 mice were fed either a normal or a low iron diet starting three weeks before arthritis induction. From day four after the collagen-booster made on day 25, the development of arthritis was regularly monitored until the end of the experiment (day 34), using a standard clinical arthritis score. The complete blood count was determined as well as Fe2+, Fe3+, oxidized and reduced glutathione (GSH and GSSG) and malondialdehyde (MDA) in whole paw tissue by ELISA. Quantitative PCR was performed from whole paw tissue for glutathione peroxidase 4 and other key regulator genes of iron metabolism and ferroptosis. We used nonparametric tests to com-pare markers of iron metabolism and ferroptosis as well as nonlinear regression models for longitu-dinal data for signs of arthritis. Results: Mice fed a low iron diet showed a significantly less severe course of arthritis compared to mice fed a normal iron diet (p

Antimicrobial resistance (AMR) is a major global concern; antibiotics and other regular treatment methods have failed to overcome the increasing number of infectious diseases. Bacteriophages (phages) are viruses that specifically target/ kill bacterial hosts without affecting other human microbiome. Phage therapy provides optimism in the current global healthcare scenario with a long history of its applications in humans that has now reached various clinical trials. Phages in clinical trials have specific requirements of being exclusively lytic, free from toxic genes with an enhanced host range that adds an advantage to this requisite. This review explains in detail the various phage engineering methods and their potential applications in therapy. To make phages more efficient, engineering has been attempted using techniques like conventional homologous recombination, Bacteriophage Recombineering of Electroporated DNA (BRED), clustered regularly interspaced short palindromic repeats (CRISPR)-Cas, CRISPY-BRED/Bacteriophage Recombineering with Infectious Particles (BRIP), chemically accelerated viral evolution (CAVE), and phage genome rebooting. Phages are administered in cocktail form in combination with antibiotics, vaccines, and purified proteins, such as endolysins. Thus, phage therapy is proving to be a better alternative for treating life-threatening infections, with more specificity and fewer detrimental consequences.

Alzheimer’s disease (AD) poses a significant public health challenge due to its irreversible and progressive nature while lack of a cure. As a potential strategy to combat AD, its prevention becomes increasingly attractive. Mild Cognitive Impairment due to AD (MCI-AD) represents a critical transitional stage between normal age-related cognitive decline and more severe AD conditions, occurring just before dementia onset. Unfortunately, there is currently no established animal model that accurately recapitulates MCI-AD characteristics. While many laboratories have traditionally used normally aged wild-type animals as experimental models, this approach falls short in representing the inherently worse state of MCI-AD compared to normal aging. To address this gap, we introduce an animal model—a transgenic mouse line with genetic inactivation of G protein-coupled receptor kinase-5 (GRK5), commonly known as the GRK5 knockout (GRK5KO) mouse. These GRK5KO mice exhibit amnesia, cognitive deficits, increased β-amyloid levels, neurofibrillary tangle (NFT) immunopositive axonopathy, and hippocampal neurodegenerative changes. Importantly, these pathological alterations predominantly impact the entorhinal, transentorhinal, and hippocampal cortices, aligning with human MCI-AD criteria and Braak stage II of human AD progression. Notably, female GRK5KO mice show approximately 2.5 times more NFT-positive axonopathy than males, mirroring the higher prevalence of AD cases in women. Collectively, existing data strongly supports the GRK5KO mouse as a qualified animal model for studying MCI-AD.

Juvenile Polyposis Syndrome (JPS) is a rare autosomal dominant disorder characterized by multiple juvenile polyps in the gastrointestinal tract, often associated with mutations in genes such as Smad4 and BMPR1A. This study explores the impact of Smad4 knockout on the development of intestinal polyps using Collaborative Cross (CC) mice, a genetically diverse model. Our results reveal a significant increase in intestinal polyps in Smad4 knockout mice across the entire population, emphasizing the broad influence of Smad4 on polyposis. Sex-specific analyses demonstrate higher polyp counts in knockout males and females compared to their WT counterparts, with distinct correlation patterns. Line-specific effects highlight the nuanced response to Smad4 knockout, underscoring the importance of genetic variability. Multimorbidity heat maps offer insights into complex relationships between polyp counts, locations, and sizes. Heritability analysis reveals a significant genetic basis for polyp counts and sizes, while machine learning models, including k-Nearest Neighbours and Linear Regression, identify key predictors, enhancing our understanding of juvenile polyposis genetics. Overall, this study provides a comprehensive understanding of the intricate genetic interplay in the context of Smad4 knockout, offering valuable insights into potential therapeutic targets for juvenile polyposis and related diseases.

Interferon-gamma (IFN-γ) is an important cytokine in host defense against tuberculosis infection. In some cases, administration of IFN-γ during tuberculosis infection can promote faster cure. In the present work, we have shown that in a mouse model, human interferon-gamma, exhibits some anti-tuberculosis activity, especially in combination with isoniazid.

Abstract: The broad clinical use of synthetic vascular grafts for vascular diseases is limited by their thrombogenicity and low patency rate, especially for vessels with a diameter inferior to 6 mm. Alternatives such as tissue-engineered blood grafts (TEBGs) have gained increasing interest. Among the different manufacturing approaches, 3D bioprinting presents numerous advantages and enables the fabrication of multi-scale, multi-material, and multicellular tissues with heterogeneous and functional intrinsic structures. Extrusion-, inkjet- and light-based 3D printing techniques have been used for the fabrication of TEBG out of hydrogels, cells, and/or solid polymers. This review discusses the state-of-the-art research on the use of 3D printing for TEBG with a focus on the biomaterials and deposition methods.

Promoter is a small region of DNA sequence in response to various transcription factors, which initiates a particular gene expression. The promoter-engineered bio-sensor can activate or repress gene expression through transcription factor recognizing specific molecules, such as polyamine, sugars, lactams, amino acids, organic acids or redox molecule, however, the reported applications of promoter enhanced bio-sensor are not too much. This review paper highlights the strategies of construction of promoter-gene engineered bio-sensor with human and bacteria’s genetic promoter array for high-throughput screening (HTS) molecular drugs, study of membrane protein’s localization and nucleocytoplasmic shuttling mechanism of regulating factor, enzyme activity, detection of the toxicity of intermediate chemicals, and probing bacteria density to improve value-added product titer. These bio-sensors’s sensitivity and specificity can be further improved by proposed approaches of Mn²⁺ and Mg²⁺ added random Error-prone PCR and site-directed mutagenesis which is applied for construction of bacteria’s “mutant library”. It is expected to establish flexible HTS platform (Bio-sensor array) to large-scale screen transcription factor-acting drugs, reducing the toxicity of intermediate compounds, and constructing gene dynamic regulatory system in “push and pull” mode to effectively regulate the valuable medicinal product production. This proposed novel promoter-engineered biosensors aided synthetic genetic circuit construction will maximize the efficiency of bio-synthesis of medicinal compound, which will greatly promote the development of microbial metabolic engineering and biomedical science.

Cholangiocarcinoma is an aggressive cancer with limited treatment options. Current therapies, such as cisplatin and 5-fluorouracil (5-FU), often cause side effects and drug resistance. This study investigated a potential new approach by combining a peanut skin extract (KK4-PSE) with these drugs. The extract effectively inhibited the growth of cholangiocarcinoma cells in laboratory studies and showed even greater selectivity for cancer cells compared to healthy cells. When combined with cisplatin or 5-FU, KK4-PSE enhanced the drugs' effects, leading to cell cycle arrest and increased cell death. These combined treatments also reduced levels of proteins that promote cancer cell survival. In animal models, KK4-PSE combined with 5-FU showed superior tumor suppression compared to the combination with cisplatin. Overall, these findings suggest that KK4-PSE may be a promising synergistic agent to improve the effectiveness of chemotherapy for cholangiocarcinoma, warranting further clinical investigation.

The possibility of abrupt transitions threatens to poise ecosystems into irreversibly degraded states. Recently, it has been proposed the use of engineered microbiomes in endangered ecosystems to prevent them to cross tipping points and avoid collapse. Potential targets for such interventions include some of the most prominent life-support systems in the biosphere: drylands and coral reefs. Since engineering can require the introduction of microorganisms not present in resident communities, how can we weight the potential outcomes? One way is to use general models of species interactions where the "synthetic" strain is incorporated into a standard multispecies model. Here we follow this approach by modelling a resource-consumer community where one of the species is a modified one that acts by preserving some key resource. We show how the indirect effect of damping the decay of shared resources results in biodiversity increase, and last but not less, the successful incorporation of the synthetic within the ecological network. Further extensions and implications for future restoration and terraformation strategies are discussed.

