Matrix metalloproteinases have been implicated in muscular dystrophy progression and recent studies described the role of MMP-10 in skeletal muscle pathology of young dystrophic mice. Nevertheless, its implication in dystrophin deficient hearts is still missing. Here, we aimed at investigating MMP-10 implication in severe muscular dystrophic progression and characterize MMP-10 loss in skeletal and cardiac muscles of aged dystrophic mice. We examined the histopathological effect of MMP-10 ablation in aged mdx mice, both in the hind limb muscles and heart tissues. We have found that MMP-10 loss compromises survival rates of aged mdx mice, with skeletal and cardiac muscles developing a chronic inflammatory response. Our findings indicate that MMP-10 is implicated in severe muscular dystrophy progression, identifying a new area of investigation that could lead to future therapies for dystrophic muscles.

Despite advances in understanding of the molecular pathogenesis of glioma, outcomes remain dismal. Developing successful treatments for glioma requires faithful in vivo disease modeling and rigorous preclinical testing. Murine models, including xenograft, syngeneic, and genetically engineered models, are used to study gliomagenesis, identify methods of tumor progression, and test novel treatment strategies. Since the discovery of highly recurrent isocitrate dehydrogenase (IDH) mutations in lower-grade gliomas, there is increasing emphasis on effective modeling of IDH mutant brain tumors. Improvements in preclinical models that capture the phenotypic and molecular heterogeneity of gliomas are critical for the development of effective new therapies. Herein, we explore the current status, advancements, and challenges with contemporary murine glioma models.

Previously, we described a 19-base pair double-stranded RNA with 3'-trinucleotide overhangs, acting as immunostimulatory RNA (isRNA). This molecule demonstrated notable antiproliferative effects on cancer cells, inhibited tumor growth, and elicited immunostimulatory and antiviral responses by inducing cytokine and interferon production. Within this study, we compared the efficiency of lung fibrosis development, initiated in mice by BLM or LPS using different schemes of induction. Then we compared the effect of isRNA used in a preventive or therapeutic regimen on the development of fibrosis in selected BLM- and LPS-induced mouse models and showed that isRNA can be used in pathological conditions accompanied by the development of inflammation and the risk of fibrosis formation, without adverse side effects. Prophylactic regimen of isRNA application is beneficial for prevention of the development of pulmonary fibrosis.

We previously developed a highly sensitive and specific anti-PDPN mAb, LpMab-23 (mouse IgG1, kappa). In this study, we produced a humanized IgG1 version (humLpMab-23) and its defucosylated form (humLpMab-23-f) of an anti‑PDPN mAb to potentiate the ADCC activity. The humLpMab-23 could recognize PDPN‑overexpressed Chinese hamster ovary (CHO)-K1 (CHO/PDPN) and PDPN-positive PC-10 and LN319 cells by flow cytometry. Furthermore, we found that humLpMab-23-f exerted ADCC and complement-dependent cytotoxicity against CHO/PDPN, PC-10 and LN319 cells in vitro and exhibited potent antitumor activities in the xenograft models. These results indicated that humLpMab-23-f could be useful for an antibody treatment regimen for PDPN-positive human cancers.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

Glioblastoma (GBM) is the most aggressive brain cancer. To model GBM in research, orthotopic brain tumor models, including syngeneic models like GL261 and genetically engineered mouse models like TRP, are used. In longitudinal studies, tumor growth and treatment response are typ-ically tracked with in vivo imaging, including bioluminescence imaging (BLI), which is quick, cost-effective, and easily quantifiable. However, BLI requires luciferase-tagged cells, and recent studies indicate that the luciferase gene can elicit an immune response, leading to tumor rejection and experimental variation. We sought to optimize the engraftment of two luciferase-expressing GBM models, GL261 Red-FLuc and TRP-mCherry-FLuc, showing differences in tumor take, with GL261 Red-FLuc cells requiring immunocompromised mice for 100% engraftment. Immuno-histochemistry and MRI revealed distinct tumor characteristics: GL261 Red-FLuc tumors were well-demarcated with densely packed cells, high mitotic activity, and vascularization. In con-trast, TRP-mCherry-FLuc tumors were large, invasive, and necrotic, with perivascular invasion. Quantifying tumor volume using the HALO® AI analysis platform yielded results comparable to manual measurements, providing a standardized and efficient approach for reliable high-throughput analysis of luciferase-expressing tumors. Our study highlights the importance of considering tumor engraftment when using luciferase-expressing GBM models, providing in-sights for preclinical research design.

Adult T-cell leukemia (ATL) is an aggressive hematologic disease caused by human T-cell leukemia virus type 1 (HTLV-1) infection. Various animal models of HTLV-1 infection/ATL have been established to elucidate the pathogenesis of ATL and develop appropriate treatments. For analyses employing murine models, transgenic and immunodeficient mice are used because of the low infectivity of HTLV-1 in mice. HTLV-1 Tax and HBZ transgenic mice spontaneously develop tumors, and roles for both Tax and HBZ in cell transformation and tumor growth have been established. Severely immunodeficient mice were able to engraft ATL cell lines and have been used in preclinical studies of candidate molecules for the treatment of ATL. HTLV-1-infected humanized mice with an established human immune system are a suitable model to characterize cells in the early stages of HTLV-1 infection. This review outlines the characteristics of mouse models of HTLV-1 infection/ATL and describes progress made in elucidating the pathogenesis of ATL and developing related therapies using these mice.

Malaria comprises a spectrum of disease syndromes and the immune system is a major participant in malarial disease. This is particularly true in relation to the immune responses elicited against blood stages of Plasmodium-parasites that are responsible for the pathogenesis of infection. Mouse models of malaria are commonly used to dissect the immune mechanisms underlying disease. While no one mouse model of Plasmodium infection completely recapitulates all the features of malaria in humans, collectively the existing models are invaluable for defining the events that lead to the immunopathogenesis of malaria. Here we review the different mouse models of Plasmodium infection that are available, and highlight some of the main contributions these models have made with regards to identifying immune mechanisms of parasite control and the immunopathogenesis of malaria.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

The age-related loss of muscle mass and strength is referred to as “sarcopenia”. The combined effect of sarcopenia and osteoporosis is a devastating threat to the old adult, accounting for reduced mobility, risk for falls and subsequent fractures. In previous studies, we observed a high degree of inter-individual variability of paraspinal muscle fatty infiltration, one most relevant index of muscle wasting. This aspect solicited us to develop a computerized method to quantitatively characterize muscle fatty infiltration in aging and diseases. Magnetic resonance images of paraspinal muscles from 58 women of different age (age range 23-85 years) and physio-pathological status (healthy young, pre-menopause, post-menopause, and os-teoporosis), were used to set up the method. It is based on fractal analysis of lean muscle area (contractile muscle) to estimate muscle fatty infiltration. In particular, lacunarity was computed by parameter β from our hyperbola model function, used to fit the GBA (gliding box algorithm) curvilinear plot. Succolarity was estimated by parameter µ, for the four main directions, through an algorithm implemented on purpose. Results show that fractal lacunarity, by quantifying muscle fatty infiltration, can discriminate be-tween osteoporosis and healthy aging while succolarity can separate the other three groups showing similar lacunarity. Therefore, fractal features of contractile muscle, by measuring fatty infiltration, can represent good indices of sarcopenia in aging and disease.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

Acute lymphoblastic leukemia (ALL) is the most common cancer among children worldwide, characterized by an overproduction of undifferentiated lymphoblasts in the bone marrow. The treatment of choice for this disease is the enzyme L-asparaginase (ASNase) from bacterial sources. ASNase hydrolyzes circulating L-asparagine in plasma, leading to starvation of leukemic cells. The ASNase formulations of E. coli and E. chrysanthemi present notorious adverse effects, especially the immunogenicity they generate, which undermines both their effectiveness as drugs and patient safety. In this study, we developed a humanized chimeric enzyme from E. coli L-asparaginase, which would reduce the immunological problems associated with current L-asparaginase therapy. For these, the immunogenic epitopes of E. coli L-asparaginase (PDB: 3ECA) were determined and replaced with those of the less immunogenic Homo sapiens asparaginase (PDB:4O0H). The structures were modeled using the Pymol software and the chimeric enzyme was modeled using the SWISS MODEL service. A humanized chimeric enzyme with four subunits similar to the template structure was obtained, and the presence of asparaginase enzymatic activity was predicted by protein-ligand docking.

Ketogenic diet (KD) is getting in the focus as auxiliary cancer therapy, since it provides sufficient energy supply for healthy cells, while impairing energy production in tumor cells underlying the Warburg effect. Thereby, it can assist in inhibiting tumor growth and simultaneously counteract cachexia, which is frequently observed in cancer patients under chemotherapy. In order to provide molecular evidence for the proposed synergistic inhibition of tumor growth, we applied untargeted quantitative metabolome analysis on a breast cancer xenograft mouse model. Healthy mice and such bearing breast cancer xenografts and receiving chemotherapy were compared after treatment with control diet and KD. Metabolomic profiling was performed on plasma samples, applying high-performance liquid chromatography coupled to tandem mass spectrometry. Statistical analysis revealed metabolic fingerprints comprising numerous significantly regulated features in the group of mice bearing breast cancer. This fingerprint disappeared after treatment with KD, resulting in recovery to the metabolic status observed in healthy mice receiving control diet. Moreover, amino acid metabolism as well as fatty acid transport were found to be affected by both, the tumor and the applied KD. Our results provide clear evidence of a significant molecular effect of KD in the context of tumor growth inhibition.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Important tumor biomarkers, therapeutic targets, and mechanisms of tumorigenesis were discovered in animal models. Mouse models of malignant gliomas were represented by transplantable, chemically-induced, and genetically-engineered cells. The aim of the study was to investigate the morphological, molecular, and immunological characteristics of two original glioblastoma (GB) strains, M2 and M6. These are new, chemically-induced, trans-plantable tissue models of malignant diffuse mouse glioma. Tissues from M2 GB and M6 GB were transplanted into immunocompetent C57BL/6 mice. The clinical manifestations of M2 GB and M6 GB growth in mice include motility disorders, cachexia, and priapism. Morphologically, M2 GB and M6 GB are characterized by diffuse proliferation, cellular and nuclear polymorphism, high mitotic activity, and pathological forms of mitosis due to the aggressive nature of these tumors. Flow cytometry showed that CD3+ T lymphocytes (~32%) and F4/80+ macrophages (~28-50%) highly infiltrated both tumors. M2 GB had higher levels of F4/80+ macrophages than M6 GB. Cdkn2a, S100b, Mki67, Pten, Vegfa, Hif1a, Sox2, Abcb1, and Gfap genes were overexpressed in both tumors. Cd133, Tp53, and Pdgfra expression was increased in M2 GB. High expression of Pi3k and Gdnf was observed in M6 GB. Expression of Cd44, Pi3k, Hif1a, Gdnf and Egfr was higher in the M6 GB tissues com-pared to M2 GB, while Cdkn2a, Tp53, Cd133 and Pdgfra were higher in the M2 GB tissue compared to M6 GB. The transplantable M2 GB and M6 GB tissue models have intratumor immune responses, clinical and morphological features similar to human GB, as well as gene expression patterns that are important for further studies on tumorigenesis. These models can be used to develop diagnostic and therapeutic procedures and study carcino-genesis.

Drug discovery has been initially attributed to coincidence or trial and error where the traditional approach was complex, lengthy, and expensive. Conventional drug discovery methods require the costly random screening of synthesized compounds or natural products. Another downside for this approach is the wide dependency on the experimental use of animals for in vi-vo testing. Currently, in silico modeling has become a vital tool for drug discovery and repurposing, and molecular docking is being used to find the best matching between a ligand and a molecule. Practical application of in silico docking will predict the biomolecular interactions between the drug and the target host. Beauvericin (BEA) is an emerging mycotoxin produced by the entomopathogenic fungus Beauveria bassiana. Originally investigated for its pesticide capability, BEA is now considered as a molecule of interest for its potentially diverse biotechnological applications in the pharmacological industry and the field of medicine. In this manuscript, we will provide an overview of the repurposing of BEA into a potentially superior therapeutic molecule in a broad range of diseases. Furthermore, considerable attention has been given to the fundamental role of in silico techniques to i) further investigate the spectrum of this secondary metabolite and ii) elucidate the pathways of BEA for its promising therapeutic action

The development of plant-based meat analogues has become a significant challenge for the food industry in recent years due to the increasing demand for sustainable and healthier proteins in the context of a global protein transition. Plant-based meat analogues imitate the visual, textural, and chemical properties of traditional meat products and are required to closely resemble meat to appeal to consumers. In addition, consumers demand natural, clean-label, and nutritional and healthy products. To address these challenges, the food industry must develop highly healthy, nutritious, and E-number-free meat analogue products. Understanding the functionality of each ingredient and its role in the food matrix is crucial to being a key player in the innovation of the meat analogues market. This review provides updated information on the primary ingredients utilized for the development of plant-based burger meat alternatives and their functionality. The key components of meat analogue burgers are outlined, including plant proteins, binding agents, fats and oils, flavorings, colorings, preservatives, fortificants, and clean-label considerations.

Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection, with septic cardiomyopathy being a common and severe complication. Despite its significant clinical impact, the molecular mechanisms underlying sepsis-induced cardiomyopathy (SICM) remain incompletely understood. In this study, we performed a comparative analysis of whole transcriptome profiles in two widely used mouse models of septic cardiomyopathy, the cecal ligation and puncture (CLP) model and the lipopolysaccharide (LPS) model. Our aim was to identify key genes and pathways involved in the development of septic cardiomyopathy and to evaluate the similarities and differences between the two models. Our findings suggested that 1) both methods can induce septic heart dysfunction within 24 hours; 2) distinct whole transcriptome expression profiles are revealed; 3) potentially different pathways are involved in causing heart failure in sepsis. The comprehensive comparison provides valuable insights into the molecular basis of septic cardiomyopathy and contributes to the ongoing search for effective treatment strategies, triggered by different factors for SICM.

