We prove an analog of the removable singularity theorem for bounded harmonic functions on stratified sets. The harmonic functions are understood in the sense of the soft Laplacian. The result can become one of the main technical components for extending the well-known Poincaré–Perron’s method of proving the solvability of the Dirichlet problem for the soft Laplacian.

This study extends the CGAN-based MODIS cloud vertical-profile (64×64-scene, about 70km width×15km height) retrieval technique developed by Leinonen et al. (2019) [1] to construct seamless 3D cloud fields for the MODIS granules [2]. Firstly, the accuracy and spatial continuity of the Leinonen et al. [1] retrievals are statistically evaluated. Then, according to the characteristics of the retrieval error, a spatially overlapping-scene ensemble generation method and a bi-directional Ensemble Binning Probability Fusion (CGAN-BEBPF) technique are developed, which improves the CGAN retrieval accuracy and support to construct seamless 3D clouds. The CGAN-BEBPF technique involves three steps: cloud masking, intensity scaling, and optimal value selection. It ensures adequate coverage of the low reflectivity areas while preserving the high reflectivity cloud cores. The technique is applied to retrieve the 3D cloud fields of Typhoon Chaba and a multi-cell convective system. The cloud structures of the CGAN-BEBPF results are highly consistent with the ground-based radar observations. It can retrieve weak clouds at the top levels of convective storms and hurricanes that were missed by ground-based radars and fill the gaps of the ground-based radar lower-level PPI scan. Overall, CGAN-BEBPF can be automated to retrieve the rich informative 3D structures of typhoons and severe convective systems over the oceans along the MODIS swath, which certainly presents great value for improving maritime and near-shore typhoons and convection prediction and other cloud-sensitive applications.

Estimating ground surface PM2.5 with fine spatiotemporal resolution is a critical technique for exposure assessments in epidemiological studies of its health risks. Previous studies have utilized monitoring, satellite remote sensing or air quality modeling data to evaluate the spatiotemporal variations of PM2.5 concentrations, but such studies rarely combined these data simultaneously. We develop a three-stage model to fuse PM2.5 monitoring data, satellite-derived aerosol optical depth (AOD) and community multi-scale air quality (CMAQ) simulations together and apply it to estimate daily PM2.5 at a spatial resolution of 0.1˚ over China. Performance of the three-stage model is evaluated using a cross-validation (CV) method step by step. CV results show that the finally fused estimator of PM2.5 is in good agreement with the observational data (RMSE = 23.00 μg/m^3 and R2 = 0.72) and outperforms either AOD-retrieved PM2.5 (R2 = 0.62) or CMAQ simulations (R2 = 0.51). According to step-specific CVs, in data fusion, AOD-retrieved PM2.5 plays a key role to reduce mean bias, whereas CMAQ provides all-spacetime-covered predictions, which avoids sampling bias caused by non-random incompleteness in satellite-derived AOD. Our fused products are more capable than either CMAQ simulations or AOD-based estimates in characterizing the polluting procedure during haze episodes and thus can support both chronic and acute exposure assessments of ambient PM2.5. Based on the products, averaged concentration of annual exposure to PM2.5 was 55.75 μg/m3, while averaged count of polluted days (PM2.5 > 75 μg/m3) was 81, across China during 2014. Fused estimates will be publicly available for future health-related studies.

This paper is devoted to the study of multi-dimensional integral transform with Fox H-function in the kernel in weighted spaces integrable functions in the domain R+n with positive coordinates. Mapping properties such as the boundedness, the range, the representations of the considered transformation are established.

Conditions under which compositions of component systems form a well-defined system-of-systems here are formulated at a fundamental level. Statement of what defines a well-defined composition and sufficient conditions guaranteeing such a result offers insight into exemplars that can be found in special cases such as differential equation and discrete event systems. For any given global state of a composition, two requirements can be stated informally as: 1) the system can leave this state, i.e., there is at least one trajectory defined that starts from the state, and 2) the trajectory evolves over time without getting stuck at a point in time. Considered for every global state, these conditions determine whether the resultant is a well-defined system and if so, whether it is non-deterministic or deterministic. We formulate these questions within the framework of iterative specifications for mathematical system models that are shown to be behaviorally equivalent to the Discrete Event System Specification (DEVS) formalism. This formalization supports definitions and proofs of the afore-mentioned conditions. Implications are drawn at the fundamental level of existence where the emergence of a system from an assemblage of components can be characterized. We focus on systems with feedback coupling where existence and uniqueness of solutions is problematic.

In this paper we describe a method which combines sentiment analysis with machine learning techniques and/or multivariate statistical analysis. By applying this methodology it is possible to classify a collection of texts into two or more groups or clusters. On the basis of a number of previously defined clusters, the novelty of the outlined approach is the use of the sentiment analysis results as input to the machine learning model or multivariate statistical analysis. Once the classifier has been obtained, we can assign a given text into one of the pre-established clusters. The groups or clusters can represent different time periods, classes of texts transcribed from different conversations, etc. The method is illustrated through an example taken from one of the two studies in which we have applied this methodology. In one of the studies, the method was used to classify press news of a volcanic eruption, while in the other study it was used to classify the conversations recorded between a chatbot with different kinds of speakers (humans or chatbots). This last study was the seminal work in which we introduced this methodology.