This study presents an innovative approach to interdisciplinary education by integrating principles of biology, engineering and art to foster holistic learning experiences for children. The focus lies on assembling mycelium bricks as engineered living materials with promising applications in sustainable construction. Through a collaborative group task, children engage in the hands-on creation of these bricks, gaining insights into mycology, biomaterials engineering and artistic expression. The curriculum introduces fundamental concepts of mycelial growth and its potential in sustainable material development. Children actively participate in fabricating 3D forms (negative and positive) using mycelium bricks, thereby gaining practical knowledge in shaping and moulding living materials. This hands-on experience enhances their understanding of biological processes and cultivates an appreciation for sustainable design principles. The group task encourages teamwork, problem-solving, and creativity as children collaboratively compose structures using mycelium bricks. Integrating art into the activity adds a creative dimension, allowing participants to explore aesthetic aspects while reinforcing the project’s interdisciplinary nature. Conversations about the material’s end of life and decomposition are framed within the broader context of Nature’s cycles, facilitating an understanding of sustainability. This interdisciplinary pedagogical approach provides a model for educators seeking to integrate diverse fields of knowledge into a cohesive and engaging learning experience. The study contributes to the emerging field of biomimetics education, illustrating the potential of integrating living materials and 3D understanding activities to nurture a holistic understanding of science, engineering and artistic expression in young learners.

Proteinuria is known to be associated with all-cause and cardiovascular mortality, and nephrotic syndrome is defined by the level of proteinuria and hypoalbuminemia. With advances in medicine, new causative genes for genetic kidney diseases are being discovered increasingly frequently. We reviewed articles on proteinuria/nephrotic syndrome, focal segmental glomerulosclerosis, membranous nephropathy, diabetic kidney disease/nephropathy, hypertension/nephrosclerosis, Alport syndrome, and rare diseases, which have been studied in mouse models. Significant progress has been made in understanding the genetics and pathophysiology of kidney diseases thanks to advances in science, but research in this area is ongoing. In the future, genetic analyses of patients with proteinuric kidney disease/nephrotic syndrome may ultimately lead to personalized treatment options.

Objective: This research was aimed to estimate the anti-fatigue effects of arecoline and elucidate its underlying mechanisms using a murine model of central fatigue precipitated by sleep deprivation (SD). Methods: Seventy-two male C57BL/6 mice were randomly allocated into six groups: a control group, a SD-induced fatigue model group, a group receiving Rhodiola Rosea capsules (2.5 mg/kg), and arecoline groups administered low, medium, and high doses (10, 20, and 40 mg/kg, respectively). Following 28 days of continuous administrations, the effects of arecoline on the mouse fatigue-related behaviors was assessed by the behavioral tests, including grip strength, rotarod performance, and weight-bearing swimming endurance. Enzyme-linked immunosorbent assays (ELISAs) were utilized to measure the levels of the relevant biochemical markers. Western blotting was employed to quantify the expression of nuclear factor erythroid 2-related factor (Nrf2), Kelch-like ECH-associated protein 1 (Keap1), heme oxygenase 1 (HO-1), sequestosome-1 (p62), and NADPH quinone oxidoreductase 1 (NQO1) in the gastrocnemius muscle. Results: Arecoline administration notably enhanced grip strength, delayed the onset of fatigue as evidenced by extended latencies in rotarod tests, and increased the duration of weight-bearing swimming in mice. In the elevated plus maze, arecoline significantly reduced both the number of entries and the total distance traveled in the open arms. Arecoline markedly decreased serum levels of creatine kinase, blood urea nitrogen, lactate dehydrogenase, triglycerides, and cholesterol, while elevated total testosterone, lactate dehydrogenase, and immunoglobulin G levels. Furthermore, it significantly increased superoxide dismutase(SOD), catalase(CAT), and glutathione peroxidase activity in the gastrocnemius muscle, reduced malondialdehyde levels, augmented hippocampal SOD and CAT activity, and elevated glycogen stores in both liver and muscle tissues. Neurotransmitter levels were significantly increased, cytokine levels were markedly reduced, and the expression of Nrf2, Keap1, NQO1, p62, and HO-1 in brain tissue was significantly upregulated. Conclusion: The current study for the first time demonstrated that arecoline has significant anti-fatigue activity, and its mechanism of action is related to elevate the levels of glucose and lipid metabolism, relieve oxidative stress damage, inhibit neuroinflammatory response, regulate neurotransmitter levels and Keap1/Nrf2/HO-1 signaling pathway. The current study provides a new insight into the potential of arecoline in prevention and improvement of fatigue.

To elucidate mesenchymal stromal cells (MSC)-tumor intricate and ambiguous interactions, the reliable cell labeling and tracking techniques are imperative. Traditional methods of cell labelling have limitations mostly relevant to need for genetic modification what demands the exploration for alternative strategies. Here, we propose using fluorescent photoconvertible microcapsules containing Rhodamine B (RhB) to study mMSC migration in brain tumors. These 3 μm sized microcapsules are readily internalised by cells and undergo photoconversion under 561 nm laser exposure with fluorescence blue shift on demand. Optimal photoconversion was achieved with a laser irradiation duration of 0.4 ms, which provide a maximal brightness of photoconverted label without an excessive laser exposure on cells. Capsules modified with polyallylamine hydrochloride demonstrated the best potential for intracellular uptake without significantly affecting cell viability, motility, or proliferation. The optimal ratio of 20 capsules per mMSC was determined for labeling. Moreover, migration of individual mMSCs within 2D and 3D glioblastoma cell (EPNT-5) colonies over 2 days and in vivo tumor settings over 7 days was tracked. Our study unveils a robust platform for investigating MSC-tumor dynamics, offering insights into therapeutic strategies. Photoconvertible microcapsules could also become an indispensable tool for studying complex fundamental processes of cell-cell interactions for a wide range of problems in biology and medicine.

Ulcerative colitis (UC) is a chronic inflammatory disease, the incidence of which is increasing worldwide. However, the etiology and pathogenesis of UC remains unclear. The n-butanol extract of pulsatilla decoction (BEPD) of the traditional Chinese medicine herbal formula has been shown to be effective in treating UC. We aimed to explore the molecular mechanism underlying the effects of BEPD on UC, in particular its effects on neutrophil extracellular trap (NET) formation by neutrophils. High-performance liquid chromatography was used to determine the principal compounds of BEPD. UC was induced in mice using dextran sodium sulfate, and mice were treated with 20, 40, or 80 mg/kg BEPD daily for seven days. Colonic inflammation was determined by assessing the disease activity index, histopathology, colonic mucosal damage index, colonic mucosal permeability, and pro- and anti-inflammatory cytokine levels. The infiltration and activation status of neutrophils in the colon were determined by analyzing the levels of chemokine (C-X-C motif) ligand (CXCL)1 and CXCL2, reactive oxygen species, Ly6G, and numerous NET proteins. Our results showed that BEPD improved the disease activity index, histopathology, and colonic mucosal damage index scores of mice with UC, and restored colonic mucosal permeability compared with untreated mice. The expression levels of the pro-inflammatory cytokines interleukin-1β, interleukin-6, and tumor necrosis factor-α in colon tissues were significantly decreased, while the expression levels of anti-inflammatory cytokines in colon tissues were significantly increased, exceeding those of control mice. In addition, BEPD reduce the expression of the neutrophil chemokines CXCL1 and CXCL2 in the colon tissue of mice with UC, reduced neutrophil infiltration, reduced reactive oxygen species levels, and significantly reduced the expression of NET proteins. BEPD also significantly reduced NET formation. The results of this study suggest that BEPD exerts therapeutic effects in a murine model of UC by inhibiting neutrophil infiltration and activation in the colon, as well as by inhibiting the expression of key proteins involved in NET formation and reducing NET formation, thereby alleviating local tissue damage and disease manifestations.

Mechanical properties of cardiomyocytes from different transmural regions are heterogeneous in the left ventricular wall. The cardiomyocyte mechanical environment affects this heterogeneity because of mechano-electric feedback mechanisms. In the present study, we investigated the effects of load upon transmural differences in contraction of subendocardial (ENDO) and subepicardial (EPI) single cells isolated from the murine left ventricle. Various loads were applied to the cells using carbon fiber techniques for single myocytes. To simulate experimentally obtained results and to predict mechanisms underlying the cellular response to change in load, our mathematical models of the ENDO and EPI cells were used. Extent of the transmural gradient in the time course of contractions was independent of the loading conditions where unloaded and heavy loaded (isometric) contractions were examined, but the regional gradient of the relaxation time characteristics tended to decrease when the load decreased. Under auxotonic contractions, time to peak contraction (T_max) was significantly longer in ENDO cells than in EPI cells at low preload. An increase in preload (axial stretch) prolonged T_max in both cell types; however, the prolongation was greater in EPI cells, resulting in a decrease in transmural gradient in T_max at high preload. The [Ca²⁺]_i transient decay time constant was consistent with the greater preload dependency in T_max of EPI cells. Our modified mathematical models reproduced experimental results, suggesting that differences in cooperativity of cross bridges and calcium troponin C complex interactions between the ENDO and EPI cardiomyocytes may contribute to the different cellular responses to stretch, which may provide a decrease in transmural dispersion of cellular shortening in the intact heart.