The zebrafish is now an important model organism for cancer biology studies and provides some unique and complementary opportunities in comparison to the mammalian equivalent. The translucency of zebrafish has allowed in vivo live imaging studies of tumour initiation and progression at the cellular level thus providing novel insights into our understanding of cancer. Here we summarise and discuss available transgenic zebrafish tumour models and what we have gleaned from them with respect to cancer inflammation. In particular, we focus on the host inflammatory response toward transformed cells during the pre-neoplastic stage of tumour development. We discuss features of tumour associated macrophages and neutrophils in mammalian models and present evidence which supports the idea that these inflammatory cells promote early stage tumour development and progression. Direct live imaging of tumour initiation in zebrafish models has shown that the intrinsic inflammation induced by pre-neoplastic cells is tumour promoting. Signals mediating leukocyte recruitment to pre-neoplastic cells in zebrafish correspond to signals mediating leukocyte recruitment in mammalian tumours. The activation state of macrophages and neutrophils recruited to pre-neoplastic cells appears to be heterogenous, as seen in mammalian models, which provides an opportunity to study the plasticity of innate immune cells during tumour initiation. Although several potential mechanisms are described that might mediate the trophic function of innate immune cells during tumour initiation in zebrafish, there are several unknowns that are yet to be resolved. Rapid advancement of genetic tools and imaging technologies for zebrafish will facilitate research into the mechanisms that modulate leukocyte function during tumour initiation and identify targets for cancer prevention.

Human Cytomegalovirus (HCMV) infection is a serious complication in hematopoietic stem cell transplant (HSCT) recipients due to virus-induced myelosuppression and impairment of stem cell engraftment. Despite the clear clinical link between myelosuppression and HCMV infection, little is known about the mechanism(s) by which the virus inhibits normal hematopoiesis because of the strict species specificity and the lack of surrogate animal models. In this study, we developed a novel humanized mouse model system that recapitulates the HCMV-mediated engraftment failure after hematopoietic cell transplantation. We observed significant alterations in the hematopoietic populations in peripheral lymphoid tissues following engraftment of a subset of HCMV+ CD34+ HPCs within the transplant suggesting that a small proportion of HCMV-infected CD34+ HPCs can profoundly affect HPC differentiation in the bone marrow microenvironment. This model will be instrumental to gain insight into the fundamental mechanisms of HCMV myelosuppression after HSCT and provides a platform to assess novel treatment strategies.

Abstract: This study aimed at investigating the effects of Valencia KK4-type peanut skin ethanolic extract (KK4-PSE) in combination with cisplatin or 5-fluorouracil (5-FU) against HeLa cells in vitro and in xenograft models. MTT assay showed that KK4-PSE, cisplatin, and 5-FU suppressed proliferation of HeLa cells in a dose and time dependent manner. Drug interactions by Chou-Talalay method demonstrated that KK4-PSE enhanced antiproliferative activity of 5-FU against HeLa cells with combination index (CI) values of 0.49 (48 h) and 0.60 (72 h), indicating a synergistic effect, while KK4-PSE combined with cisplatin exhibited an additive effect (CI = 1.02) (72 h) and antagonistic effect at 24 and 48 h exposures (CI = 1.12 and 1.18, respectively). In nude mouse xenograft models, the combination of 5-FU and KK4-PSE markedly reduced HeLa tumor weights compared with control and single agent treatments. The combination of KK4-PSE and 5-FU achieved greater tumor growth inhibition than that of the KK4-PSE-cisplatin combination. KK4-PSE mitigated hepatotoxicity induced by both cisplatin and 5-FU in nude mice. The spleen hyaloserositis was significantly reduced in the combination treatment of 5-FU and KK4-PSE. These findings suggest a potential of KK4-PSE to inhibit cervical cancer cell growth while alleviating the toxicities of cisplatin and 5-FU.

Background: In response to inflammation, the absorption of nutritional iron is restricted. Multiple inflammation-related signaling pathways can lead to ferroptosis, an iron-dependent mechanism of programmed cell death. Since the pathophysiological significance of the presence and uptake of iron in chronic inflammation is still unknown, we tested the effect of a low iron diet on the clinical course of arthritis in the mouse model of collagen-induced arthritis (CIA). Methods: Six- to eight-week-old male DBA/1 mice were fed either a normal or a low iron diet starting three weeks before arthritis induction. From day four after the collagen-booster made on day 25, the development of arthritis was regularly monitored until the end of the experiment (day 34), using a standard clinical arthritis score. The complete blood count was determined as well as Fe2+, Fe3+, oxidized and reduced glutathione (GSH and GSSG) and malondialdehyde (MDA) in whole paw tissue by ELISA. Quantitative PCR was performed from whole paw tissue for glutathione peroxidase 4 and other key regulator genes of iron metabolism and ferroptosis. We used nonparametric tests to com-pare markers of iron metabolism and ferroptosis as well as nonlinear regression models for longitu-dinal data for signs of arthritis. Results: Mice fed a low iron diet showed a significantly less severe course of arthritis compared to mice fed a normal iron diet (p

Necroptosis is an inflammatory form of lytic programmed cell death that is thought to have evolved to defend against pathogens. Genetic deletion of the terminal effector protein – MLKL – shows no overt phenotype in the C57BL/6 mouse strain under conventional laboratory housing conditions. Small molecules that inhibit necroptosis by targeting the kinase activity of RIPK1, one of the main upstream conduits to MLKL activation, have shown promise in several murine models of non-infectious disease and in phase II human clinical trials. This has triggered multi-billion-dollar investments into the emerging class of necroptosis blocking drugs, and the potential utility of targeting the terminal effector is being closely scrutinised. Here we review murine models of disease, both genetic deletion and mutation, that investigate the role of MLKL. We summarize a series of examples from several broad disease categories including ischemia reperfusion injury, sterile inflammation, pathogen infection and haematological stress. Elucidating MLKL’s contribution to mouse models of disease is an important first step to identify human indications that stand to benefit most from MLKL-targeted drug therapies.

Alzheimer’s disease (AD) poses a significant public health challenge due to its irreversible and progressive nature while lack of a cure. As a potential strategy to combat AD, its prevention becomes increasingly attractive. Mild Cognitive Impairment due to AD (MCI-AD) represents a critical transitional stage between normal age-related cognitive decline and more severe AD conditions, occurring just before dementia onset. Unfortunately, there is currently no established animal model that accurately recapitulates MCI-AD characteristics. While many laboratories have traditionally used normally aged wild-type animals as experimental models, this approach falls short in representing the inherently worse state of MCI-AD compared to normal aging. To address this gap, we introduce an animal model—a transgenic mouse line with genetic inactivation of G protein-coupled receptor kinase-5 (GRK5), commonly known as the GRK5 knockout (GRK5KO) mouse. These GRK5KO mice exhibit amnesia, cognitive deficits, increased β-amyloid levels, neurofibrillary tangle (NFT) immunopositive axonopathy, and hippocampal neurodegenerative changes. Importantly, these pathological alterations predominantly impact the entorhinal, transentorhinal, and hippocampal cortices, aligning with human MCI-AD criteria and Braak stage II of human AD progression. Notably, female GRK5KO mice show approximately 2.5 times more NFT-positive axonopathy than males, mirroring the higher prevalence of AD cases in women. Collectively, existing data strongly supports the GRK5KO mouse as a qualified animal model for studying MCI-AD.

This study focuses on mimicking constitutive phosphorylation in the N-terminus of the myosin regulatory light chain (S15D-RLC) as a rescue strategy for the mutation-induced cardiac dysfunction in transgenic (Tg) models of restrictive (RCM) and dilated (DCM) cardiomyopathy caused by mutations in myosin essential (ELC) or regulatory (RLC) light chains. S15D-RLC phosphomimetic was reconstituted in left ventricular papillary muscle (LVPM) fibers from two mouse models of cardiomyopathy, RCM-E143K ELC and DCM-D94A RLC, along with their corresponding Tg-ELC and Tg-RLC wild type (WT) mice. The beneficial effects of S15D-RLC in rescuing cardiac function were manifested by S15D-RLC-induced destabilization of the super-relaxed (SRX) state that was observed in both models of cardiomyopathy. S15D-RLC promoted a shift from the SRX state to the disordered relaxed (DRX) state, increasing the number of heads readily available to interact with actin and produce force. Additionally, S15D-RLC reconstituted fibers demonstrated significantly higher maximal isometric force per cross-section of muscle compared with reconstitution with WT-RLC protein. The effects of the phosphomimetic S15D-RLC were compared to those observed for Omecamtiv Mecarbil (OM), a myosin activator shown to bind to the catalytic site of cardiac myosin and increase myocardial contractility. A similar SRX↔DRX equilibrium shift was observed in OM=treated fibers as in S15D-RLC-reconstituted preparations. Additionally, treatment with OM resulted in significantly higher maximal pCa 4 force per cross-section of muscle fibers in both cardiomyopathy models. Our results suggest that both treatments with S15D-RLC and OM may improve the function of myosin motors and cardiac muscle contraction in RCM-ELC and DCM-RLC mice.

Non-homologous end joining (NHEJ) is the main DNA repair mechanism for the repair of double strand breaks (DSBs) throughout the course of the cell cycle. DSBs are generated in developing B and T lymphocytes during V(D)J recombination to increase the repertoire of B and T cell receptors. DSBs are also generated during the class switch recombination (CSR) process in mature B lymphocytes, providing distinct effector functions of antibody heavy chain constant regions. Thus, NHEJ is important for both V(D)J recombination and CSR. NHEJ comprises core Ku70 and Ku80 subunits that form the Ku heterodimer, which binds DSBs and promotes the recruitment of accessory factors (e.g., DNA-PKcs, Artemis, PAXX, Mri) and downstream core factors (XLF, Lig4 and XRCC4). In recent decades, new NHEJ proteins have been reported, increasing complexity of this molecular pathway. Numerous in vivo mouse models have been generated and characterized to identify the interplay of NHEJ factors and their role in development of adaptive immune system. This review summarizes the currently available mouse models lacking one or several NHEJ factors, with a particular focus on early B cell development. We also underline genetic interactions and redundancy in the NHEJ pathway in mice.

Interferon-gamma (IFN-γ) is an important cytokine in host defense against tuberculosis infection. In some cases, administration of IFN-γ during tuberculosis infection can promote faster cure. In the present work, we have shown that in a mouse model, human interferon-gamma, exhibits some anti-tuberculosis activity, especially in combination with isoniazid.

The Herpes Virus Entry Mediator (HVEM) delivers a negative signal to T cells mainly through the B and T Lymphocyte Attenuator (BTLA) molecule and thus, could represent a novel immune checkpoint during an anti-tumor immune response. A formal demonstration that HVEM can be targeted for cancer immunotherapy is however still lacking. Here, we first show that HVEM and BTLA were associated to a worse prognosis in patients with prostate adenocarcinomas, indicating a detrimental role for this pair of molecule during prostate cancer progression. We then show that a monoclonal antibody to human HVEM significantly impacted the growth of a prostate cancer cell line in immuno-compromised NOD.SCID.gc-null mice reconstituted with human T cells. Using CRISPR/Cas9, we showed that HVEM expression by the tumor was mandatory to observe the therapeutic effect. Mechanistically, tumor control was dependent on CD8+ T cells and was associated to an increase in the proliferation and number of tumor-infiltrating leukocytes. Accordingly, the expression of genes belonging to various T cell activation pathways were enriched in tumor infiltrating leukocytes, whereas genes associated with immuno-suppressive pathways were decreased, possibly resulting in modifications of leukocyte adhesion and motility. Finally, we developed a simple in vivo assay in humanized mice to directly demonstrate that HVEM was an immune checkpoint for T-cell mediated tumor control. Our results show that targeting HVEM is a promising strategy for prostate cancer immunotherapy.

Juvenile Polyposis Syndrome (JPS) is a rare autosomal dominant disorder characterized by multiple juvenile polyps in the gastrointestinal tract, often associated with mutations in genes such as Smad4 and BMPR1A. This study explores the impact of Smad4 knockout on the development of intestinal polyps using Collaborative Cross (CC) mice, a genetically diverse model. Our results reveal a significant increase in intestinal polyps in Smad4 knockout mice across the entire population, emphasizing the broad influence of Smad4 on polyposis. Sex-specific analyses demonstrate higher polyp counts in knockout males and females compared to their WT counterparts, with distinct correlation patterns. Line-specific effects highlight the nuanced response to Smad4 knockout, underscoring the importance of genetic variability. Multimorbidity heat maps offer insights into complex relationships between polyp counts, locations, and sizes. Heritability analysis reveals a significant genetic basis for polyp counts and sizes, while machine learning models, including k-Nearest Neighbours and Linear Regression, identify key predictors, enhancing our understanding of juvenile polyposis genetics. Overall, this study provides a comprehensive understanding of the intricate genetic interplay in the context of Smad4 knockout, offering valuable insights into potential therapeutic targets for juvenile polyposis and related diseases.