If we assume that: a. The four fundamental forces of nature are independent waves without rest masses, and their speeds are constant in a vacuum, just like light. b. Light or electromagnetic waves and gravity are comparable in structures. Weak and strong interactions are similar in structures. c. Light and weak interaction have the same speed c_L with spin number +1 or –1. d. Gravity and strong interaction have the same speed c_G without spin. e. The primary particles, namely electrons, electron neutrinos, and dark neutrinos in this paper, are made by the above four waves. We can find and describe some fundamental characteristics of the primary particles (e.g., their sizes, energies, and interactions) and introduce new attractive results from them (e.g., the source of the Pauli exclusion principle, the solution to the Einstein-Podolsky-Rosen paradox, and c_G slightly faster than c_L).

Metasurfaces of gold (Au) nanoparticles on a SiO2-Si substrate were fabricated for the enhancement of second harmonic generation (SHG) using electron beam lithography and lift-off. Triangular Au nanoprisms which are non-centro-symmetric and support the second- order non-linearity were examined for SHG. The thickness of the SiO2 spacer is shown to be an efficient parameter to spectrally tune to maximise SHG. Electrical field enhancement at the fundamental wavelength was shown to define the intensity of the second harmonics. Numerical modeling of light enhancement was verified by experimental measurements of SHG and reflectivity spectra at the normal incidence. At the plasmonic resonance, SHG is enhanced up to ∼3.5×103 times for the optimised conditions.

Glaucoma is a blinding disease largely caused by increased resistance to drainage of fluid from the eye’s anterior chamber, resulting in elevated intraocular pressure (IOP). A major site of fluid outflow regulation and pathology is the trabecular meshwork (TM) at the entrance of the eye’s drainage system. We aimed to characterize the structural and functional properties of a newly developed tissue-engineered anterior segment eye culture model. We hypothesized that repopulation of a decellularized TM with non-native TM cells could restore aspects of normal TM. The decellularization protocol removed all cells and debris while preserving the ECM. Seeded cells localized to the TM region and progressively infiltrated the meshwork ECM. Cells reached a distribution comparable to control TM after four days of perfusion culture. After a perfusion rate increase challenge, tissue-engineered cultures reestablished normal IOPs (reseeded = 13.7±0.4 mmHg, decellularized = 35.2±2.2 mmHg, p < 0.0001). eGFP expressing CrFK control cells caused a high and unstable IOP (27.0±6.2 mmHg). In conclusion, we describe a readily available, storable, and biocompatible scaffold for anterior segment perfusion culture of non-native cells. Tissue-engineered organs demonstrated similarities to native tissues and may reduce the need for scarce donor globes in outflow research.

Although nanotechnology is a new and rapidly growing area of science, the impact of nanomaterials on living organisms is unknown in many aspects. In this regard it is extremely important to perform toxicological tests, but complete characterization of all varying preparations is extremely laborious. The computational technique called quantitative structure-activity relationship, or QSAR, allows reducing the cost of time- and resource-consuming nanotoxicity tests. In this review, (Q)SAR cytotoxicity studies of the past decade are systematically considered. We regard here five classes of engineered nanomaterials (ENMs): metal oxides, metal-containing nanoparticles, multi-walled carbon nanotubes, fullerenes, and silica nanoparticles. Some studies reveal that QSAR models are better than classification SAR models, while other reports conclude that SAR is more precise than QSAR. The quasi-QSAR method appears to be the most promising tool, as it allows accurately taking experimental conditions into account. However, experimental artifacts are a major concern in this case

If genetic gains in wheat yield are to be achieved in today’s breeding, increasing genetic variability of cultivated genotypes is an essential requisite to meet. To this aim, alien gene transfer through chromosome engineering (CE) is a validated and sound strategy. Attempts to incorporate more than one alien segment into cultivated wheat have been rare, particularly for tetraploid durum wheat. Here we present the agronomic and quality performance of the first successful CE-mediated multiple introgression into the latter species. By assembling into 7AL, 3BS and 1AS arms of a single genotype homoeologous segments of Thinopyrum ponticum 7el1L, Aegilops longissima 3SlS, and Triticum aestivum 1DS arms, respectively, we have stacked several valuable alien genes, comprising Lr19+Sr25+Yp (leaf and stem rust resistance and a gene increasing semolina yellowness), Pm13 (powdery mildew resistance) and Gli-D1/Glu-D3 (genes affecting gluten properties), respectively. Advanced progenies of single, double and triple recombinants were field-tested across three years in a typical durum wheat growing area of Central Italy. The results showed that not only all recombinants had normal phenotype and fertility, but also that one of the triple recombinants had the highest yield through all seasons compared with all other recombinants and control cultivars. Moreover, the multiple introgressions enhanced quality traits, including gluten characteristics and semolina yellow index. Presence of effective disease resistance genes confers additional breeding value to the novel and functional CE products, which can greatly contribute to crop security and safety.

Ubiquitin-specific protease 2 (USP2) maintains mitochondrial integrity in culture myoblasts. In this study, we investigated molecular mechanisms underlying the protective role of USP2 on mitochondria. Knockout (KO) of the Usp2 gene or chemical inhibition of USP2 induced robust accumulation of mitochondrial reactive oxygen species (ROS), accompanied by defects in mitochondrial membrane potential, in C2C12 myoblasts. ROS removal by N-acetyl-L-cysteine restored the mitochondrial dysfunction induced by USP2 deficiency. Comprehensive RT-qPCR screening and following protein analysis indicated that both genetic and chemical inhibition of USP2 elicited a decrease of uncoupling protein 2 (UCP2) at mRNA and protein levels. Accordingly, the introduction of a Ucp2-expressing construct effectively recovered mitochondrial membrane potentials, entailing an increment of the intracellular ATP level in Usp2KO C2C12 cells. In contrast, USP2 deficiency also decreased peroxisome proliferator-activated receptor  coactivator 1 (PGC1 protein in C2C12 cells, while it upregulated Ppargc1a mRNA. Overexpression studies indicate that USP2 potentially stabilizes PGC1 in an isopeptidase-dependent manner. Given that PGC1 is an inducer of UCP2 in C2C12 cells, USP2 might ameliorate mitochondrial ROS by maintaining the PGC1–UCP2 axis in myoblasts.

Non-tuberculous mycobacteria (NTM) are opportunistic pathogens that cause illness primarily in the elderly, in the immunocompromised or in patients with underlying lung disease. Mycobacterium chimaera is a NTM species belonging to the M. avium Complex (MAC) group of species. Since 2013, a global outbreak of M. chimaera infection related to heater-cooler units (HCU) used in cardio-thoracic surgery has been identified. This outbreak was caused by a single strain of M. chimaera. In order to estimate the prevalence of this outbreak strain in Israel, we sampled M. chimaera from several HCU machines in Israel, as well as from patients, sequenced their genomes and compared them to the outbreak strain. The presence of mixed mycobacteria species in the samples complicated the analysis of obtained sequences. By applying a metagenomic binning strategy, we were able to obtain genomes of single strains from the mixed samples, and characterized them. M. chimaera strains were compared to each other and to previously reported genomes from other countries. The strain causing the outbreak related to the HCU machines was identified in several such machines in Israel but not in any of the clinical samples.

Intratumour heterogeneity is often associated with poor response to treatment and bad prognosis. In addition to constitutive genetic/epigenetic sources, phenotypic and functional heterogeneity can reflect cell plasticity due to changes in gene expression patterns induced by signals from the tumour microenvironment or other cells. Positive interactions between cancer clones can increase their fitness and contribute to tumour growth, resistance to drugs and metastasis. Consequently, understanding the pathways involved in such behaviours is of great significance for cancer treatment. To explore if and how genetically distant clones can synergistically enhance each other's metastatic potential, this study used three (two breast and one lung) cancer cell lines with different aggressiveness levels. We found that (i) the conditioned media from the breast and lung aggressive lines induce mesenchymal features and increase the migration and invasion potential of the poorly metastatic breast line, and (ii) in both cases, this interclonal communication is based on the same soluble factor – namely, the tumour growth factor TGF-β1. Furthermore, when the two breast lines are mixed and co-cultured, the invasive potential of both lines is enhanced, and this outcome is dependent on the recruitment of the less aggressive clone into expressing a malignant phenotype. Based on our findings, we propose a two-tier model whereby highly metastatic clones can recruit weakly metastatic clones into acquiring an invasive phenotype, which in turn augments the invasion ability of the former (i.e., a “help me help you” strategy) through shared proteases and/or ECM remodelling. We suggest that such synergistic cooperation can easily emerge via cross-talk involving metastatic clones able to constitutively secrete signalling molecules that induce and maintain their own malignant state (i.e., autocrine/cell-autonomous signalling) and clones that have the ability to respond to those signals (i.e., paracrine/non-cell-autonomous signalling) and express a metastatic phenotype. Taking into account the lack of therapies to directly affect the metastatic process, interfering with such cooperative behaviours that tumour cells engage in during the early steps in the metastatic cascade could provide an additional strategy to increase patient survival.

In the current industrial landscape, increasingly pervaded by technological innovations, the adoption of optimized strategies for asset management is becoming a critical key success factor. Among the various strategies available, the “Prognostics and Health Management” strategy is able to support maintenance management decisions more accurately, through continuous monitoring of equipment health and “Remaining Useful Life” forecasting. In the present study, Convolutional Neural Network-based Deep Neural Network techniques are investigated for the Remaining Useful Life prediction of a punch tool, whose degradation is caused by working surface deformations during the machining process. Surface deformation is determined using a 3D scanning sensor capable of returning point clouds with micrometric accuracy during the operation of the punching machine, avoiding both downtime and human intervention. The 3D point clouds thus obtained are transformed into bidimensional image-type maps, i.e., maps of depths and normal vectors, to fully exploit the potential of convolutional neural networks for extracting features. Such maps are then processed by comparing 15 genetically optimized architectures with the transfer learning of 19 pre-trained models, using a classic machine learning approach, i.e., Support Vector Regression, as a benchmark. The achieved results clearly show that, in this specific case, optimized architectures provide performance far superior (MAPE=0.058) to that of transfer learning which, instead, remains at a lower or slightly higher level (MAPE=0.416) than Support Vector Regression (MAPE=0.857).

The enhancement of early diagnosis of lung cancer is mandatory to improve prognosis. We observed the increase cancer stem cells (CSC) and circulating tumor cells (CTC) in blood of mice on d3 after Lewis lung carcinoma (LLC) cell implantation before disease symptom. Besides we have developed an approach to reprogramming immune cells by inhibiting the MAPK/ERK pathway through MEKi and the PD-1/PD-L1 immune checkpoint signaling pathway. We hypothesized that reprogramming of spleen CD8+ T-cells could also create a population of immune cells with high antitumor activity. We reprogrammed CD8+ T-cells derived from the spleen of C57BL/6 mice (rsCD8+T-cells). The rsCD8+T-cells were able to migrate to lung and were more resistant after the exhaustion in vitro in comparison with naïve sCD8+T-cells. In the orthotopic LLC model, the rsCD8+T-cells therapy increased the amount of proliferating CD8+ and CD4+ T-cells in blood and lung from mice. The amount of CSC decreased in the blood and lung of mice treated with rsCD8+ T-cells. A morphological study revealed a decrease in the number of metastases in lung tissue. The antitumor effects of rsCD8+T-cells are based on the activation of the host immune response by increasing the populations of CD8+ and CD4+ T-cells and apoptosis of CSCs.

The potential of the Additive Manufacturing technologies is impeded by the surface finish obtained on the as-manufactured material. Therefore, the influence of various surface treatments, commonly applied to space hardware, on the mechanical properties of three selected metallic alloys (SS316L, AlSi10Mg, Ti6Al4V) prepared by using Selective Laser Melting (SLM) and Electron Beam Melting (EBM) additive manufacturing processes have been investigated. Within this study, SLM using EOS M400 and EOS M280 equipment and in addition EBM using an ARCAM Q20 machine have been applied for sample manufacturing. A half-automated shot-peening process followed by a chemical and/or electrochemical polishing or Hirtisation® process has been applied in order to obtain lower surface roughness compared to their as-received states. Special emphasize has been taken on their tensile, fatigue, and fracture toughness properties. In addition, their stress corrosion cracking (SCC) behaviour including microstructural analysis using HR-SEM have been investigated.

The COVID-19 pandemic has underscored the importance of swift responses and the necessity of dependable technologies for vaccine development. Our team previously developed a fast cloning system for the modified vaccinia virus Ankara (MVA) vaccine platform. In this study, we report the construction and preclinical testing of a recombinant MVA vaccine obtained using this system. We obtained recombinant MVA expressing the unmodified full-length SARS-CoV-2 spike (S) protein containing the D614G amino acid substitution (MVA-Sdg) and a version expressing a modified S protein containing amino acid substitutions designed to stabilize the protein a in a pre-fusion conformation (MVA-Spf). S protein expressed by MVA-Sdg was found to be expressed and correctly processed and transported to the cell surface, where it efficiently produced cell-cell fusion. Version Spf, however, was not proteolytically processed and despite being transported to the plasma membrane, it failed to induce cell-cell fusion. We assessed both vaccine candidates in prime-boost regimens in the susceptible transgenic K18-human angiotensin converting enzyme 2 (K18-hACE2) mice and in golden Syrian hamsters. Robust immunity and protection from disease was induced with either vaccine in both animal models. Remarkably, the MVA-Spf vaccine candidate produced higher levels of antibodies, a stronger T cell response, and a higher degree of protection from challenge. In addition, the levels of SARS-CoV-2 in the brain of MVA-Spf inoculated mice was decreased to undetectable levels. Those results add to our current experience and range of vaccine vectors and technologies for developing a safe and effective COVID-19 vaccine

Abstract: Endoglin (ENG) is a causative gene of type 1 hereditary hemorrhagic telangiectasia (HHT1). HHT1 patients have arteriovenous malformations (AVMs) in multiple organs, including the brain. In mice, Eng deletion induced by R26RCreER or SM22aCre leads to AVM development in the brain and other organs. We have reported that the severity of brain AVM in mice with activin receptor-like kinase 1 (Alk1, an HHT2 causative gene) mutation is correlated with the number of Alk1 negative endothelial cells (ECs). We hypothesized that increase of Eng negative ECs will enhance AVM severity. To increase EC Eng deletion, we used a codon improved cre (icre), which is more potent in recombination of floxed alleles than the wild type (WT) cre. R26RCreER;Eng^f/f mice that have Rosa promoter driving and tamoxifen (TM) inducible WT cre expression globally and PdgfbiCreER;Eng^f/f that have Pdgfb promoter driving and TM inducible icre expression in ECs were treated with 3 intra-peritoneal injections of TM (2.5 mg/25g of body weight) to delete Eng globally or in the ECs. AAV-VEGF was stereotactically injected into the brain to induce brain focal angiogenesis and brain AVM. We found that iCre caused more Eng deletion in the brain indicated by lower level of Eng proteins (p<0.001) and fewer Eng positive ECs (p=0.01) than mice with WT cre. Mice with iCre mediated Eng deletion have more abnormal vessels (p=0.02), CD68⁺ macrophages (p=0.002), and hemorrhage (p=0.04), and less vascular pericyte and smooth muscle coverage than mice with WT cre. In addition, arteriovenous shunts were detected in the intestines of icre mice, a phenotype that have not been detected in WT cre mice before. RNAseq analysis showed that 8 out of the 10 top upregulated pathways identified by Gene Ontology (GO) analysis are related to the inflammation. Therefore, increase of Eng deletion in ECs exacerbates AVM severity, which is associated with enhanced inflammation. Strategies that can reduce Eng negative ECs could be used to develop new therapies to reduce AVM severity for HHT1 patients.

The abilities of quantitative description of noise are restricted due to its origin and only the statistical and spectral analysis methods can be applied while an exact time evolution cannot be defined or predicted. It emphasizes the challenges faced in many applications including communication systems where noise can play, on one hand, a vital role impacting signal-to-noise ratio but possessing, on the other hand, unique properties such as infinite entropy (infinite information capacity), exponentially decaying correlation function and so on. Despite the deterministic nature of chaotic systems, the predictability of chaotic signals is limited for a short time window putting them close to random noise. In this article, we propose and experimentally verify an approach to achieve Gaussian-distributed chaotic signals by processing the outputs of chaotic systems. The mathematical criteria, on which the main idea of the study is based on, is the Central Limit Theorem which states that the sum of a large number of independent random variables with similar variances approaches a Gaussian distribution. The study involves more than 40 mostly three-dimensional continuous-time chaotic systems (Chua’s, Lorenz’s, Sprott’s, memristor-based, etc.) whose output signals are analyzed according to criteria that encompass the probability density functions of a chaotic signal itself and its envelope and phase, statistical and entropy-based metrics such as skewness, kurtosis, and entropy power. We found that two chaotic signals of Chua’s and Lorenz’s systems exhibited superior performance across the chosen metrics. Furthermore, our focus extended to determining the minimum number of independent chaotic signals necessary to yield a Gaussian-distributed combined signal. The analytic and experimental results indicate that the sum of at least three non-Gaussian chaotic signals closely approximates Gaussian distribution. It allows generation of reproducible Gaussian-distributed deterministic chaos by modeling simple chaotic systems.