Objective: This research was aimed to estimate the anti-fatigue effects of arecoline and elucidate its underlying mechanisms using a murine model of central fatigue precipitated by sleep deprivation (SD). Methods: Seventy-two male C57BL/6 mice were randomly allocated into six groups: a control group, a SD-induced fatigue model group, a group receiving Rhodiola Rosea capsules (2.5 mg/kg), and arecoline groups administered low, medium, and high doses (10, 20, and 40 mg/kg, respectively). Following 28 days of continuous administrations, the effects of arecoline on the mouse fatigue-related behaviors was assessed by the behavioral tests, including grip strength, rotarod performance, and weight-bearing swimming endurance. Enzyme-linked immunosorbent assays (ELISAs) were utilized to measure the levels of the relevant biochemical markers. Western blotting was employed to quantify the expression of nuclear factor erythroid 2-related factor (Nrf2), Kelch-like ECH-associated protein 1 (Keap1), heme oxygenase 1 (HO-1), sequestosome-1 (p62), and NADPH quinone oxidoreductase 1 (NQO1) in the gastrocnemius muscle. Results: Arecoline administration notably enhanced grip strength, delayed the onset of fatigue as evidenced by extended latencies in rotarod tests, and increased the duration of weight-bearing swimming in mice. In the elevated plus maze, arecoline significantly reduced both the number of entries and the total distance traveled in the open arms. Arecoline markedly decreased serum levels of creatine kinase, blood urea nitrogen, lactate dehydrogenase, triglycerides, and cholesterol, while elevated total testosterone, lactate dehydrogenase, and immunoglobulin G levels. Furthermore, it significantly increased superoxide dismutase(SOD), catalase(CAT), and glutathione peroxidase activity in the gastrocnemius muscle, reduced malondialdehyde levels, augmented hippocampal SOD and CAT activity, and elevated glycogen stores in both liver and muscle tissues. Neurotransmitter levels were significantly increased, cytokine levels were markedly reduced, and the expression of Nrf2, Keap1, NQO1, p62, and HO-1 in brain tissue was significantly upregulated. Conclusion: The current study for the first time demonstrated that arecoline has significant anti-fatigue activity, and its mechanism of action is related to elevate the levels of glucose and lipid metabolism, relieve oxidative stress damage, inhibit neuroinflammatory response, regulate neurotransmitter levels and Keap1/Nrf2/HO-1 signaling pathway. The current study provides a new insight into the potential of arecoline in prevention and improvement of fatigue.

Cholangiocarcinoma is an aggressive cancer with limited treatment options. Current therapies, such as cisplatin and 5-fluorouracil (5-FU), often cause side effects and drug resistance. This study investigated a potential new approach by combining a peanut skin extract (KK4-PSE) with these drugs. The extract effectively inhibited the growth of cholangiocarcinoma cells in laboratory studies and showed even greater selectivity for cancer cells compared to healthy cells. When combined with cisplatin or 5-FU, KK4-PSE enhanced the drugs' effects, leading to cell cycle arrest and increased cell death. These combined treatments also reduced levels of proteins that promote cancer cell survival. In animal models, KK4-PSE combined with 5-FU showed superior tumor suppression compared to the combination with cisplatin. Overall, these findings suggest that KK4-PSE may be a promising synergistic agent to improve the effectiveness of chemotherapy for cholangiocarcinoma, warranting further clinical investigation.

Ulcerative colitis (UC) is a chronic inflammatory disease, the incidence of which is increasing worldwide. However, the etiology and pathogenesis of UC remains unclear. The n-butanol extract of pulsatilla decoction (BEPD) of the traditional Chinese medicine herbal formula has been shown to be effective in treating UC. We aimed to explore the molecular mechanism underlying the effects of BEPD on UC, in particular its effects on neutrophil extracellular trap (NET) formation by neutrophils. High-performance liquid chromatography was used to determine the principal compounds of BEPD. UC was induced in mice using dextran sodium sulfate, and mice were treated with 20, 40, or 80 mg/kg BEPD daily for seven days. Colonic inflammation was determined by assessing the disease activity index, histopathology, colonic mucosal damage index, colonic mucosal permeability, and pro- and anti-inflammatory cytokine levels. The infiltration and activation status of neutrophils in the colon were determined by analyzing the levels of chemokine (C-X-C motif) ligand (CXCL)1 and CXCL2, reactive oxygen species, Ly6G, and numerous NET proteins. Our results showed that BEPD improved the disease activity index, histopathology, and colonic mucosal damage index scores of mice with UC, and restored colonic mucosal permeability compared with untreated mice. The expression levels of the pro-inflammatory cytokines interleukin-1β, interleukin-6, and tumor necrosis factor-α in colon tissues were significantly decreased, while the expression levels of anti-inflammatory cytokines in colon tissues were significantly increased, exceeding those of control mice. In addition, BEPD reduce the expression of the neutrophil chemokines CXCL1 and CXCL2 in the colon tissue of mice with UC, reduced neutrophil infiltration, reduced reactive oxygen species levels, and significantly reduced the expression of NET proteins. BEPD also significantly reduced NET formation. The results of this study suggest that BEPD exerts therapeutic effects in a murine model of UC by inhibiting neutrophil infiltration and activation in the colon, as well as by inhibiting the expression of key proteins involved in NET formation and reducing NET formation, thereby alleviating local tissue damage and disease manifestations.

To elucidate mesenchymal stromal cells (MSC)-tumor intricate and ambiguous interactions, the reliable cell labeling and tracking techniques are imperative. Traditional methods of cell labelling have limitations mostly relevant to need for genetic modification what demands the exploration for alternative strategies. Here, we propose using fluorescent photoconvertible microcapsules containing Rhodamine B (RhB) to study mMSC migration in brain tumors. These 3 μm sized microcapsules are readily internalised by cells and undergo photoconversion under 561 nm laser exposure with fluorescence blue shift on demand. Optimal photoconversion was achieved with a laser irradiation duration of 0.4 ms, which provide a maximal brightness of photoconverted label without an excessive laser exposure on cells. Capsules modified with polyallylamine hydrochloride demonstrated the best potential for intracellular uptake without significantly affecting cell viability, motility, or proliferation. The optimal ratio of 20 capsules per mMSC was determined for labeling. Moreover, migration of individual mMSCs within 2D and 3D glioblastoma cell (EPNT-5) colonies over 2 days and in vivo tumor settings over 7 days was tracked. Our study unveils a robust platform for investigating MSC-tumor dynamics, offering insights into therapeutic strategies. Photoconvertible microcapsules could also become an indispensable tool for studying complex fundamental processes of cell-cell interactions for a wide range of problems in biology and medicine.

Mechanical properties of cardiomyocytes from different transmural regions are heterogeneous in the left ventricular wall. The cardiomyocyte mechanical environment affects this heterogeneity because of mechano-electric feedback mechanisms. In the present study, we investigated the effects of load upon transmural differences in contraction of subendocardial (ENDO) and subepicardial (EPI) single cells isolated from the murine left ventricle. Various loads were applied to the cells using carbon fiber techniques for single myocytes. To simulate experimentally obtained results and to predict mechanisms underlying the cellular response to change in load, our mathematical models of the ENDO and EPI cells were used. Extent of the transmural gradient in the time course of contractions was independent of the loading conditions where unloaded and heavy loaded (isometric) contractions were examined, but the regional gradient of the relaxation time characteristics tended to decrease when the load decreased. Under auxotonic contractions, time to peak contraction (T_max) was significantly longer in ENDO cells than in EPI cells at low preload. An increase in preload (axial stretch) prolonged T_max in both cell types; however, the prolongation was greater in EPI cells, resulting in a decrease in transmural gradient in T_max at high preload. The [Ca²⁺]_i transient decay time constant was consistent with the greater preload dependency in T_max of EPI cells. Our modified mathematical models reproduced experimental results, suggesting that differences in cooperativity of cross bridges and calcium troponin C complex interactions between the ENDO and EPI cardiomyocytes may contribute to the different cellular responses to stretch, which may provide a decrease in transmural dispersion of cellular shortening in the intact heart.

We report on an immunofluorescent paper-based assay for the detection of severe acute respiratory symptom coronavirus 2 (SARS-CoV-2) humanized antibody. The paper-based device was fabricated by using lamination technique for easy and optimized handling. Our approach utilises a two-step strategy that involves (i) initial coating of the paper-electrode with recombinant SARS-CoV-2 nucleocapsid antigen to capture the target SARS-CoV-2 specific antibodies, and (ii) subsequent detection of SARS-CoV-2 antibodies using fluorophore-conjugated IgG antibody. The fluorescence readout was observed with fluorescence microscopy. The images were processed and quantified using a MATLAB program. The assay can selectively detect SARS-CoV-2 humanized antibodies spiked in PBS and healthy human serum samples with the relative standard deviation of approximately 6.4% (for n = 3). It has broad dynamic ranges (1 ng to 50 ng/µL in PBS and 5 to 100 ng/µL in human serum samples) for SARS-CoV-2 humanized antibodies with the detection limits of 2 ng/µL (0.025 IU/mL) and 10 ng/µL (0.125 IU/mL) in PBS and human serum samples, respectively. We believe that our assay has the potential to be used as a simple, rapid, and inexpensive paper-based diagnostic device with a portable fluorescent reader to provide point-of-care diagnosis. This assay can be used for rapid examination of a large batch of samples toward clinical screening of SARS-CoV-2 specific antibodies as a confirmed infected active case or to evaluate the immune response to a SARS-CoV-2 vaccine.

Proteinuria is known to be associated with all-cause and cardiovascular mortality, and nephrotic syndrome is defined by the level of proteinuria and hypoalbuminemia. With advances in medicine, new causative genes for genetic kidney diseases are being discovered increasingly frequently. We reviewed articles on proteinuria/nephrotic syndrome, focal segmental glomerulosclerosis, membranous nephropathy, diabetic kidney disease/nephropathy, hypertension/nephrosclerosis, Alport syndrome, and rare diseases, which have been studied in mouse models. Significant progress has been made in understanding the genetics and pathophysiology of kidney diseases thanks to advances in science, but research in this area is ongoing. In the future, genetic analyses of patients with proteinuric kidney disease/nephrotic syndrome may ultimately lead to personalized treatment options.

The enhancement of early diagnosis of lung cancer is mandatory to improve prognosis. We observed the increase cancer stem cells (CSC) and circulating tumor cells (CTC) in blood of mice on d3 after Lewis lung carcinoma (LLC) cell implantation before disease symptom. Besides we have developed an approach to reprogramming immune cells by inhibiting the MAPK/ERK pathway through MEKi and the PD-1/PD-L1 immune checkpoint signaling pathway. We hypothesized that reprogramming of spleen CD8+ T-cells could also create a population of immune cells with high antitumor activity. We reprogrammed CD8+ T-cells derived from the spleen of C57BL/6 mice (rsCD8+T-cells). The rsCD8+T-cells were able to migrate to lung and were more resistant after the exhaustion in vitro in comparison with naïve sCD8+T-cells. In the orthotopic LLC model, the rsCD8+T-cells therapy increased the amount of proliferating CD8+ and CD4+ T-cells in blood and lung from mice. The amount of CSC decreased in the blood and lung of mice treated with rsCD8+ T-cells. A morphological study revealed a decrease in the number of metastases in lung tissue. The antitumor effects of rsCD8+T-cells are based on the activation of the host immune response by increasing the populations of CD8+ and CD4+ T-cells and apoptosis of CSCs.

The abilities of quantitative description of noise are restricted due to its origin and only the statistical and spectral analysis methods can be applied while an exact time evolution cannot be defined or predicted. It emphasizes the challenges faced in many applications including communication systems where noise can play, on one hand, a vital role impacting signal-to-noise ratio but possessing, on the other hand, unique properties such as infinite entropy (infinite information capacity), exponentially decaying correlation function and so on. Despite the deterministic nature of chaotic systems, the predictability of chaotic signals is limited for a short time window putting them close to random noise. In this article, we propose and experimentally verify an approach to achieve Gaussian-distributed chaotic signals by processing the outputs of chaotic systems. The mathematical criteria, on which the main idea of the study is based on, is the Central Limit Theorem which states that the sum of a large number of independent random variables with similar variances approaches a Gaussian distribution. The study involves more than 40 mostly three-dimensional continuous-time chaotic systems (Chua’s, Lorenz’s, Sprott’s, memristor-based, etc.) whose output signals are analyzed according to criteria that encompass the probability density functions of a chaotic signal itself and its envelope and phase, statistical and entropy-based metrics such as skewness, kurtosis, and entropy power. We found that two chaotic signals of Chua’s and Lorenz’s systems exhibited superior performance across the chosen metrics. Furthermore, our focus extended to determining the minimum number of independent chaotic signals necessary to yield a Gaussian-distributed combined signal. The analytic and experimental results indicate that the sum of at least three non-Gaussian chaotic signals closely approximates Gaussian distribution. It allows generation of reproducible Gaussian-distributed deterministic chaos by modeling simple chaotic systems.

One of the primary causes of the mechanical seal failure is rotor vibration. Traditional dynamic seal models often would not be able to fully explaining the failure mechanisms. The seal dynamic models proposed in this paper, including those developed by the authors, prove valuable in predicting seal dynamics during operation in specific turbomachinery and in explaining the causes of seal failure. The single-mass dynamic model is suitable for analyzing contact mechanical seal and simple design dry gas seals dynamics. The two-mass dynamic model is used for investigating operational dynamics processes in classical dry gas seals under complex loading conditions. The three-mass dynamic model is used to study various complex mechanical seal types. This model is able to determine the normal operating condition range and to explain leakage mechanisms in the presence of excessive rotor vibrations.