Rock materials failures are accompanied by the co-existence of various failure mechanisms, in-cluding rock fracturing, shearing, and compaction yield. These mechanisms manifest macro-scopically as multiple failure modes and nonlinear strength characteristics related to stress levels. Considering the limitations of current rock mechanics strength theories, which are primarily derived from single failure mechanisms, this study evaluates the applicability of alternative strength theories. Based on the extensional-strain criterion and the PMC (Paul-Mohr-Coulomb) model, a piecewise linear strength model was proposed that is suitable for analyzing multiple failure mechanisms in rocks and revealing the intrinsic mechanisms of multi-mechanism rock material failure. A multiple failure mechanism strength model in the form of inequalities was proposed, using the generalized shear stress, mean stress, and stress Lode angle as parameters. Strength tests conducted on sandstone and granite rock material samples under different stress conditions revealed distinct piecewise linear strength characteristics for both rock types, vali-dating the rationality and applicability of the multiple failure mechanism model. The findings construct a multi-mechanism failure model for rocks, providing enhanced predictive capabilities and aiding in the prevention of rock structural failures.

Meningitis is a severe disease associated with death in children under five with highest rates of infections under age of one. Vaccines for Neisseria meningitides and Haemophilus influenza are used to prevent the main causative agents of meningitis. Administration of H. influenzae type b (Hib) vaccine is recommended at 2, 4 and 6 months with a booster dose at 18 months. N. meningitidis has two commercially available vaccines, the pure polysaccharide is recommended at 24 months meanwhile the protein-conjugated vaccines at 12 months. We sought in this study to examine if coadministering the vaccines for the two main meningitis causing bacteria might be synergistic as a preliminary step towards the possibility of shuffling immunization schedule. So, we coadministered Hib vaccine with commercially available vaccines either quadrate (ACWY) polysaccharide meningococcal (Men) or conjugated meningococcal (Nim) vaccines in Balb/C mice (n = 6/group) and compared to each vaccine administered separately and controls. Thirty-five days post immunization, we measured specific antibodies titers. Hib vaccine increased Men antibody titers significantly for serotypes Y and W. When Hib vaccine was coadministrated with Nim, antibody titer for Y, W and A significantly increased. For serotype C, there was no significant difference in antibody titers among immunized groups. As for effect of meningococcal vaccines on Hib, Men significantly increased Hib antibody titers while Nim had no effect. Collectively, our data suggested that coadministration of Hib and Men or Nim vaccines was safe and had synergistic effect on immune responses elicited to both vaccines. Further studies are needed before immunization schedule modifications. Such immunization schedule recommendation should provide better protection against this life-threatening disease in young children.

One of the primary causes of the mechanical seal failure is rotor vibration. Traditional dynamic seal models often would not be able to fully explaining the failure mechanisms. The seal dynamic models proposed in this paper, including those developed by the authors, prove valuable in predicting seal dynamics during operation in specific turbomachinery and in explaining the causes of seal failure. The single-mass dynamic model is suitable for analyzing contact mechanical seal and simple design dry gas seals dynamics. The two-mass dynamic model is used for investigating operational dynamics processes in classical dry gas seals under complex loading conditions. The three-mass dynamic model is used to study various complex mechanical seal types. This model is able to determine the normal operating condition range and to explain leakage mechanisms in the presence of excessive rotor vibrations.

Profiling technologies, such as proteomics, allow the simultaneous measurement and comparison of thousands of plant components without prior knowledge of their identity. The combination of these non-targeted methods facilitates a more comprehensive approach than targeted methods and thus provides additional opportunities to identify genotypic changes resulting from genetic modification, including new allergens or toxins. The purpose of this study was to investigate unintended changes in GM Bt maize grown in South Africa. In the present study, we used bi-dimensional gel electrophoresis based on fluorescence staining, coupled with mass spectrometry in order to compare the proteome of the field-grown transgenic hybrid (MON810) and its near-isogenic counterpart. Proteomic data showed that energy metabolism and redox homeostasis were unequally modulated in GM Bt and non-GM maize variety samples. In addition, a potential allergenic protein – pathogenesis related protein -1 has been identified in our sample set. These finding highlight the suitability of unbiased profiling approaches to complement current GMO risk assessment practices worldwide.

Type 2 diabetes mellitus (T2DM) is a global health concern driven by factors such as obesity, sedentary behavior, and poor diet. This study uses data from the 2017-18 Bangladesh Demographic and Health Survey (BDHS) to analyze regional and individual predictors of diabetes and predi-abetes. Employing a Bayesian multinomial mixed-effects model, we account for regional varia-bility and individual factors like age, gender, BMI, residence, wealth, education, employment, and hypertension. Our results indicate significant regional differences and associations between de-mographic and health-related factors with diabetes risk. Younger individuals and those with higher BMI are more likely to be diabetic, while hypertension significantly increases diabetes risk. We applied machine learning (ML) models, including logistic regression, decision trees, k-nearest neighbor, linear discriminant analysis, and random forest, to classify diabetic status using these predictors, assessing their accuracy through 10-fold cross-validation. Logistic regression and linear discriminant analysis demonstrated robust performance across various response distributions. Simulation studies further examined the impact of different response distributions on model performance, revealing significant differences in classification accuracies. This approach of esti-mating parameters with a Bayesian model, applying ML for prediction, and conducting simulation studies to explore various scenarios highlights the importance of integrating these methodologies for effective diabetes prediction, providing insights for public health strategies to mitigate T2DM's impact.

Equine herpesvirus type 1 (EHV-1) causes rhinopneumonitis, abortion and neurological outbreaks (equine herpesvirus myeloencephalopathy, EHM) in horses. EHV-1 also causes lethal encephalitis in laboratory small animals such as mice and hamsters experimentally. EHV-1 ORF76 is a homologue of HSV-1 US9, which is a herpesvirus kinase. Starting with an EHV-1 bacterial artificial chromosome clone of neuropathogenic strain Ab4p (pAb4p BAC), we constructed an ORF76 deletion mutant (Ab4p∆ORF76) by replacing ORF76 with the rpsLneo gene. Deletion of ORF76 had no influence on replication, cell-to-cell spread in cultured cells or replication in primary neuronal cells. In western blots of EHV-1-infected cell lysates, an EHV-1 Us9-specific polyclonal antibody detected multiple bands ranging from 35 to 42-kDa. In a CBA/N1 mouse infection model following intranasal inoculation, the parent and Ab4p∆ORF76 revertant caused the same histopathology in the brain and olfactory bulbs. The parent, Ab4p∆ORF76 and revertant mutant replicated similarly in the olfactory mucosa, although Ab4p∆ORF76 was not transported to the olfactory bulbs and was unable to infect the CNS. These results indicated that the ORF76 (US9) plays an essential role in the anterograde spread EHV-1.

The last two decades have witnessed a surge in investigations proposing stem cells as a promising strategy to treat stroke. Since growth factor release is considered as one of the most important aspects of cell-based therapy, stem cells over-expressing growth factors are hypothesized to yield higher levels of therapeutic efficiency. In pre-clinical studies of the last 15 years that were investigating the efficiency of stem cell therapy for stroke, a variety of stem cell types were genetically modified to over-express various factors. In this review we summarize the current knowledge on the therapeutic efficiency of stem cell-derived growth factors, encompassing techniques employed and time points to evaluate. In addition, we discuss several types of stem cells, including the recently developed model of epidermal neural crest stem cells, and genetically modified stem cells over-expressing specific factors, which could elevate the restorative potential of naive stem cells. The restorative potential is based on enhanced survival/differentiation potential of transplanted cells, apoptosis inhibition, infarct volume reduction, neovascularization or functional improvement. Since the majority of studies have focused on the short-term curative effects of genetically engineered stem cells, we emphasize the need to address their long-term impact.

This paper investigates five different GARCH models (GARCH, EGARCH, IGARCH, Component GARCH (CGARCH) and GJR-GARCH) along with six distributions (Normal, Student’s t, GED and their skewed forms), which are used to forecast the volatility for the Bulgarian Stock index SOFIX. We use a GARCH model to predict how much time it will take, after the latest crisis, for the SOFIX index to reach its historical peak once again. The empirical data covers the period between the years 2000 and 2024, including the 2008 financial crisis and the COVID-19 pandemic. The purpose is to answer which of the five models is the best at forecasting the volatility of SOFIX and which distribution is most appropriate. The results, based on BIC and AIC information criteria, show that the ARMA(1,1)-CGARCH(1,1) specification with the Student t-distribution is preferred for forecasting. With the help of 5000 simulations, it is estimated that the chances of Index SOFIX reaching its historical peak value of 1976.73 (08.10.2007) are higher than 90% at 13.08.2087.

The advancements achieved in Tissue Engineering are based on a careful and in-depth study of cell-tissue interaction. The choice of a certain biomaterial in Tissue Engineering is fundamental as it represents an interface for adherent cells in the creation of a microenvironment suitable for cell growth and differentiation. The knowledge of the biochemical and biophysical properties of the extracellular matrix is a useful tool for the optimization of polymeric scaffolds. The aim of this re-view is to analyse the chemical, physical and biological parameters on which it is possible to act in Tissue Engineering for the optimization of polymeric scaffolds. Understanding the scaffold impact on cell fate is of paramount importance for the successful advancement of Tissue Engineering.