Meningitis is a severe disease associated with death in children under five with highest rates of infections under age of one. Vaccines for Neisseria meningitides and Haemophilus influenza are used to prevent the main causative agents of meningitis. Administration of H. influenzae type b (Hib) vaccine is recommended at 2, 4 and 6 months with a booster dose at 18 months. N. meningitidis has two commercially available vaccines, the pure polysaccharide is recommended at 24 months meanwhile the protein-conjugated vaccines at 12 months. We sought in this study to examine if coadministering the vaccines for the two main meningitis causing bacteria might be synergistic as a preliminary step towards the possibility of shuffling immunization schedule. So, we coadministered Hib vaccine with commercially available vaccines either quadrate (ACWY) polysaccharide meningococcal (Men) or conjugated meningococcal (Nim) vaccines in Balb/C mice (n = 6/group) and compared to each vaccine administered separately and controls. Thirty-five days post immunization, we measured specific antibodies titers. Hib vaccine increased Men antibody titers significantly for serotypes Y and W. When Hib vaccine was coadministrated with Nim, antibody titer for Y, W and A significantly increased. For serotype C, there was no significant difference in antibody titers among immunized groups. As for effect of meningococcal vaccines on Hib, Men significantly increased Hib antibody titers while Nim had no effect. Collectively, our data suggested that coadministration of Hib and Men or Nim vaccines was safe and had synergistic effect on immune responses elicited to both vaccines. Further studies are needed before immunization schedule modifications. Such immunization schedule recommendation should provide better protection against this life-threatening disease in young children.

Abstract: Endoglin (ENG) is a causative gene of type 1 hereditary hemorrhagic telangiectasia (HHT1). HHT1 patients have arteriovenous malformations (AVMs) in multiple organs, including the brain. In mice, Eng deletion induced by R26RCreER or SM22aCre leads to AVM development in the brain and other organs. We have reported that the severity of brain AVM in mice with activin receptor-like kinase 1 (Alk1, an HHT2 causative gene) mutation is correlated with the number of Alk1 negative endothelial cells (ECs). We hypothesized that increase of Eng negative ECs will enhance AVM severity. To increase EC Eng deletion, we used a codon improved cre (icre), which is more potent in recombination of floxed alleles than the wild type (WT) cre. R26RCreER;Eng^f/f mice that have Rosa promoter driving and tamoxifen (TM) inducible WT cre expression globally and PdgfbiCreER;Eng^f/f that have Pdgfb promoter driving and TM inducible icre expression in ECs were treated with 3 intra-peritoneal injections of TM (2.5 mg/25g of body weight) to delete Eng globally or in the ECs. AAV-VEGF was stereotactically injected into the brain to induce brain focal angiogenesis and brain AVM. We found that iCre caused more Eng deletion in the brain indicated by lower level of Eng proteins (p<0.001) and fewer Eng positive ECs (p=0.01) than mice with WT cre. Mice with iCre mediated Eng deletion have more abnormal vessels (p=0.02), CD68⁺ macrophages (p=0.002), and hemorrhage (p=0.04), and less vascular pericyte and smooth muscle coverage than mice with WT cre. In addition, arteriovenous shunts were detected in the intestines of icre mice, a phenotype that have not been detected in WT cre mice before. RNAseq analysis showed that 8 out of the 10 top upregulated pathways identified by Gene Ontology (GO) analysis are related to the inflammation. Therefore, increase of Eng deletion in ECs exacerbates AVM severity, which is associated with enhanced inflammation. Strategies that can reduce Eng negative ECs could be used to develop new therapies to reduce AVM severity for HHT1 patients.

This paper investigates five different GARCH models (GARCH, EGARCH, IGARCH, Component GARCH (CGARCH) and GJR-GARCH) along with six distributions (Normal, Student’s t, GED and their skewed forms), which are used to forecast the volatility for the Bulgarian Stock index SOFIX. We use a GARCH model to predict how much time it will take, after the latest crisis, for the SOFIX index to reach its historical peak once again. The empirical data covers the period between the years 2000 and 2024, including the 2008 financial crisis and the COVID-19 pandemic. The purpose is to answer which of the five models is the best at forecasting the volatility of SOFIX and which distribution is most appropriate. The results, based on BIC and AIC information criteria, show that the ARMA(1,1)-CGARCH(1,1) specification with the Student t-distribution is preferred for forecasting. With the help of 5000 simulations, it is estimated that the chances of Index SOFIX reaching its historical peak value of 1976.73 (08.10.2007) are higher than 90% at 13.08.2087.

Recessive dystrophic epidermolysis (RDEB) is a rare, inherited and currently incurable skin blistering disorder characterized by cyclically recurring wounds coexisting with chronic non-healing wounds. In a recent clinical trial three intravenous infusions of skin-derived ABCB5+ mesenchymal stromal cells (MSCs) to 14 patients with RDEB improved healing of wounds that were present at baseline. Since in RDEB even minor mechanical forces perpetually provoke the development of new or recurrent wounds, a post-hoc analysis of patient photographs was performed to specifically assess the effects of ABCB5+ MSCs on new or recurrent wounds by evaluating 174 wounds that occurred after baseline. During 12 weeks of systemic treatment with ABCB5+ MSCs the number of newly occurring wounds declined. When compared to the previously reported healing responses of the wounds present at baseline, the newly occurring wounds healed faster, and a greater portion of healed wounds remained stably closed. These data suggest a previously undescribed skin-stabilizing effect of treatment with ABCB5+ MSCs and support repeated dosing of ABCB5+ MSCs in RDEB to continuously slow the wound development and accelerate the healing of new or recurrent wounds before they become infected or progress to a chronic, difficult-to-heal stage.

The conformity assessment of products or a measured value with the given standards is carried out based on the global risk of producers and consumers calculation. A product may conform to specifications but be falsely rejected as non-conforming. This is about the producer's risk. If a product doesn't meet the requirements but is falsely accepted as conforming, that poses a risk to the consumer. The conventional approach to risk assessment, which yields only a single numerical value for the global risk of producers and consumers, is naturally extended, and utilized for assessing risk in measurement models with linear regression. The outcomes of the two-dimensional extension, along a moderate scale, are the parabolas with an opening upwards. Risk surfaces were obtained through three-dimensional extension over the area limited by the moderate scale and guard band axes. Four models with different ranges of tolerance intervals were used to test this innovative method of risk assessment in linear regression. The corresponding standard measurement uncertainties are determined by applying a simplified measurement model with the use of comprehensive data on the measurement performance and by determining measurement uncertainty derived from consideration of the functional relationship obtained by linear regression analysis. Models that utilize information from linear regression analysis to determine measurement uncertainty are biased towards risks at the edges of the moderate scale. Testing the model's performances with metrics related to the confusion matrix, such as the F1 score, further substantiated this assertion. The diagnostic odds ratio has been proven to be extremely effective in identifying the curve along the guard band axis, along which the global risks of producers and consumers are at their lowest.

The COVID-19 pandemic has underscored the importance of swift responses and the necessity of dependable technologies for vaccine development. Our team previously developed a fast cloning system for the modified vaccinia virus Ankara (MVA) vaccine platform. In this study, we report the construction and preclinical testing of a recombinant MVA vaccine obtained using this system. We obtained recombinant MVA expressing the unmodified full-length SARS-CoV-2 spike (S) protein containing the D614G amino acid substitution (MVA-Sdg) and a version expressing a modified S protein containing amino acid substitutions designed to stabilize the protein a in a pre-fusion conformation (MVA-Spf). S protein expressed by MVA-Sdg was found to be expressed and correctly processed and transported to the cell surface, where it efficiently produced cell-cell fusion. Version Spf, however, was not proteolytically processed and despite being transported to the plasma membrane, it failed to induce cell-cell fusion. We assessed both vaccine candidates in prime-boost regimens in the susceptible transgenic K18-human angiotensin converting enzyme 2 (K18-hACE2) mice and in golden Syrian hamsters. Robust immunity and protection from disease was induced with either vaccine in both animal models. Remarkably, the MVA-Spf vaccine candidate produced higher levels of antibodies, a stronger T cell response, and a higher degree of protection from challenge. In addition, the levels of SARS-CoV-2 in the brain of MVA-Spf inoculated mice was decreased to undetectable levels. Those results add to our current experience and range of vaccine vectors and technologies for developing a safe and effective COVID-19 vaccine

This paper introduces a novel framework for zero-shot learning (ZSL), i.e., to recognize new categories that are unseen during training, by distilling knowledge from foundation models. Specifically, we first employ ChatGPT and DALL-E to synthesize reference images of unseen categories from text prompts. Then, the test image is aligned with text and reference images using CLIP and DINO. Finally, the predicted logits are aggregated according to their confidence to produce the final prediction.Experiments are conducted on multiple datasets, including CIFAR-10, CIFAR-100, and TinyImageNet. The results demonstrate that our model can significantly improve classification accuracy compared to previous approaches, achieving AUROC scores above 96\% across all test datasets. Our code is available at https://github.com/1134112149/MICW-ZIC.

With the development of organizational biology and forced from the EU Cosmetic Regulation (EU/1223/2009) with the complete ban of animal testing for cosmetic purposes, 3D skin models have been widely developed due to their similar physiological structure and metabolic function to native human tissue. 3D skin models for in vitro cosmetic evaluation are still promising alternative methods for evaluating phototoxicity, corrosivity and irritation. These models have been used for early screening and later validation of toxicity and efficacy evaluation by many well-known cosmetic companies. 3D skin models have become an important tool in cosmetic evaluation research. This article reviews the development of 3D skin models and their application in cosmetic evaluation. An outlook on the current application and future technological development directions in the cosmetic field is also presented.

As Artificial Intelligence (AI) technology, particularly Machine Learning algorithms, becomes increasingly ubiquitous, our abilities to understand and interpret AI and machine learning algorithms are becoming increasingly desirable. Visualization has been used as a common tool to view and understand complex machine learning processes. In this paper, we will focus on developing a general framework for the visualization of machine learning models as a scalar valued multi-dimensional function to help users understand how the models behave over different viewing spaces. We first give a formal definition of the visualization problem. Interpolation-based morphing and subspace sampling techniques are applied to generate various renderings through projections and cross-sections of the model space as 3D surfaces or heatmap images. This method will be applied to two real-world datasets and applications: the diagnosis of Alzheimer's Disease (AD) using a human brain networks dataset and a real-world benchmark dataset for predicting home credit default risks. The visualizations show that different machine learning algorithms can behave quite differently under different conditions.

Current methodologies for developing patient-derived xenografts (PDX) in humanized mice in preclinical trials to test response to immune-based therapies are limited by graft versus host disease. Here we compared two approaches for establishing PDX tumors in humanized mice: 1) PDX are first established in immune-deficient mice; 2) PDX are initially established in humanized mice, before transplanting established PDX’s to a larger cohort of humanized mice for preclinical trials. With the first approach, there was rapid wasting of PDX-bearing humanized mice with high levels of activated T cells in the circulation and organs, indicating immune-mediated toxicity. In contrast, with the second approach, toxicity was less of an issue and long-term human melanoma tumor growth and maintenance of human chimerism was achieved. Pre-clinical trials from the second approach revealed that rigosertib, but not anti-PD-1, increased CD8/CD4 T cell ratios in spleen and blood and inhibited PDX tumor growth. Resistance to anti-PD-1 was associated with limited infiltration of CD8+ T cell into the tumor. Our findings suggest that it is essential to carefully manage immune editing by first establishing PDX tumors in the presence of human immune cells before expanding PDX tumors into a larger cohort of humanized mice to evaluate therapy response.

The assortment of low-cost 3D printers for “in-practice” use, e.g., for clear aligner therapies, is ever increasing. To address concerns about the accuracy of orthodontic models produced on such printers when cost efficient modes of 3D printing are employed, this study examined the effect of print model body type and print angulation on accuracy. Six printing-configuration groups were included: 2 model types (solid or hollow shell) combined with 3 print angles (0°, 70°, or 90°) with 10 models/group; all models were printed with 100-µm layer thickness using a digital light processing-based 3-dimensional printer. Eleven selected structures and distances were measured on the printed models with a digital microscope and compared to the same measures on a digitized master model. The clinically-acceptability range was set at ±0.25 mm difference from the master model for single tooth measurements (intra-tooth) and ±0.5 mm for cross-arch measurements (inter-tooth). For individual measurements across all models, 98% fell within clinical acceptability. For mean measurements within each model group, only canine height for the shell-0° model had a mean difference (0.26 mm ± 0.03) outside the clinically acceptable range for intra-tooth measurements. Standard deviations for all intra-tooth measurements were within 0.07 mm. While none of the mean inter-tooth measurements exceeded the acceptability range, the standard deviations were larger (0.04 to 0.30 mm). Accuracy of orthodontic models for clear aligner therapies was not impacted beyond the clinically acceptable range when altering model body type and print angulation to improve efficiency of 3D printing. These findings suggest greater flexibility of the practitioner to alter print settings to address time and cost efficiency in various clinical scenarios and still maintain clinically acceptable model accuracy.

Antigen-presenting cells (APCs) are essential for modulating immune responses, and optimizing their differentiation protocols is critical for cell-based immunotherapies. This study compares eight different protocols for differentiating APCs from C57BL/6J mice using GM-CSF and L-929 supernatant. Four groups treated with GM-CSF and four with L-929 supernatant at various concentrations, alongside a control group were evaluated. Flow cytometry was used to analyze the expression of key markers, including MHC II, CD11c, F4/80, and CD11b. Our findings show that GM-CSF resulted in superior differentiation outcomes compared to L-929 supernatant, with higher expression levels of the analyzed markers. This study underscores the importance of considering both cell yield and protein expression quality in selecting differentiation protocols. For researchers developing therapies targeting specific cell populations, these findings demonstrate how different culture conditions influences both the quantity and phenotypic characteristics of differentiated cells. Balancing efficiency and phenotypic fidelity is crucial for optimizing cell-based immunotherapy strategies. Our data provide a valuable reference for future studies and applications involving APC differentiation from bone marrow precursors, ensuring robust foundations for developing advanced immunotherapies. This comprehensive comparison of differentiation protocols offers insights essential for enhancing the effectiveness and cost-efficiency of cell-based therapies.