Gastrointestinal tumors including pancreatic and colorectal cancers represent one of the greatest public health issues worldwide, leading to million global deaths. Recent research demonstrated that the human heavy chain ferritin (HFt) can encapsulate different type of drugs in its cavity and can bind to its receptor, CD71, in several solid and hematological tumors, thus highlighting the potential use of ferritin for tumor-targeting therapies. Here, we describe the development and characterization of a novel nanomedicine based on the HFt that is named The-0504. In particular, this novel system is a nano-assembly comprising an engineered version of HFt that entraps about 80 molecules of a potent, wide-spectrum, non-camptothecin topoisomerase I inhibitor (Genz-644282). The-0504 can be produced by a standardized pre-industrial process as a pure and homogeneously formulated product with favourable lyophilization properties. The preliminary anticancer activity was evaluated in cultured cancer cells and in a mouse model of pancreatic cancer. Overall results reported here make The-0504 a candidate for further preclinical development against CD-71 expressing deadly tumors

The conformity assessment of products or a measured value with the given standards is carried out based on the global risk of producers and consumers calculation. A product may conform to specifications but be falsely rejected as non-conforming. This is about the producer's risk. If a product doesn't meet the requirements but is falsely accepted as conforming, that poses a risk to the consumer. The conventional approach to risk assessment, which yields only a single numerical value for the global risk of producers and consumers, is naturally extended, and utilized for assessing risk in measurement models with linear regression. The outcomes of the two-dimensional extension, along a moderate scale, are the parabolas with an opening upwards. Risk surfaces were obtained through three-dimensional extension over the area limited by the moderate scale and guard band axes. Four models with different ranges of tolerance intervals were used to test this innovative method of risk assessment in linear regression. The corresponding standard measurement uncertainties are determined by applying a simplified measurement model with the use of comprehensive data on the measurement performance and by determining measurement uncertainty derived from consideration of the functional relationship obtained by linear regression analysis. Models that utilize information from linear regression analysis to determine measurement uncertainty are biased towards risks at the edges of the moderate scale. Testing the model's performances with metrics related to the confusion matrix, such as the F1 score, further substantiated this assertion. The diagnostic odds ratio has been proven to be extremely effective in identifying the curve along the guard band axis, along which the global risks of producers and consumers are at their lowest.

Facing global warming consequences is a major issue of present times. For what concerns climate, projections say that heavy rainfalls are going to increase with high probability together with temperature rise, thus also the hazard related to rainfall induced shallow landslides will likely increase in density over susceptible territories. Different modeling approaches exist and any of them is forced to make simplifications in order to reproduce landslide occurrences over space and time. Process based models can help in quantifying the consequences of heavy rainfall on the different involved processes. In this paper, a narrative review about physically-based deterministic distributed models (PBDDMs) is presented. Models were selected based on: the adoption of the infinite slope scheme (ISS), the use of a deterministic approach (i.e., input and output are treated as absolute values), the inclusion of new approaches in modeling slope stability through the ISS. Models are presented in chronological order with the aim of drawing a timeline of the evolution of PBDDMs and to give researchers and practitioners a basic knowledge on how much has been already done. Results indicate that including vegetation effects on slope stability has raised in importance over time but that there is still the need of finding an efficient way to include them, and that in the last years the literature production seems to be more focused on probabilistic approaches.

As Artificial Intelligence (AI) technology, particularly Machine Learning algorithms, becomes increasingly ubiquitous, our abilities to understand and interpret AI and machine learning algorithms are becoming increasingly desirable. Visualization has been used as a common tool to view and understand complex machine learning processes. In this paper, we will focus on developing a general framework for the visualization of machine learning models as a scalar valued multi-dimensional function to help users understand how the models behave over different viewing spaces. We first give a formal definition of the visualization problem. Interpolation-based morphing and subspace sampling techniques are applied to generate various renderings through projections and cross-sections of the model space as 3D surfaces or heatmap images. This method will be applied to two real-world datasets and applications: the diagnosis of Alzheimer's Disease (AD) using a human brain networks dataset and a real-world benchmark dataset for predicting home credit default risks. The visualizations show that different machine learning algorithms can behave quite differently under different conditions.

Spherical or hexagonal NaYF4:Yb,Er nanoparticles (UCNPs) with sizes of 25 nm (S-UCNPs) and 120 nm (L-UCNPs) were synthesized by high-temperature coprecipitation and subsequently modified with three kinds of polymers. These included poly(ethylene glycol) (PEG) and poly(N,N-dimethylacrylamide-co-2-aminoethylacrylamide) [P(DMA-AEA)] terminated with an alendronate anchoring group, and poly(methyl vinyl ether-co-maleic acid) (PMVEMA). The internalization of nanoparticles by rat mesenchymal stem cells (rMSCs) and C6 cancer cells was visualized by electron microscopy and the cytotoxicity of the UCNPs and their leaches was measured by the real time proliferation assay. Comet assay was used to determine oxidative damage of UCNPs. In vivo study on mice determined the elimination route and potential accumulation of UCNPs in the body. The results showed that the L- and S-UCNPs were internalized into cells in the lumen of endosomes. Proliferation assay revealed that L-UCNPs were less toxic than S-UCNPs. The viability of rat mesenchymal stem cells (rMSCs) incubated with particles decreased in the order S-UCNP@Ale-(PDMA-AEA) > S-UCNP@Ale-PEG > S-UCNPs > S-UCNP@PMVEMA. Similar results were obtained in C6 cells. Oxidative damage measured by the Comet assay showed that neat L-UCNPs caused oxidative damage to rMSCs more than all coated UCNPs while no difference was observed in C6 cells. An in vivo study indicated that L-UCNPs were eliminated from the body via the hepatobiliary route; L-UCNP@Ale-PEG particles were almost eliminated from the liver 96 h after intravenous application. Pilot fluorescence imaging confirmed the limited in vivo detection capabilities of the nanoparticles.

With the development of organizational biology and forced from the EU Cosmetic Regulation (EU/1223/2009) with the complete ban of animal testing for cosmetic purposes, 3D skin models have been widely developed due to their similar physiological structure and metabolic function to native human tissue. 3D skin models for in vitro cosmetic evaluation are still promising alternative methods for evaluating phototoxicity, corrosivity and irritation. These models have been used for early screening and later validation of toxicity and efficacy evaluation by many well-known cosmetic companies. 3D skin models have become an important tool in cosmetic evaluation research. This article reviews the development of 3D skin models and their application in cosmetic evaluation. An outlook on the current application and future technological development directions in the cosmetic field is also presented.

This paper introduces a novel framework for zero-shot learning (ZSL), i.e., to recognize new categories that are unseen during training, by distilling knowledge from foundation models. Specifically, we first employ ChatGPT and DALL-E to synthesize reference images of unseen categories from text prompts. Then, the test image is aligned with text and reference images using CLIP and DINO. Finally, the predicted logits are aggregated according to their confidence to produce the final prediction.Experiments are conducted on multiple datasets, including CIFAR-10, CIFAR-100, and TinyImageNet. The results demonstrate that our model can significantly improve classification accuracy compared to previous approaches, achieving AUROC scores above 96\% across all test datasets. Our code is available at https://github.com/1134112149/MICW-ZIC.

This study addresses a gap in the literature by conducting a comparative analysis of statistical and artificial intelligence techniques for predicting bankruptcy in small and medium-sized enterprises (SMEs). Using a comprehensive database of 7,104 Belgian SMEs, our findings demonstrate that intelligent techniques offer superior predictive accuracy for bankruptcy. Notably, our results indicate that a firm's position in the global value chain significantly affects prediction accuracy, with lower performance for firms operating upstream in the production process. This suggests that bankruptcy risk may spread upward along the value chain. This insight is particularly valuable for practitioners, as it highlights the importance of focusing on specific performance factors based on the type of firms they manage, advise, or collaborate with.

High production cost is one of the major factors that limit the market growth of polyhydroxyalkanoates (PHAs) as a biopolymer. Improving PHA synthesis performance and utilizing low grade feedstock are two logical strategies for reducing the cost. As an oleaginous yeast, Y. lipolytica has a high carbon flux through acetyl-CoA (main PHB precursor) which makes it a desired cell factory for PHB biosynthesis. Two different metabolic pathways introduced into Y. lipolytica PO1f in this study for enhancing PHB biosynthesis, along with glucose and acetate as co-substrates. Results showed that NBC pathway led to more than 11% PHB accumulation, while there was non-detectable PHB accumulations using ABC pathway. Further modifications were done using peroxisomal compartmentalization and gene-dose overexpression. Final strain showed up to 41% PHB of CDW with a growth rate of 0.227 h-1. Low growth rate was observed using acetate or glucose as sole carbon and energy source. The co-substrate strategy showed compensatory effect on overcoming inhibitory and toxic effects of both substrates at high concentrations. Cultivating the engineered strain in optimal co-substrate condition predicted by RSM led to 83.4 g/L biomass concentration and 31.7 g/L PHB.

Limonene is a valuable monoterpenoid that with diverse applications. Microbial biosynthesis offers a sustainable alternative to plant-based extraction, which is prone to hinderance by climate change and acreage. In the present study, the effects on limonene production of carbon source, inoculum, working volume, temperature, pH, dodecane coverage, and media were investigated with engineered strains of Rhodosporidium toruloides. Through single-factor and orthogonal experiments, the limonene titer was improved from 52.2 to 358.1 mg/L on 250-mL flask, a 586% increase. The optimized medium was MM, with a working volume of 50 mL, inoculum OD600=0.6, 22 °C, pH 6, and dodecane coverage (v/v) of 20%. The results here demonstrated that the R. toruloides could be explored as an efficient limonene producer and facilitate other monoterpenoids biosynthesis with R. toruloides.

Findings of new targeted treatments with adequate safety evaluations is essential for better cancer cures and mortality rates. Immunotherapy holds promise for patients with relapsed disease, with the ability to elicit long-term remissions. Emerging promising clinical results in B-cell malignancy using gene-altered T-lymphocytes uttering chimeric antigen receptors have sparked a lot of interest. This treatment could open the path for a major difference in the way we treat tumors that are resistant or recurring. Genetically altered T cells used to produce tumor-specific chimeric antigen receptors are resurrected field of adoptive cell therapy by demonstrating remarkable success in the treatment of malignant tumors. Because of the molecular complexity of chimeric antigen receptors -T cells, a variety of engineering approaches to improve safety and effectiveness are necessary to realize larger therapeutic uses. In this study, we investigate at new strategies for enhancing chimeric antigen receptors-T cell therapy by altering chimeric antigen receptors proteins, T lymphocytes, and their relations with other solid tumor microenvironment (TME) aspects.

The ever-growing field of materials with applications in the biomedical field holds great promise regarding the design and fabrication of devices with specific characteristics especially scaffolds with personalized geometry and architecture. The continuous technological development pushes the limits of innovation in obtaining adequate scaffolds and establishing their characteristics and performance. To this end, computed tomography (CT) proved to be a reliable, non-destructive, high-performance machine, enabling visualization and structure analysis at sub-micronic resolutions. CT allows both qualitative and quantitative data of the 3D model, offering an overall image of its specific architectural features as well as reliable numerical data for rigorous analyses. The precise engineering of scaffolds consists in the fabrication of objects with well-defined morphometric parameters (e.g.: shape, porosity, wall thickness), and in their performance validation through thorough control over their behavior (in situ visualization, degradation, new tissue formation, wear, etc.). This review is focused on the use of CT in biomaterial science with the aim of qualitatively and quantitatively assess the scaffolds’ features and in monitoring their behavior following in vivo or in vitro experiments. Furthermore, the paper presents the benefits and limitations regarding the employment of this technique when engineering materials with applications in the biomedical field.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.

Antigen-presenting cells (APCs) are essential for modulating immune responses, and optimizing their differentiation protocols is critical for cell-based immunotherapies. This study compares eight different protocols for differentiating APCs from C57BL/6J mice using GM-CSF and L-929 supernatant. Four groups treated with GM-CSF and four with L-929 supernatant at various concentrations, alongside a control group were evaluated. Flow cytometry was used to analyze the expression of key markers, including MHC II, CD11c, F4/80, and CD11b. Our findings show that GM-CSF resulted in superior differentiation outcomes compared to L-929 supernatant, with higher expression levels of the analyzed markers. This study underscores the importance of considering both cell yield and protein expression quality in selecting differentiation protocols. For researchers developing therapies targeting specific cell populations, these findings demonstrate how different culture conditions influences both the quantity and phenotypic characteristics of differentiated cells. Balancing efficiency and phenotypic fidelity is crucial for optimizing cell-based immunotherapy strategies. Our data provide a valuable reference for future studies and applications involving APC differentiation from bone marrow precursors, ensuring robust foundations for developing advanced immunotherapies. This comprehensive comparison of differentiation protocols offers insights essential for enhancing the effectiveness and cost-efficiency of cell-based therapies.

Herein, the mechanical properties and carbonation durability of engineered cementitious composites (ECC) were studied. For cost-efficient utilization of ECC materials, polypropylene (PP) and hydrophilic polyvinyl alcohol (PVA) fibers were employed to cast different types of specimens. The compressive strength, Poisson’s ratio, strength-deflection curves, cracking/post-cracking strength, impact index, and tensile strain-stress curves of the two types of ECC materials, with different fiber contents of 0 vol%, 1 vol%, 1.5 vol% and 2 vol%, were investigated by conducting compressive tests, four-point bending tests, drop weight tests, and uniaxial tensile tests. In addition, the matrix microstructure and failure morphology of the fiber in the ECC materials were studied by scanning electron microscopy (SEM) analysis. Furthermore, carbonation test and steel corrosion after carbonization were employed to study durability resistance. The results indicated that for both PP fiber- and hydrophilic PVA fiber-reinforced ECCs, the compressive strength first increases and then decreases as fiber content increases from 0 vol% to 2 vol% and reaches the maximum at 1 vol% fiber content. The bending strength, deformation capacity, and impact resistance show significant improvement with increasing fiber contents. The ECC material reinforced with 2 vol% PP fiber shows superior carbonized durability with maximum carbonation depth of only 0.8 mm.

Artificial neural networks are highly efficient tools for numerous kinds of tasks, which include forecasting, regression, and recognizing patterns in classification and pattern recognition. An artificial neural network is a model for processing information using essential components called artificial neurons that are inspired by the human brain. Two significant aspects of delayed neural networks dynamic activity are their stability and the synchronization phenomenon. This work presents a bidirectional associative memory (BAM) incommensurate fractional-order delay neural network model. The incommensurate fractional orders are calculated within the stability region through the corresponding eigenvalues and their points of equilibrium. The involved neuron states are synchronized with each other for the calculated incommensurate stable fractional orders. The reduction of the time delay will give more relaxation time for the state variable $w_4(t)$ to be stable as compared to the state variable $w_3(t)$ due to the induction of extra activation functions. The theoretical findings of this research have significance for providing guidance and controlling the dynamic behavior of artificial neural networks.

The assortment of low-cost 3D printers for “in-practice” use, e.g., for clear aligner therapies, is ever increasing. To address concerns about the accuracy of orthodontic models produced on such printers when cost efficient modes of 3D printing are employed, this study examined the effect of print model body type and print angulation on accuracy. Six printing-configuration groups were included: 2 model types (solid or hollow shell) combined with 3 print angles (0°, 70°, or 90°) with 10 models/group; all models were printed with 100-µm layer thickness using a digital light processing-based 3-dimensional printer. Eleven selected structures and distances were measured on the printed models with a digital microscope and compared to the same measures on a digitized master model. The clinically-acceptability range was set at ±0.25 mm difference from the master model for single tooth measurements (intra-tooth) and ±0.5 mm for cross-arch measurements (inter-tooth). For individual measurements across all models, 98% fell within clinical acceptability. For mean measurements within each model group, only canine height for the shell-0° model had a mean difference (0.26 mm ± 0.03) outside the clinically acceptable range for intra-tooth measurements. Standard deviations for all intra-tooth measurements were within 0.07 mm. While none of the mean inter-tooth measurements exceeded the acceptability range, the standard deviations were larger (0.04 to 0.30 mm). Accuracy of orthodontic models for clear aligner therapies was not impacted beyond the clinically acceptable range when altering model body type and print angulation to improve efficiency of 3D printing. These findings suggest greater flexibility of the practitioner to alter print settings to address time and cost efficiency in various clinical scenarios and still maintain clinically acceptable model accuracy.

Two monoclonal antibodies (mAbs) against human epidermal growth factor receptor 2 (HER2), trastuzumab and pertuzumab, were clinically approved. We previously developed a highly sensitive and specific anti-HER2 mAb, H2Mab-139 (mouse IgG1, kappa). In this study, we produced a defucosylated IgG2a version of anti‑HER2 mAb (H2Mab-139-mG2a-f) to enhance ADCC-mediated antitumor activity. H2Mab-139-mG2a-f exhibits a high binding affinity in flow cytometry with the dissociation constant (KD) determined to be 3.9 × 10‑9 M and 7.7 × 10‑9 M against HER2‑overexpressed Chinese hamster ovary (CHO)-K1 (CHO/HER2) and HER2-positive BT-474 cells, respectively. Moreover, we showed that H2Mab-139-mG2a-f exerted ADCC and complement-dependent cytotoxicity against CHO/HER2 and BT-474 cells in vitro and exhibited potent antitumor activities in the xenograft models. These results indicated that H2Mab-139-mG2a-f exerts antitumor effects against HER2-positive human breast cancers and could be useful for an antibody treatment regimen for HER2-positive human cancers.