Accurate traffic simulation models play a crucial role in developing intelligent transport systems that offer timely traffic information to users and efficient traffic management. However, calibrating these models to represent real-world traffic conditions accurately poses a significant challenge due to the dynamic nature of traffic flow and the limitations of traditional calibration methods. This article introduces a machine learning-based approach to calibrate macroscopic traffic simulation models using real-time traffic video stream data. By leveraging computer vision technologies to extract key traffic parameters from video streams, the approach demonstrated a notable improvement in aligning the generated data from the calibrated simulation model with car sensor data, achieving an average improvement of over 50% compared to the uncalibrated macroscopic model. Moreover, there was a substantial reduction in data drift for the machine learning model integrated into the virtual transport space using vehicle-to-everything technology, resulting in a more than fourfold decrease in the average absolute error of the model.

The rapid advancement of large language models (LLMs), such as ChatGPT, has revolutionized natural language processing, enabling these models to generate coherent and contextually relevant text. These capabilities hold significant potential for various applications, particularly in the medical field. LLMs can assist healthcare professionals by providing accurate information, supporting diagnostic processes, and enhancing medical education. However, the implementation of LLMs in clinical settings faces several barriers, including technical limitations, ethical concerns, regulatory constraints, and practical challenges. Ensuring accuracy, reliability, and interpretability is crucial, along with addressing biases, ensuring data privacy, and establishing ethical guidelines. Future research should focus on improving training techniques, developing explainable AI methods, and creating efficient, resource-saving models. Expanding applications through domain-specific models and multi-modal integration can further unlock the potential of LLMs. By addressing these challenges and prioritizing responsible development, LLM technology can be safely and effectively integrated into various domains, driving innovation and improving outcomes. This paper explores the current state of LLM technology, its medical applications, barriers to implementation, and directions for future research and development

Drug-induced liver injury (DILI) stands as a significant cause of drug attrition. To mitigate clinical DILI risks, assessing drugs using human liver models is crucial since animal studies may fall short due to species-specific liver pathway variations. Cell-based preclinical hepatotoxicity testing is often pertinent. In the present study, cells from a human liver cancer line (HepG2, HepaRG) were cultured in both formats of 2D and 3D spheroids to explore their responses to drugs. Liver-specific marker expressions across cell lines and culture formats were also examined to assess disparities in drug-induced liver injury marker expressions. In cytotoxicity assays, HepG2 cells exhibited heightened sensitivity to amiodarone HCl, while HepaRG cells showed greater sensitivity to acetaminophen. Generally, 2D cultures were more responsive to drugs than 3D cultures. Consistency was observed between cytotoxicity assays and liver injury markers AST and ALT. Variations were also noted in liver cell marker secretion, with albumin and urea concentrations declining post-drug treatment, particularly with higher baseline expression in HepaRG cells and 3D cultures. Additionally, mRNA expression levels of CYP enzymes involved in hepatocellular drug metabolism were compared following treatment with enzyme inducers. CYP1A2 and CYP2C9 were not expressed in HepG2 cells. On the other hand, CYP3A4 was expressed higher in 3D culture than in 2D culture. HepaRG cells exhibited significantly increased expression of all three enzymes post-treatment. Notably, enzyme expression was notably higher in 3D cultures than in 2D cultures. Collectively, these findings suggest that HepaRG cells and 3D cultures hold promise for evaluating DILI during early-stage drug development.

Variable-Angle Tow (VAT) laminates can improve straight fiber composites mechanical properties thanks to the application of curvilinear fibers. This characteristic allows to achieve ambitious objectives for design and performance purposes. Nevertheless, the wider design space and the higher number of parameters result in a more complex structural problem. Among the various approaches that have been used for VATs study, Carrera’s Unified Formulation (CUF) allows to obtain multiple theories within the same framework, guaranteeing a good compromise between the results accuracy and the computational cost. In this article, the linear buckling behavior of VAT laminates is analyzed through the extension of CUF 2D plate models within the Reissner’s Mixed Variational Theorem (RMVT). Results show that RMVT can better approximate the prebuckling non-uniform stress field of the plate when compared to standard approaches, thus improving the prediction of the linear buckling loads of VAT composites.

Predicting human trajectories poses a significant challenge due to the complex interplay of pedestrian behavior, which is influenced by environmental layout and interpersonal dynamics. This complexity is further compounded by variations in scene density. To address this, we introduce a novel dataset from the Festival of Lights in Lyon 2022, characterized by a wide range of densities (0.2-2.2 ped/m2). Our analysis demonstrates that density-based classification of data can significantly enhance the accuracy of predictive algorithms. We propose an innovative two-stage processing approach, surpassing current state-of-the-art methods in performance. Additionally, we utilize a collision-based error metric to better account for collisions in trajectory predictions. Our findings indicate that the effectiveness of this error metric is density-dependent, offering prediction insights. This study not only advances our understanding of human trajectory prediction in dense environments but also presents a methodological framework for integrating density considerations into predictive modeling, thereby improving algorithmic performance and collision avoidance.

The extent of correlation or co-movement among the returns of developed and/or emerging stock markets remains pivotal for efficiently diversifying global portfolios. This correlation is prone to variation over time as a consequence of escalating economic interdependence fostered by international trade and financial markets. In this study, we analyzed the time-varying correlation and co-movement between the JSE.JO stock market of South Africa and its developed and developing stock market partners. The Dynamic Conditional Correlation - Exponential Generalized Autoregressive Conditional Heteroscedasticity (DCC-EGARCH) methodology is employed with different multivariate distributions to explore the time-varying correlation and volatilities between the JSE.JO stock market and its partners. Based on the conditional correlation results, the JSE.JO stock market is integrated and co-moves with its partners, and the conditional correlation for all markets exhibit time-variant behavior. The conditional volatility results show that the JSE.JO stock market behaves differently from other markets, especially after 2015, indicating a positive sign for investors to diversify between JSE.JO and its partners. The highest value of conditional volatility for markets was in 2020 during the COVID-19 pandemic, representing the riskiest period that investors should avoid due to the lack of diversification opportunities during crises.

Electricity price forecasting has become a crucial element for both private and public decision-making. This importance has been growing since the wave of deregulation and liberalization of energy sector worldwide late 1990s. Given these facts, this paper tries to come up with a precise and flexible forecasting model for the wholesale electricity price for the Italian power market on an hourly basis. We utilize artificial intelligence models such as neural networks and bagged regression trees that are rarely used to forecast electricity prices. After model calibration, our final model is bagged regression trees with exogenous variables. The selected model outperformed neural network and bagged regression with single price used in this paper, it also outperformed other statistical and non-statistical models used in other studies. We also confirm some theoretical specifications of the model. As a policy implication, this model might be used by energy traders, transmission system operators and energy regulators for an enhanced decision-making process.

The multiphase motors due to their reliability find new areas of application in the industry and transportation. Developing of any system with multiphase motors at first requires elaborate model of the system, define control mode and controllers. The model of control system for the six-phase drive is based on its conventional d-q mathematical model and indirect field-oriented control. Simulink model of six-phase drive with indirect field-oriented control and simulated with two types PID and PID fuzzy controllers. The simulation results, reflecting step response and provided speed reference law as well as load application at constant speed, are presented and analyzed. Fuzzy controller with 49 rules is considered and applied. Six-phase electric drive with field-oriented control at well-tuned PID controller has good step response specifications: settling time 0.13 s at starting without load, step response has no overshoot, small about 1 % short time decrease of speed at load of 5 Nm application. The system employing PID fuzzy controller shows slightly better results in response to torque application: the decrease in speed 1 % is eliminated in shorter time. Simulation results indicate the robustness of both systems with six-phase drive to disturbance and provide high quality transient specifications at determined reference speed.

Polysulfides are endogenously produced in mammals and generally associated with protective functions. Our aim was to investigate the effect of dimethyl trisulfide (DMTS) in a mouse model of acute stress. DMTS activates transient receptor potential ankyrin 1 (TRPA1) channels and leads to neuropeptide release, potentially that of substance P (SP). We hypothesize that DMTS might inhibit the degrading enzymes of endocannabinoids, so this system was also investigated as another possible pathway for mediating the effects of DMTS. Trpa1 gene wild type (WT) and knock out (KO) mice were used to confirm the role of the TRPA1 ion channel in mediating the effects of DMTS. C57BL/6J, NK1 gene KO, and Tac1 gene KO mice were used to evaluate the effect of DMTS on the release and expression of SP. Some C57BL/6J animals were treated with AM251, an inhibitor of the cannabinoid CB1 receptor, to elucidate the role of the endocannabinoid system in these processes. Open field test (OFT) and forced swim test (FST) were performed in each mouse strain. Tail suspension test (TST) was performed in TRPA1 WT and KO animals. C-FOS immunohistochemistry was carried out on TRPA1 WT animals. DMTS treatment increased the number of highly active periods and decreased immobility time in the FST in WT animals, but had no effect on Trpa1 KO mice. DMTS administration induced neuronal activation in stress-related brain areas such as the locus coeruleus, dorsal raphe nucleus, lateral septum, paraventricular nucleus of the thalamus, and paraventricular nucleus of the hypothalamus. DMTS may have a potential role in the regulation of stress-related processes, and the TRPA1 ion channel may also be involved in mediating the effects of DMTS. DMTS can be an ideal candidate for further study as a potential remedy in stress-related disorders.

Two monoclonal antibodies (mAbs) against human epidermal growth factor receptor 2 (HER2), trastuzumab and pertuzumab, were clinically approved. We previously developed a highly sensitive and specific anti-HER2 mAb, H2Mab-139 (mouse IgG1, kappa). In this study, we produced a defucosylated IgG2a version of anti‑HER2 mAb (H2Mab-139-mG2a-f) to enhance ADCC-mediated antitumor activity. H2Mab-139-mG2a-f exhibits a high binding affinity in flow cytometry with the dissociation constant (KD) determined to be 3.9 × 10‑9 M and 7.7 × 10‑9 M against HER2‑overexpressed Chinese hamster ovary (CHO)-K1 (CHO/HER2) and HER2-positive BT-474 cells, respectively. Moreover, we showed that H2Mab-139-mG2a-f exerted ADCC and complement-dependent cytotoxicity against CHO/HER2 and BT-474 cells in vitro and exhibited potent antitumor activities in the xenograft models. These results indicated that H2Mab-139-mG2a-f exerts antitumor effects against HER2-positive human breast cancers and could be useful for an antibody treatment regimen for HER2-positive human cancers.

Large Language Models (LLMs) have demonstrated promising capabilities to solve complex tasks in critical sectors such as healthcare. However, LLMs are limited by their training data which is often outdated, the tendency to generate inaccurate ("hallucinated") content and a lack of transparency in the content they generate. To address these limitations, retrieval augmented generation (RAG) grounds the responses of LLMs by exposing them to external knowledge sources. However, in the healthcare domain there is currently a lack of systematic understanding of which datasets, RAG methodologies and evaluation frameworks are available. This review aims to bridge this gap by assessing RAG-based approaches employed by LLMs in healthcare, focusing on the different steps of retrieval, augmentation and generation. Additionally, we identify the limitations, strengths and gaps in the existing literature. Our synthesis shows that proprietary models such as GPT-3.5/4 are the most used for RAG applications in healthcare. Also, there is a lack of standardized evaluation frameworks for RAG-based applications. In addition, the majority of the studies do not assess or address ethical considerations related to RAG in healthcare. It is important to account for ethical challenges that are inherent when AI systems are implemented in the clinical setting. Lastly, we highlight the need for further research and development to ensure responsible and effective adoption of RAG in the medical domain.

Molnupiravir, a prodrug known for its broad antiviral activity, demonstrated efficacy in animal models of Covid-19, prompting clinical trials where initial results indicated a significant effect against the disease. However, subsequent clinical studies did not confirm these findings, leading to the rejection of molnupiravir for permanent market authorization in many countries. This report critically assessed 19 studies published in 17 reports that investigated the efficacy of molnupiravir in animal models of Covid-19 with the purpose of determining how well the design of these models informed human studies. We found that the administered doses of molnupiravir in most studies involving animal Covid-19 models were disproportionately higher than the dose rec-ommended for human use. Specifically, when adjusted for body surface area, half of the doses of molnupiravir used in the animal studies were more than twice as high as the human dose. Addi-tionally, the drug was frequently given prophylactically or shortly after SARS-CoV-2 inoculation in these models, in contrast to clinical trials where such timing is not consistently achieved. Furthermore, the recommended five-day treatment duration for humans was exceeded in several animal studies. Collectively, we suggest that these design elements in the reported animal studies contributed to a bias favoring molnupiravir, and thus inflated expectations for its efficacy against Covid-19. Addressing these elements may offer avenues to enhance the clinical efficacy of mol-nupiravir for treatment of Covid-19 that include dose increment, early treatment, and admin-istration by inhalation along with use of molnupiravir in antiviral combination therapy.

In this study, we investigated the features of co-infection with SARS-CoV-2 and nonpathogenic strain LEV8 of coxsackievirus A7 or enterovirus A71 for Vero E6 cells and Syrian hamsters. The investigation of co-infection with SARS-СoV-2 and LEV-8 or EV-A71 in the cell model was shown that a competitive inhibitory effect for these viruses were especially significant against SARS-CoV-2. Pre-infection with enteroviruses in animals caused more than a 100-fold decrease in the levels of SARS-CoV-2 virus replication in the respiratory tracts and more rapid clearance of the lower respiratory tract from infectious SARS-CoV-2. Co-infection with SARS-CoV-2 and LEV-8 or EV-A71 also reduced the severity of clinical manifestations of the SARS-CoV-2 infection for animals. Additionally, the histological data illustrated that co-infection with nonpathogenic coxsackievirus decreased the level of pathological changes by SARS-CoV-2 in the lungs. Research into the chemokine/cytokine profile demonstrated that the studied enteroviruses efficiently triggered this part of antiviral immune response, which can be associated with significant inhibition of SARS-CoV-2 infection. These results demonstrate that there exists a strong viral interference between the studied nonpathogenic strain of coxsackievirus A7 or enteroviruses A71 and SARS-CoV-2 pathogenic for humans in vitro and in vivo.

Despite significant advancements in Artificial Intelligence (AI) and Large Language Models (LLMs), detecting and mitigating bias remains a critical challenge, particularly within social media platforms like X (formerly Twitter) and in addressing cyberbullying present on them. This research investigates the effectiveness of leading LLMs in generating synthetic biased and cyberbullying data and evaluates the proficiency of Transformer AI models in detecting bias and cyberbullying within both authentic and synthetic contexts. The study involves semantic analysis and feature engineering on a dataset of over 48,000 sentences related to cyberbullying collected from Twitter (before it became X). Leveraging state-of-the-art LLMs such as ChatGPT-4o, Pi AI, Claude 3 Opus, and Gemini-1.5, synthetic biased, cyberbullying, and neutral data were generated to deepen the understanding of bias in human-generated data. AI models including DeBERTa, Longformer, BigBird, HateBERT, MobileBERT, DistilBERT, BERT, RoBERTa, ELECTRA, and XLNet were initially trained to classify Twitter cyberbullying data and subsequently fine-tuned, optimized, and quantized for multilabel classification (detecting both biases and cyberbullying). The study's outcomes include a prototype of a hybrid application that combines a Bias Data Detector and a Bias Data Generator, validated through extensive testing.

Decompression sickness (DCS) with neurological disorders is the leading cause of diving accidents. Exposure to high levels of CO2 during diving is a safety concern for occupational , groups at risk of DCS. However, the effects of prior exposure to CO2 have never been evaluated. The purpose of this study was to evaluate the effect of CO2 breathing prior to a provocative dive on the occurrence of DCS in mice. 50 mice were exposed to a maximum CO2 concentration of 70 hPa for one hour at atmospheric pressure. Another 50 mice breathing air under similar conditions served as controls. In the AIR group (controls), 22 out of 50 mice showed post-dive symptoms compared to 44 out of 50 in the CO2 group. We found that CO2 breathing is associated with a decrease in body temperature in mice and that CO2 exposure dramatically increases the incidence of DCS. More unexpectedly, it appears that a lower temperature of the animals even before exposure to the accident-prone protocol leads to an unfavorable prognosis. This study also suggests that the composition of the microbiota may influence thermogenesis and thus accidentology. Depending on prior exposure, some bacteria identified in this work could be perceived as protective or pathogenic.

This study considers an application of the first-order Grey Markov Model to foresee the values of Italian power generation in relation to the available energy sources. The model is used to fit data from the Italian energy system from 2000 to 2022. The integration of Markovian error introduces a random element to the model, which is able now to capture inherent uncertainties and misalignments between the Grey model predictions and the real data. This application provides valuable insights for strategic planning in the energy sector and future developments. The results show good accuracy of the predictions, which provides powerful information for the effective implementation of energy policies concerning the evolution of energy demand in the country. Despite advancements, Italy’s 2032 energy mix will still significantly rely on fossil fuels, emphasizing the need for sustained efforts beyond 2032 to enhance sustainability.

The pursuit of Artificial Intelligence (AI) that emulates human cognitive processes is a cornerstone of ethical AI development, ensuring that emerging technologies can integrate seamlessly into societal frameworks requiring nuanced understanding and decision-making. Zero-Shot Instance Retrieval (ZSIR) stands at the forefront of this endeavour, potentially providing a robust platform for AI systems, particularly large visual language models, to demonstrate and refine cognition-aligned learning without the need for direct experience. In this paper, we critically evaluate current cognition alignment methodologies within traditional zero-shot learning paradigms, using visual attributes and word embedding generated by large AI models. We propose a unified similarity function that quantifies the cognitive alignment level, bridging the gap between AI processes and human-like understanding. Through extensive experimentation, our findings illustrate that this similarity function can effectively mirror the visual-semantic gap, steering the model towards enhanced performance in zero-shot instance retrieval. This work not only benchmarks the cognition alignment of AI, but also sets a new precedent for the development of visual language models attuned to the complexities of human cognition.}

Abstract This study delved into the application of various machine learning (ML) models for the classification of lung cancer levels. Through meticulous monitoring of parameters such as minimum child weight and learning rate, efforts were made to mitigate overfitting while optimizing model performance. The Deep Neural Network (DNN) emerged as a standout performer, showcasing robust performance across training, validation, and testing stages. Ensemble methods like voting and bagging also demonstrated promising results. However, Support Vector Machine (SVM) models with the Sigmoid kernel faced challenges in achieving satisfactory performance. Overall, the investigation sheds light on the efficacy of different ML models in lung cancer level classification and underscores the importance of parameter tuning to address overfitting concerns.

Ice formation on aircraft surfaces poses significant safety risks, and current detection systems often struggle to provide accurate, real-time predictions. This paper presents the development and comprehensive evaluation of a smart ice control system using a suite of machine learning models. The system utilizes various sensors to detect temperature anomalies and signal potential ice formation. We trained and tested supervised learning models (Logistic Regression, Support Vector Machine, Random Forest), unsupervised learning models (K-means clustering), and neural networks (Multi-Layer Perceptron) to predict and identify ice formation patterns. Experimental results demonstrate that our smart system, driven by machine learning, accurately predicts ice formation in real-time, optimizes de-icing processes, and enhances safety while reducing power consumption. This solution holds the potential for improving ice detection accuracy in aviation and other critical industries requiring robust predictive maintenance.

With the increasing use of data-driven modeling methods new approaches to complex problems in the field of wind energy can be addressed. Topics reviewed through literature include wake modeling, performance monitoring and controls applications, condition monitoring and fault detection, and other data-driven research. Literature shows the advantages of data-driven methods reduce computational expense or complexity, particularly in the cases of wake modeling and controls, as well as various data-driven methodologies’ aptitude for predictive modeling and classification, as in the cases of fault detection and diagnosis. Significant work exists for fault detection while less work is found for controls applications. A methodology for creating data-driven wind turbine models for arbitrary performance parameters is proposed. Results are presented utilizing the methodology to create wind turbine models relating active adaptive twist to steady-state rotor thrust as a performance parameter of interest. Resulting models are evaluated by comparing root-mean-square-error (RMSE) on both the training and validation data sets, with Gaussian Process Regression (GPR), deemed an accurate model for this application. The resulting model undergoes particle swarm optimization to determine the optimal aerostructure twist shape at a given wind speed with respect to the modeled performance parameter, aerodynamic thrust load. The optimization process shows an improvement of 3.15% in thrust loading for the 10 MW reference turbine, and 2.66% for the 15 MW reference turbine.

This study investigates the effects of xylitol, a natural sugar alcohol, on tumor progression in syngeneic mouse cancer models. Xylitol has been known for its dental health benefits, but emerging evidence suggests broader biological roles, including potential anti-cancer properties. We explored xylitol's impact on two mouse cancer models: 4T1 mammary carcinoma and B16F10 melanoma. Xylitol's efficacy in inhibiting cancer cell lines and modulating tumor progression was assessed using immunocompetent female mice. The experiments involved intratumoral and peri-tumoral administration of a 20% xylitol solution in two mouse strains: BALB/c (4T1 mammary carcinoma) and C57BL/6 (B16F10 melanoma). Tumor volume, histopathology, and metabolomic analyses were conducted to gauge xylitol's influence. The study revealed that xylitol administration initially reduced tumor growth in the B16F10 melanoma model, accompanied by alterations in tumor metabolism. However, similar effects were not observed in the 4T1 mammary carcinoma model, and melanoma tumor growth re-commenced after stroma deterioration permitted xylitol solution leakage. These findings suggest that xylitol may have potential as an adjunct therapy in cancer treatment, specifically in melanoma. The differential response between the two cancer models underscores the complexity of cancer biology and the need for further investigation into xylitol's mechanisms of action and its role in cancer therapy.

Currently, obesity is a critical global public health burden. Numerous studies have demonstrated the regulation of the pathogenesis of obesity and metabolic abnormalities by the gut microbiota and microbial factors; however, their involvement in the various degrees of obesity is not yet understood well. Previously, obesity has been shown to be associated with decreased levels of vitamin B12. Considering exclusive microbial production of vitamin B12, we hypothesised that a decrease in cobalamin levels in obese individuals may be at least partially caused by its depleted production in the intestinal tract by the commensal microbiota. In the present study, our aim was to estimate the abundance of enzymes and metabolic pathways for vitamin B12 synthesis in the gut microbiota of mouse models of alimentary and genetically determined obesity, to evaluate the contribution of the obesogenic microbiome to vitamin B12 synthesis in the gut. We have defined a significantly lower representation of enzymes and metabolic pathways for vitamin B12 biosynthesis in obese mice compared to non-obese mice, wherein enzyme depletion was more pronounced in lepr(-/-) (db/db) mice, which developed severe obesity. The representation of enzymes involved in cobalamin synthesis is strongly correlated with representation of several microbes in high-fat diet fed mice, whereas there were almost no correlations in db/db mice. Therefore, the degree of obesity and the composition of the correspondent microbiota are the main contributors to the representation of genes and pathways for cobalamin biosynthesis in the mouse gut.

The speed-density or flow-density relationship is a fundamental aspect of traffic flow theory. Single-regime models often face challenges in consistently fitting empirical data under diverse traffic conditions. This paper addresses the inaccuracies of single-regime models, attributing them not only to their functional forms but also to data dispersion and sample selection bias. To mitigate these issues, the data is segmented into day and night periods, leading to the creation of separate models for each. Calibration results, conducted on data from two freeways, Tehran-Karaj and Tehran-Qom, reveal distinct challenges, with the former exhibiting high dispersion and the latter showing low dispersion. Surprisingly, single-regime models demonstrate notable effectiveness when applied to distinct day and night data. Further analysis, categorizing data into day and night, results in reduced errors (20-60% improvement in R-Square), emphasizing the potential for enhanced accuracy by considering distinct regimes. Overall, the study underscores the significance of regime-specific considerations for accurate traffic flow modeling. Upon thorough evaluation, the study highlights the superiority of the neural network Multi-layer Perceptron (MLP) over traditional models. The research discusses the implications of incorporating day and night parameters into the models, emphasizing their potential for accuracy enhancement.

EIMIs face the challenge of adapting to the Paris Agreement and the European Green Deal to achieve carbon neutrality. This change is being driven by consumer interest in low-carbon products, regulatory requirements from climate agreements and investors prioritizing sustainability. This pressure is pushing companies to go beyond short-term financial gains and integrate sustainability into their business. The growing awareness of the environmental impact of business models (BM) has fueled the development of Sustainable Business Models (SBMs). This study aims to link the discussion on the role of SBMs in the drivers of decarbonization, to improve the understanding of how the drivers can be integrated and enable new BMs for EIMIs. Based on a structured literature review, semi-structured interviews were conducted in the EIMIs. The study identifies BM-components that are influenced by these drivers and require sustainable business model innovation (SBMI). The results show that decarbonization drivers have a significant impact on all BM components. Experts emphasize the importance of collaborative approaches and cooperation throughout the value chain. This research elaborates on the importance of systematic analysis to understand how companies can effectively manage decarbonization drivers and suggests in-depth exploration within BM-research to uncover potential SBM design options.

Appropriate animal models of human diseases are a cornerstone in the advancement of science and medicine. To create animal models of neuropsychiatric and neurobehavioral diseases such as ASD necessitates the development of sufficient neurobehavioral measuring tools to translate human behavior to expected measurable behavioral features in animals. Indeed, at least in rodents, adequate neurobehavioral and neurological tests have been developed. Since ASD is characterized by a number of specific behavioral trends with significant severity, animal models of autistic-like behavior have to demonstrate the specific characteristic features, namely impaired social interactions, and communication, restricted, repetitive behavioral patterns with association to several additional impairments such as somatosensory, motor and memory impairments. Thus, an appropriate model must show behavioral impairment of a minimal number of neurobehavioral characteristics using an adequate number of behavioral tests. The proper animal models enable the study of ASD like-behavior from the etiologic, pathogenetic and therapeutic aspects. From the etiologic aspects, models have been developed by the use of immunogenic substances like polyinosinic-polycytidylic acid (PolyIC), Lipopolysaccharide (LPS) and propionic acid or other well-documented immunogens or pathogens, like mycobacterium tuberculosis. Another approach is the use of chemicals like valproic acid, Polychlorinated biphenyls (PCBs), organophosphate pesticides - chlorpyrifos (CPF) and others. These substances were administered either prenatally, generally after the period of major organogenesis, or, especially in rodents, during the early postnatal life. In addition, using modern genetic manipulation methods, genetic models have been created of almost all human genetic diseases that are manifested by autistic like behavior (i.e. fragile X, Rett syndrome, SHANK gene mutation Neuroligin genes and others). Ideally, we should not only evaluate the different behavioral modes affected by the ASD-like behavior but also assess the severity of the behavioral deviations by an appropriate scoring system, as applied to humans.

This study presents a groundbreaking approach in the field of gaming AI, focusing on the classic game” Pacman” through the lens of DRL integrated with advanced optimization techniques. The core of the research involves adapting DRL models for” Pacman”, utilizing the ESO for hyper- parameter tuning. These novel adaptations significantly enhance the AI agent’s performance, demonstrating a remarkable improvement in adaptability, responsiveness, and efficiency within the game environment. A pivotal aspect of this research is the innovative integration of metaheuristic optimization techniques into the DRL framework, a first in the domain of Atari gaming AI. This integration has proven essential in fine-tuning the DRL models, leading to a more effective and dynamic gaming experience. The study thoroughly evaluates and compares the performance of these algorithms, providing empirical support for their effectiveness and setting a new benchmark in AI-driven game development. The implications of this research extend beyond gaming AI, opening up possibilities for future exploration in several directions. Expanding DRL models to other complex gaming environments, continuous algorithmic enhancements, real-time learning adaptations, and applying these principles to robotics and autonomous vehicles are examples. The research also emphasizes ethical and responsible AI use in gaming to address fairness and addiction issues.