The rapid advancement of large language models (LLMs), such as ChatGPT, has revolutionized natural language processing, enabling these models to generate coherent and contextually relevant text. These capabilities hold significant potential for various applications, particularly in the medical field. LLMs can assist healthcare professionals by providing accurate information, supporting diagnostic processes, and enhancing medical education. However, the implementation of LLMs in clinical settings faces several barriers, including technical limitations, ethical concerns, regulatory constraints, and practical challenges. Ensuring accuracy, reliability, and interpretability is crucial, along with addressing biases, ensuring data privacy, and establishing ethical guidelines. Future research should focus on improving training techniques, developing explainable AI methods, and creating efficient, resource-saving models. Expanding applications through domain-specific models and multi-modal integration can further unlock the potential of LLMs. By addressing these challenges and prioritizing responsible development, LLM technology can be safely and effectively integrated into various domains, driving innovation and improving outcomes. This paper explores the current state of LLM technology, its medical applications, barriers to implementation, and directions for future research and development

Accurate traffic simulation models play a crucial role in developing intelligent transport systems that offer timely traffic information to users and efficient traffic management. However, calibrating these models to represent real-world traffic conditions accurately poses a significant challenge due to the dynamic nature of traffic flow and the limitations of traditional calibration methods. This article introduces a machine learning-based approach to calibrate macroscopic traffic simulation models using real-time traffic video stream data. By leveraging computer vision technologies to extract key traffic parameters from video streams, the approach demonstrated a notable improvement in aligning the generated data from the calibrated simulation model with car sensor data, achieving an average improvement of over 50% compared to the uncalibrated macroscopic model. Moreover, there was a substantial reduction in data drift for the machine learning model integrated into the virtual transport space using vehicle-to-everything technology, resulting in a more than fourfold decrease in the average absolute error of the model.

Pain diagnosis remains a challenging task due to its subjective nature, the variability in pain expression among individuals, and the difficult assessment of the underlying biopsychosocial factors. In this complex scenario, artificial intelligence (AI) can offer the potential to enhance diagnostic accuracy, predict treatment outcomes, and personalize pain management strategies. This review aims at dissecting the current literature on computer-aided diagnosis methods. It also discusses how AI-driven diagnostic methods can be integrated into multimodal models that combine various data sources, such as facial expression analysis, neuroimaging, and physiological signals, with advanced AI techniques. Despite the significant advancements in AI technology, its widespread adoption in clinical settings faces crucial challenges. Ethical considerations related to patient privacy, biases, and lack of reliability and generalizability are the main issues. Furthermore, there is a need for high-quality real-word validation as well as the development of standardized protocols and policy rules to guide the implementation of these technologies in diverse clinical settings.

Dynamical manipulation of plasmon-induced transparency (PIT) in graphene metasurfaces is promising for optoelectronic devices such as optical switching and modulating, however, previous design approaches are limited within one or two bright/dark modes, and the realization of dual PIT windows through triple bright modes in graphene metasurfaces is rare and urgently needed. Here we demonstrate that dual PIT can be realized through a symmetry-engineered graphene metasurface, which consists the graphene central cross (GCC) and graphene rectangular ring (GRR) arrays. The GCC supports a bright mode from electric dipole (ED), the GRR supports two nondegenerate bright modes from ED and electric quadrupole (EQ) due to the C2v symmetry breaking, and the resonant coupling of these three bright modes induces the dual PIT windows. A triple coupled-oscillator model (TCM) is proposed to evaluate the transmission performances of the dual PIT phenomenon, and the results are in good agreement with the finite-difference time-domain (FDTD) method. In addition, the dual PIT windows are robust to the variation of the structural parameters of the graphene metasurface except the y-directioned length of the GRR. By changing the carrier mobility of graphene, the amplitudes of the two PIT windows can be effectively tuned. The alteration of the Fermi level of graphene enables the dynamic modulation of the dual PIT with good performances for both modulation degree (MD) and insertion loss (IL).

We introduce a novel method for fabricating perovskite solar modules using selective spin-coating on various Au/ITO patterned substrates. These patterns were engineered for twofold purposes: (1) to enhance selectivity of monolayers primarily self-assembling on the Au electrode, and (2) to enable seamless interconnection between cells through direct contact of the top electrode and the hydrophobic Au connection electrode. Utilizing SAMs-treated Au/ITO, we achieved sequential selective deposition of the electron transport layer (ETL) and the perovskite layer on the hydrophilic amino-terminated ITO, while the hole transport layer (HTL) was deposited on the hydrophobic CH3-terminated Au connection electrodes. Importantly, our approach had negligible impact on the series resistance of the solar cells, as evidenced by the measured specific contact resistivity of the multilayers. A significant outcome was the production of a 6-cell series-connected solar module with a notable average PCE of 8.32%, providing a viable alternative to the conventional laser scribing technique.

Mesoscale imperfections, such as pores and voids, can strongly modify the properties and the mechanical response of materials under extreme conditions. Tracking the material response and microstructure evolution during void collapse is crucial for understanding its performance. In particular, imperfections in ablator materials, such as voids, can limit the efficiency of the fusion reaction and ultimately hinder ignition. To characterize how voids influence the response of materials during dynamic loading and seed hydrodynamic instabilities, we have developed a tailored fabrication procedure for designer targets with voids at specific locations. Our procedure uses SU-8 as a proxy for ablators materials and hollow silica microspheres as proxy for voids and pores. By using photolithography to design the targets’ geometry, we demonstrate precise and highly reproducible placement of a single void within the sample, which is key for a detailed understanding of its behavior under shock compression. This fabrication technique will benefit high-repetition rate experiments at x-ray and laser facilities. Insight from shock compression experiments will provide benchmarks for the next generation of microphysics modelling.

Microalgae are recognized as a third generation feedstock for biofuel production due to its rapid growth rate and lignin-free characteristic. In this study, the lipid extracted microalgae biomass residues was used as the material to produce isoprene, α-pinene and β-pinene with the engineered E. coli strain. We adopted an optimal sulfuric acid hydrolysis method to convert holocellulose into fermentable sugar efficiently (6.37 g/L) and explored a novel detoxification strategy (phosphoric acid/calcium hydroxide) to remove inhibitors notably. 55.32 % acetic acid, 99.19 % furfural and 98.22 % 5-HMF were cut down with the phosphoric acid/calcium hydroxide method, and the fermentation concentration of isoprene (223.23 mg/L), α-pinene (382.21 μg/L) and β-pinene (17.4 mg/L) using the detoxified hydrolysate as the carbon source account for approximately 86.02 %, 90.16 % and 88.32 % of those produced by the engineered E. coli strain fermented on pure glucose, respectively.

Drug-induced liver injury (DILI) stands as a significant cause of drug attrition. To mitigate clinical DILI risks, assessing drugs using human liver models is crucial since animal studies may fall short due to species-specific liver pathway variations. Cell-based preclinical hepatotoxicity testing is often pertinent. In the present study, cells from a human liver cancer line (HepG2, HepaRG) were cultured in both formats of 2D and 3D spheroids to explore their responses to drugs. Liver-specific marker expressions across cell lines and culture formats were also examined to assess disparities in drug-induced liver injury marker expressions. In cytotoxicity assays, HepG2 cells exhibited heightened sensitivity to amiodarone HCl, while HepaRG cells showed greater sensitivity to acetaminophen. Generally, 2D cultures were more responsive to drugs than 3D cultures. Consistency was observed between cytotoxicity assays and liver injury markers AST and ALT. Variations were also noted in liver cell marker secretion, with albumin and urea concentrations declining post-drug treatment, particularly with higher baseline expression in HepaRG cells and 3D cultures. Additionally, mRNA expression levels of CYP enzymes involved in hepatocellular drug metabolism were compared following treatment with enzyme inducers. CYP1A2 and CYP2C9 were not expressed in HepG2 cells. On the other hand, CYP3A4 was expressed higher in 3D culture than in 2D culture. HepaRG cells exhibited significantly increased expression of all three enzymes post-treatment. Notably, enzyme expression was notably higher in 3D cultures than in 2D cultures. Collectively, these findings suggest that HepaRG cells and 3D cultures hold promise for evaluating DILI during early-stage drug development.

Bacterial nitroreductase enzymes that convert prodrugs to cytotoxins are valuable tools for creating transgenic targeted ablation models to study cellular function and cell-specific regeneration paradigms. We recently engineered a nitroreductase (“NTR 2.0”) for substantially enhanced reduction of the prodrug metronidazole, which permits faster cell ablation kinetics, cleaner interrogations of cell function, ablation of previously recalcitrant cell types, and extended ablation paradigms useful for modelling chronic diseases. To provide insight into the enhanced enzymatic mechanism of NTR 2.0, we have solved the X-ray crystal structure at 1.85 Angstroms resolution and compared it to the parental enzyme, NfsB from Vibrio vulnificus. We additionally present a survey of reductive activity with eight alternative nitroaromatic substrates, to provide access to alternative ablation prodrugs, and explore applications such as remediation of dinitrotoluene pollutants. The predicted binding modes of four key substrates were investigated using molecular modelling.