A review of quantitative risk assessment (QRA) models of L. monocytogenes in produce was carried out, with the objective of appraising and contrasting the effectiveness of the control strategies placed along the food chains. Despite nine of the thirteen QRA models recovered focused on fresh or RTE leafy greens, none of them represented important factors or sources of contamination in the primary production, such as type of cultivation, water, fertilisers or irrigation method/practices. Cross-contamination at processing and during consumer’s handling was modelled using transfer rates, which were shown to moderately drive the final risk of listeriosis; highlighting therefore the importance of accurately representing the transfer coefficient parameters. Many QRA models coincided in the fact that temperature fluctuations at retail or temperature abuse at home were key factors contributing to increasing the risk of listeriosis. In addition to a primary module that could help assess current on-farm practices and potential control measures, future QRA models for minimally-processed produce should also contain a refined sanitisation module able to estimate the effectiveness of various sanitisers as a function of type, concentration and exposure time. Finally, L. monocytogenes growth in the products down the supply chain should be estimated by using realistic time-temperature trajectories, and validated microbial kinetic parameters, both of them currently available in the literature.

Due to the increasing use of computer equipment, institutions and companies face challenges, such as sensitive data leaks and the spread of hate speech, which have severe consequences for organizations and their employees. Addressing these challenges is essential to avoid financial losses, reputational damage, and impacts on the psychological health of those involved. This paper presents a solution based on microservices for monitoring computers used by employees in organizations, including capturing information from the equipment using spyware techniques and a web application for managing alerts. The solution seeks to detect data leaks, suspicious behaviour, and hate speech. The results of the evaluation indicate that the proposed solution has an efficient data capture time and can identify unwanted behaviour in a short period. The solution also includes applying prediction models to detect hate speech, achieving an average accuracy of approximately 87%. The performance, scalability, and security evaluation demonstrate that the solution is suitable for dealing with data leakage and hate speech challenges in the corporate environment.

Count data analysis presents unique challenges due to its discrete nature, often exhibiting excessive zeros and overdispersion. To address these complexities, count models, such as Poisson regression and Negative Binomial regression, have been developed, enabling modeling and prediction of count-based phenomena. Additionally, it’s important to notice that zero inflation, a phenomenon commonly observed in count data, requires specialized techniques for robust analysis. This article provides an overview of count data and count models, explores zero inflation, introduces Likelihood Ratio Tests, and explains how the Vuong Test can be used as a model selection criteria. Furthermore, we created a Vuong Test implementation from scratch using the Python programming language. This implementation enhances the accessibility and applicability of the Vuong Test in real-world scenarios, providing a valuable contribution to the academic community, since Python didn’t have an implementation of this statistical test.

When dealing with limited sample sizes or missing values in time series data, achieving high accuracy in forecasting becomes challenging. This challenge is particularly common in wind energy forecasting, where many wind farms lack complete data. In this paper, we employ the widely-used ARIMA (Autoregressive Integrated Moving Average) model for time series forecasting. To address the difficulties posed by limited sample sizes and missing values, we adopt a unique approach by utilizing multiple ARIMA models for different datasets. A key distinction from other multiple models methods for time series forecasting lies in each model within our approach using its own dataset, making the fusion process more intricate. To overcome this, we incorporate neural networks and two techniques for model fusion: direct fusion with a learning mechanism and compensation for missing data through training. For each ARIMA model, we introduce a noise estimation method to circumvent the white noise assumptions inherent in ARIMA models. Finally, we apply these methods to wind energy prediction, and our experimental results showcase a significant enhancement in forecasting accuracy.

Glycogen storage disease type III (GSDIII) is a hereditary glycogenosis caused by deficiency of the glycogen debranching enzyme (GDE), an enzyme, encoded by Agl, enabling glycogen degradation by catalyzing alpha-1,4-oligosaccharide side chain transfer and alpha-1,6-glucose cleavage. GDE deficiency causes accumulation of phosphorylase-limited dextrin, leading to liver disorder followed by fatal myopathy. We tested here the capacity of the new autophagosomal activator GHF-201 to alleviate disease burden by clearing pathogenic glycogen surcharge in the GSDIII mouse model Agl-/-. We used open field, grip strength and rotarod tests for evaluating GHF-201’s effects on locomotion, biochemistry panel to quantify hematological biomarkers, indirect calorimetry to quantify in vivo metabolism, transmission electron microscopy to quantify glycogen in muscle, and fibroblast image analysis to determine cellular features affected by GHF-201. GHF-201 was able to improve all locomotion parameters and partially reversed hypoglycemia, hyperlipidemia and liver and muscle malfunction in Agl-/- mice. Treated mice burnt carbohydrates more efficiently and showed significant improvement of aberrant ultrastructural muscle features. In GSDIII patient fibroblasts, GHF-201 restored mitochondrial membrane polarization and corrected lysosomal swelling. In conclusion, GHF-201 is a viable candidate for treating GSDIII as it recovered a wide range of its pathologies in vivo, in vitro, and ex vivo.

Recessive dystrophic epidermolysis bullosa (RDEB) is a rare severe hereditary skin disease characterized by skin and mucosa fragility, resulting in blister formation. The most severe complication in RDEB patients is the development of cutaneous squamous cell carcinoma (SCC) leading to premature death. Multiple evidences suggest a permissive tumor micro-environment (TME) as driver of SCC development in RDEB patients. In a cohort of RDEB patients, we characterized the immune profiles of RDEB-SCCs and compared them with clinical, histopathological, and prognostic features. RDEB-SCCs were subdivided into 4 groups based on their occurrence (first onset or recurrences) and grading according to their clinical-histopathological parameters of aggressiveness. Thirty-eight SCCs from 20 RDEB patients were analysed. Five RDEB patients experienced an unfavorable course af-ter the diagnosis of the first SCC, with early recurrence or metastasis, whereas 15 pa-tients developed multiple SCCs without metastasis. High-risk primary RDEB-SCCs showed a higher neutrophil-to-lymphocyte ratio in the tumor microenvironment, and an increased proportion of neutrophil extracellular traps (NET). Additionally, citrullinated histone H3, a marker of NETs, was increased in the serum of RDEB patients with high-risk primary SCC, suggesting that this modified form of histone H3 may serve as a potential blood marker of unfavorable prognosis in RDEB-SCCs.

The accurate forecasting of solar power output is essential for ensuring the stable and efficient operation of grid-connected photovoltaic (PV) systems, especially when faced with variable weather patterns. This research focuses on the integration of Machine Learning (ML) methodologies and climatic parameters to predict solar panel energy generation, with a specific emphasis on addressing consumption-production imbalances. Leveraging a dataset sourced from the Kaggle platform, the study is conducted in the context of Estonia, aiming to optimize solar energy utilization in this geographic region. The dataset, obtained from Kaggle, encompasses comprehensive information on climatic variables, including sunlight intensity, temperature, and humidity, alongside corresponding solar panel energy output. Leveraging machine learning algorithms, including XGBoost regression and neural networks, our model aims to identify complex patterns and relationships within the datasets. By tailoring the model to Estonia's climatic nuances, we seek to enhance the accuracy of energy production forecasts and, consequently, better manage the challenges associated with consumption-production imbalances. Furthermore, the research investigates the adaptability of the proposed model to diverse climatic conditions, ensuring its applicability for similar endeavors in other geographical locations. The performance of the forecasting model will be evaluated using error metrics like mean absolute error (MAE) and root mean squared error (RMSE). This study leverages a comprehensive dataset from Kaggle and utilizes advanced machine learning techniques to generate valuable insights. These insights can inform the development of sustainable energy policies and practices, ultimately leading to a more efficient and reliable renewable energy infrastructure.

This paper analyzes and compares models for predicting average magnet losses in interior permanent-magnet motors with fractional-slot concentrated windings due to harmonics in the armature reaction (assuming sinusoidal phase currents). Particularly, loss models adopting different formulations and solutions to the Helmholtz equation to solve for the eddy currents are compared to a simpler model relying on an assumed eddy-current distribution. Boundaries in terms of magnet dimensions and angular frequency are identified (numerically and using an identified approximate analytical expression) to aid the machine designer whether the more simple loss model is applicable or not. The assumption of a uniform flux-density variation (used in the loss models) is also investigated for the case of V-shaped and straight interior permanent magnets. Finally, predicted volumetric loss densities are exemplified for combinations of slot and pole numbers common in automotive applications.

Natural language Processing (NLP) has significantly transformed in the last decade, especially in the field of Language Modeling. Large Language Models (LLMs) have achieved SOTA performances on Natural Language Understanding (NLU) and Natural Language Generation (NLG) tasks by learning language representation in self-supervised ways. This paper provides a comprehensive survey to capture the progression of advances in Language Models. In this paper, we examine the different aspects of Language Models, which started with a few million parameters but have reached the size of a trillion in a very short time. We also look at how these LLMs transitioned from task-specific to task-independent to task-and-language-independent architectures. This paper extensively discusses different pre-training objectives, benchmarks, and transfer learning methods used in LLMs. It also examines different fine-tuning and In-Context learning techniques used in downstream tasks. It also explores how LLMs can perform well across many domains and datasets if sufficiently trained on a large and diverse dataset. Next, it discusses how, over time, the availability of cheap computational power and large datasets have improved LLM’s capabilities and raised new challenges. As part of our study, we also inspect LLMs from the lens of scalability to see how their performance is affected by the model’s depth, width, and data size. Lastly, we provide an empirical comparison of existing trends and techniques and a comprehensive analysis of where the field of LLM currently stand.

This paper is aimed at studying the temporal evolution of the surface displacements occurred over the past few years in the ocean-reclaimed platforms of the Shanghai megacity (China), which are mainly ascribable to consolidation processes of large dredger fills and alluvial deposits. With respect to previous analyses carried out over the same area, this work provides a joint multi-platform differential interferometry synthetic aperture radar (DInSAR) analysis, based on the application of the advanced Small BAseline Subset (SBAS) algorithm. This led us to retrieve long-term deformation time-series that are helpful for a better understanding of the on-going deformation phenomena. To this aim, we have exploited two sequences of SAR data collected by the ASAR/ENVISAT and by the COSMO-SkyMed (CSK) sensors, respectively, spanning the whole time period from 2007 to 2016. Unfortunately, the large time gap (of about three years) existing between the available ASAR/ENVISAT and CSK datasets gave rise to additional difficulties for their combination. Nevertheless, this problem has been faced by benefiting from the knowledge of a time-dependent model describing the temporal evolution of the expected deformations affecting the Shanghai ocean-reclaimed platforms.

Pericentromeric regions of chromosomes enriched in tandemly repeated satellite DNA although representing a significant part of eukaryotic genomes are still understudied mainly due to interdisciplinary knowledge gaps. Recent studies suggest their important role in genome regulation, karyotype stability and evolution. Thus, the idea of satellite DNA as a junk part of the genome was refuted. Integration of data about molecular composition, chromosome behaviour and details of in situ organization of pericentromeric regions is of great interest. The objective of this work was a cytogenetic analysis of the interactions of pericentromeric regions non-homologous chromosomes in mouse spermatocytes using immuno-FISH. We analysed two events: the associations between cerntomeric regions of X chromosome and autosomes, and associations between centromeric regions of autosomal bivalents forming chromocenters. We conclude that X chromosome form temporary synaptic associations with different autosomes in early meiotic prophase I which normally can be found at pachytene-diplotene without signs of pachytene arrest. These associations are formed between the satellite DNA-enriched centomeric regions of X chromosome and different autosomes but not involve the satellite-poor centromeric region of Y-chromosome. We suggest the mechanism of X chromosome competitive replacement from such associations during synaptic correction. We showed that centromeric region of the X chromosome remains free of γH2Ax-dependent chromatin inactivation, while Y chromosome is completely inactivated. This findings highlights the predominant role of associations between satellite DNA-enriched regions of different chromosomes including X. We assume that X-autosome temporary associations is a manifestation of an additional synaptic disorders checkpoint. These associations are normally corrected before the late diplotene. We revealed that the intense spreading conditions applied to the spermatocytes I nuclei did not lead to destruction of stretched chromatin fibers i.e. elongated chromocenters enriched in satellite DNA. Revealed by us tight associations between pericentromeric regions of different autosomal bivalents and X chromosome may represent the basis for repeat stability maintenance in autosomes an X chromosome. The consequences of our findings are discussed. We obtained the preparations of mouse spermatocytes nuclei in the meiotic prophase I using two approaches: standard and extremely intense surface spread techniques. Using immuno-FISH we visualized tandemly repeated mouse Major and Minor satellite DNA located in the pericentromeric regions of chromosomes and performed a morphological comparison of the standard- and intensely spreaded meiotic nuclei. Based on our results, we assume the remarkable strength of the chromocenter-mediated associations, “chromatin “bridges”, between different bivalents at the pachytene and diplotene stages. We have demonstrated that the chromocenter “bridges” between the centromeric ends of meiotic bivalents are enriched in both tandemly repeated Major and Minor satellite DNA. Association of centromeric regions of autosomal bivalents and X-chromosome but not with Y-chromosome correlates with the absence of Major and Minor satellites on Y-chromosome. We suggest that revealed tight associations between pericentromeric regions of bivalents may represent the network-like system providing dynamic stability of chromosomal territories, as well as add new data for the hypothesis of ectopic recombination in these regions which supports sequence homogeneity between non-homologous chromosomes and does not contradict the meiotic restrictions imposed by the crossing-over interference near centromeres. We conclude that nuclear architecture in meio-sis may play an essential role in contacts between the non-homologous chromosomes providing the specific characteristics of pericentromeric DNA.

Methionine 77 in calmodulin can be stereospecifically oxidized to methionine sulfoxide by mammalian methionine sulfoxide reductase A. Whether this has in vivo significance is unknown. We therefore created a mutant mouse in which wild-type calmodulin-1 was replaced by a calmodulin containing a mimic of methionine sulfoxide at residue 77. Total calmodulin levels were unchanged in the homozygous M77Q mutant, which is viable and fertile. No differences were observed on learning tests, including the Morris water maze and associative learning. Cardiac stress test results were also the same for mutant and wild type mice. .However, young male and female mice were 20% smaller than wild type mice, although food intake was normal for their weight. Young M77Q mice were notably more active and exploratory than wild type mice. This behavior difference was objectively documented on the treadmill and open field tests. The mutant mice ran 20% longer on the treadmill than controls, and in the open field test, the mutant mice explored more than controls and exhibited reduced anxiety These phenotypic differences bore a similarity to those observed in mice lacking calcium/calmodulin kinase Iiα (CaMKIIα). We then showed that M77Q calmodulin was less effective in activating CaMKIIα than wild type calmodulin. Thus, characterization of the phenotype of a mouse expressing a constitutively active mimic of calmodulin led to the identification of the first calmodulin target that can be differentially regulated by the oxidation state of Met77. We conclude that reversible oxidation of methionine 77 in calmodulin by MSRA can regulate cellular function.

Aggregation of the protein α-Synuclein (αSyn) is a hallmark of Parkinson's disease (PD), dementia with Lewy bodies (DLB) and multiple systems atrophy, and alleviating the extent of αSyn pathology is an attractive strategy against neurodegeneration. The engineered binding protein β-wrapin AS69 binds monomeric αSyn. AS69 reduces primary and secondary nucleation as well as fibril elongation in vitro. It also mitigates aSyn pathology in a mouse model based on intrastriatal injection of aSyn pre-formed fibrils (PFF). Since the PFF-based model does not represent all aspects of PD, we tested here whether AS69 can reduce neurodegeneration resulting from αSyn overexpression. Human A53T-αSyn was overexpressed in the mouse Substantia nigra (SN) by using recombinant adeno-associated viral vector (rAAV). AS69 was also expressed by rAAV transduction. Behavioral tests and immunofluorescence stainings were used as outcomes.Transduction with rAAV-αSyn resulted in αSyn pathology as reported by phospho-αSyn staining and caused degeneration of dopaminergic neurons in the SN. The co-expression of rAAV-AS69 did not reduce αSyn pathology or degeneration of dopaminergic neurons. We conclude that αSyn monomer binding by rAAV-AS69 was insufficient to protect from aSyn pathology resulting from αSyn overexpression.

With the rapid growth of large language models (LLMs), there is increasing demand for memory and computation in LLMs. Recent efforts on post-training pruning of LLMs aim to reduce the model size and computation requirements, yet the performance is still sub-optimal. In this paper, we present a plug-and-play solution for post-training pruning of LLMs. The proposed solution has two innovative components: 1) Relative Importance and Activations (RIA), a new pruning metric that jointly considers the weight and activations efficiently on LLMs; and 2) Channel Permutation, a new approach to maximally preserve important weights under N:M sparsity. The two proposed components can be readily combined to further enhance the N:M semi-structured pruning of LLMs. Our empirical experiments show that RIA alone can already surpass all existing post-training pruning methods on prevalent LLMs, e.g., LLaMA ranging from 7B to 65B. Furthermore, N:M semi-structured pruning with channel permutation can even outperform the original LLaMA2-70B on zero-shot tasks, together with practical speed-up on specific hardware. Our code is available at: https://github.com/biomedical-cybernetics/Relative-importance-and-activation-pruning

As the educational landscape evolves, understanding and fostering student adaptability has become increasingly critical. This study presents a comparative analysis of (XAI) techniques to interpret machine learning models aimed at classifying student adaptability levels. Leveraging a robust dataset, we employed several machine learning algorithms with a particular focus on Random Forest, which demonstrated a 91% accuracy. Our study utilizes (SHAP), (LIME), Anchors, (ALE), and counterfactual explanations to reveal the specific contributions of various features impacting adaptability predictions. Consistently, 'Class Duration' and 'Financial Condition' emerge as key factors, while the study also underscores the subtle effects of 'Institution Type' and 'Load-shedding'. This multi-faceted interpretability approach bridges the gap between machine learning performance and educational relevance, presenting a model that not only predicts but also explains the dynamic factors influencing student adaptability. The synthesized insights advocate for educational policies accommodating socioeconomic factors, instructional time, and infrastructure stability to enhance student adaptability. The implications extend to informed and personalized educational interventions, fostering an adaptable learning environment. This methodical research contributes to responsible AI application in education, promoting predictive and interpretable models for equitable and effective educational strategies.

1) Background: Impeded resolution of inflammation contributes substantially to the pathogenesis of Alzheimer's disease (AD); consequently, resolving inflammation is pivotal to the amelioration of AD pathology. This can potentially be achieved by the treatment with specialized pro-resolving lipid mediators (SPMs), which should resolve neuroinflammation in brains. 2) Methods: Here, we report the effects of long-term treatment with a SPM, maresin like 1 (MarL1), on AD pathogenesis in a transgenic 5xFAD mouse model. 3) Results: MarL1 treatment reduced Aβ overload, curbed the loss of neurons in brains especially cholinergic neurons associated with cleaved-caspase-3-associated apoptotic degeneration, reduced astrogliosis and microgliosis and the pro-inflammatory M1 polarization of microglia, curbed the AD-associated decline in an-ti-inflammatory Iba1+Arg-1+-M2 microglia, reduced astrogliosis-associated level of neuroin-flammatory TNF-α, inhibited phenotype switching of pro-inflammatory neurotoxic A1 astrocytes and N1 neutrophils, promoted polarization of inflammation-resolving neuroprotective A2 as-trocytes, promoted the blood–brain-barrier-associated tight-junction protein claudin-5 and de-creased neutrophil leakage in 5xFAD brains, and induced the switch of neutrophils toward the inflammation-resolving N2 phenotype. 4) Conclusion: Long-term administration of MarL1 mit-igates AD-related neuropathogenesis in brains by curbing neuroinflammation and neurodegen-eration. These findings provided the preclinical leads and mechanistic insights for the develop-ment of MarL1 into an effective modality to ameliorate AD pathogenesis.

Effective agricultural management in maize production operations starts with the early quantification of seedlings. Accurately determining plant presence allows growers to optimize planting density, allocate resources, and detect potential growth issues early on. This study presents an in-depth analysis of multiple object detection models used by drones to count maize seedlings, while concurrently investigating the influence of planting density, flight altitude, and plant growth stage. The findings of this study demonstrate that one-stage models are able to more accurately detect maize seedlings than two-stage models. In particular, YOLOv8n exhibits outstanding performance, achieving an F1-score of over 0.92 under various density conditions and maintaining a stable performance, especially under densities below 105,000 plants/ha. Additionally, planting density and growth stage were observed to significantly affect detection accuracy, with performance declining as density and growth stage increased. Image resolution and detection were impacted by flight altitude, with lower flights producing higher-quality results. Ultimately, YOLOv8n displays optimal performance under various conditions, providing crucial data to support intelligent decision-making. This research offers valuable insights into the application of object detection technology and provides a basis for the future development of precision agriculture.

Although researchers have proposed various indentation size effect (ISE) models, these models often involve different form and number of parameters that can make our wonder which is the best in existed ISE models. Three types of ISE test data, namely, normal ISE, reverse ISE and transition of normal to reverse ISE, are used to evaluate the sixteen ISE models. The comparatively study indicates that H-J, N-G-Fs, N-G-H, N-G-A and N-G-Qs models can accurately predict the normal ISE. The reason for this is that the friction stress that is not related to dislocation activities or the indentation size effect of plastic zone has been introduced into these models. Therefore, these two factors should be considered in future ISE models. The sixteen ISE models are originally proposed to describe the normal ISE of different materials. However, to our surprise, some of these models are able to capture the reverse ISE and the transition of normal to reverse ISE of different materials. The determination coefficients (DC) of the sixteen ISE models are also determined for different materials. For reverse ISE, the highest DC value for NiCSi, TC4 and PED Ni are given by the EXP, N-G-Fs and N-G-A models, respectively. For the transition of normal to reverse ISE, the N-G-YC, N-G-Fs, and N-G-H models produce the maximum DC for ZrO2, Cu and Y2O3-ZrO2, respectively. Moreover, the mean DC of the N-G-Fs model is the maximum among the sixteen ISE models, followed by the N-G-H model, but they cannot accurately predict the reverse ISE. Therefore, the N-G-Fs and N-G-H models should be further modified to accurately predict the reverse ISE.

This study investigated the effects of silibinin, derived from milk thistle (Silybum marianum), on lipopolysaccharide (LPS)-induced morphological changes in mouse macrophages. Silibinin was treated at various doses and time points to assess its effects on macrophage activation including morphological changes and phagocytosis. Silibinin effectively inhibited LPS-induced pseudopodia formation and size increase, while unstimulated cells remained round. Silibinin's impact on phagocytosis was dose- and time-dependent, showing a decrease. We explored its mechanism of action on kinases using a MAPK array. Among the three MAPK family members tested, silibinin had a limited effect on JNK and p38 but significantly inhibited ERK1/2 and related RSK1/2. Silibinin also inhibited MKK6, AKT3, MSK2, p70S6K, and GSK-3β. These findings highlight silibinin's potent inhibitory effects on phagocytosis and morphological changes in macrophages. We suggest its potential as an anti-inflammatory agent due to its ability to target key inflammatory pathways involving ERK1/2 and related kinases. Overall, this study demonstrates the promising therapeutic properties of silibinin in modulating macrophage function and inflammation.

The circadian clock regulates daily changes in behavioral, endocrine and metabolic activities in mammals. Circadian rhythms in cellular physiology are significantly affected by aging. In particular, we previously found that aging has profound impact on daily rhythms in mitochondrial functions, leading to increased oxidative stress. However, this is unlikely due to malfunction of molecular clocks in the suprachiasmatic nucleus or peripheral tissues, as robust clock oscillations are observed therein in old animals. Nonetheless, aging induces changes in gene expression levels and rhythms in various peripheral and probably central tissues. In this article, we review findings on the roles of the circadian clock and aging in regulating mitochondrial rhythms and redox homeostasis. Chronic sterile inflammation is implicated in mitochondrial dysfunction and increased oxidative stress during aging. In particular, upregulation of CD38 by inflammatory response can disturb mitochondrial functions in multiple ways.

There is evidence that spaceflight poses acute and late risks on the central nervous system. To explore possible mechanisms, the proteomic changes following spaceflight in mouse brain were characterized. Space Shuttle Atlantis (STS-135) was launched at the Kennedy Space Center on a 13-day mission. Within 3–5 hours after landing, brain tissue was collected to evaluate protein expression profiles using quantitative proteomic analysis. Our results showed that there were 26 proteins that were significantly altered after spaceflight in the grey and/or white matter. While there was no overlap between the white and grey matter in terms of individual proteins, there was overlap in terms of function, synaptic plasticity, vesical activity, protein/organelle transport, and metabolism. Our data demonstrate that exposure to the spaceflight environment induces significant changes in protein expression related to neuronal structure and metabolic function. This might lead to a significant impact on brain structural and functional integrity that could affect the outcome of space missions.

Herein, we examined the effects of weather parameters and individual clinicodemographic risk factors on hemorrhagic stroke (HS) incidence, severity on admission, and disability at discharge in a harsh desert climate. In a retrospective design we studied patients admitted to a stroke unit in Arab Emirates in 2016-2019. With a distributed lag nonlinear model we explored immediate and delayed effects of weather on stroke incidence. Supervised machine learning was used to build models predictive of scores in NIHSS and mRS scales. We assessed model performance by calculating ROC AUC, F1 scores, specificity, and sensitivity. HS risk increased after a significant change in any weather parameter. The risk was reduced below baseline after 1-week adjustment to environmental changes. Climate input from the previous 3 days yielded reliable classification models. Humidex was a better predictor of severity than air temperature, whereas body mass index, age, and time of day at stroke onset were the strongest clinical predictors. Weather parameters before admission were stronger predictors of disease severity than individual clinical factors. We addressed limitations of previous studies by analyzing a full set of climate parameters: ambient temperature, relative humidity, humidex, atmospheric pressure, and wind speed. Predictive models may help to optimize patient management and develop preventative strategies.

In the sphere of urban renewal in historic districts, preserving and innovatively reinterpreting traditional architectural styles remains a primary research focus. However, the modernization and adaptive reuse of traditional buildings often necessitate changes in their functionality. To cater to the demands of tourism in historic districts, many traditional residential buildings require conversion to commercial use, resulting in a mismatch between their external form and internal function. This study explores an automated approach to transform traditional residences into commercially viable designs, offering an efficient and scalable solution for the modernization of historic architecture. We developed a methodology based on diffusion models, focusing on a dataset of nighttime shopfront facades. By training a Low-Rank adaptation (LoRA) model and integrating the ControlNet model, we enhanced the accuracy and stability of generated images. The methodology’s performance was validated through qualitative and quantitative assessments, optimizing batch size, repetition, and learning rate configurations. These evaluations confirmed the method’s effectiveness. Our findings significantly advance the modern commercial style transformation of historical architectural facades, providing a novel solution that maintains aesthetic and functional integrity, thereby fostering breakthroughs in traditional de-sign thinking and exploring new possibilities for the preservation and commercial adaptation of historical buildings.