The development of accurate dynamic battery pack models for electric vehicles (EVs) is critical for the ongoing electrification of the global automotive vehicle fleet, since these serve as a key element in the energy performance of an EV powertrain system. The Equivalent Circuit Model (ECM) technique at the cell level is commonly employed for this purpose, combining accuracy and efficiency in the representation of battery operation within the broader powertrain system. In this study, a second-order ECM model of a battery cell is being developed using Modelica, an equation-based modeling language. Parameter lookup tables at multiple levels of state of charge (SoC), extracted from Li-ion battery cells with 4 different commonly used cathode materials, have been utilized. This approach allows for a representation of the battery systems that are used in a wide range of commercial EV applications. To verify the model, an integrated EV model is developed and simulation results of the FTP75 driving cycle have been compared against an equivalent application in MATLAB Simulink. The findings demonstrate a close match between the results obtained from both software across different system points. Specifically, the maximum deviation of SoC is limited to 0.08% and the maximum value of relative voltage deviation is 1.4%. The verified model enables the exploration of multiple possible architecture configurations of EV powertrains with Modelica.

The main contribution of this paper is to develop a graphical tool to evaluate the suitability of a candidate parametric model to fit a data set. The practical motivation is to check the adequacy of the so called SAINT model proposed in Jarner and Kryger (2011). This model has been implemented in practice by an important European pension fund concerned with setting annuity reserves for all current or former employees of Denmark. So, one particular relevant question is whether this mortality model is actually fitting old-age. Our graphical test can be described as follows. First we transform the data by means of the parametric model which is being evaluated. Should the model be correct, the transformed data will be in accordance with an Exponential distribution with rate 1. Then we construct a family of local linear hazard estimates based on the data on the transformed scale. Finally we use the statistical tool SiZer to assess the goodness-of-fit of the Exponential distribution to the data on the transformed scale. If the model is correct the SiZer map should not reveal any significant feature in the family of kernel estimates. Our method allow us to establish a diagnostic regarding the validity of the SAINT model when describing mortality patterns in four different countries.

Alzheimer’s disease (AD) poses a significant public health challenge due to its irreversible and progressive nature while lack of a cure. As a potential strategy to combat AD, its prevention becomes increasingly attractive. Mild Cognitive Impairment due to AD (MCI-AD) represents a critical transitional stage between normal age-related cognitive decline and more severe AD conditions, occurring just before dementia onset. Unfortunately, there is currently no established animal model that accurately recapitulates MCI-AD characteristics. While many laboratories have traditionally used normally aged wild-type animals as experimental models, this approach falls short in representing the inherently worse state of MCI-AD compared to normal aging. To address this gap, we introduce an animal model—a transgenic mouse line with genetic inactivation of G protein-coupled receptor kinase-5 (GRK5), commonly known as the GRK5 knockout (GRK5KO) mouse. These GRK5KO mice exhibit amnesia, cognitive deficits, increased β-amyloid levels, neurofibrillary tangle (NFT) immunopositive axonopathy, and hippocampal neurodegenerative changes. Importantly, these pathological alterations predominantly impact the entorhinal, transentorhinal, and hippocampal cortices, aligning with human MCI-AD criteria and Braak stage II of human AD progression. Notably, female GRK5KO mice show approximately 2.5 times more NFT-positive axonopathy than males, mirroring the higher prevalence of AD cases in women. Collectively, existing data strongly supports the GRK5KO mouse as a qualified animal model for studying MCI-AD.

Mechanical properties of cardiomyocytes from different transmural regions are heterogeneous in the left ventricular wall. The cardiomyocyte mechanical environment affects this heterogeneity because of mechano-electric feedback mechanisms. In the present study, we investigated the effects of load upon transmural differences in contraction of subendocardial (ENDO) and subepicardial (EPI) single cells isolated from the murine left ventricle. Various loads were applied to the cells using carbon fiber techniques for single myocytes. To simulate experimentally obtained results and to predict mechanisms underlying the cellular response to change in load, our mathematical models of the ENDO and EPI cells were used. Extent of the transmural gradient in the time course of contractions was independent of the loading conditions where unloaded and heavy loaded (isometric) contractions were examined, but the regional gradient of the relaxation time characteristics tended to decrease when the load decreased. Under auxotonic contractions, time to peak contraction (T_max) was significantly longer in ENDO cells than in EPI cells at low preload. An increase in preload (axial stretch) prolonged T_max in both cell types; however, the prolongation was greater in EPI cells, resulting in a decrease in transmural gradient in T_max at high preload. The [Ca²⁺]_i transient decay time constant was consistent with the greater preload dependency in T_max of EPI cells. Our modified mathematical models reproduced experimental results, suggesting that differences in cooperativity of cross bridges and calcium troponin C complex interactions between the ENDO and EPI cardiomyocytes may contribute to the different cellular responses to stretch, which may provide a decrease in transmural dispersion of cellular shortening in the intact heart.

Previously, we described a 19-base pair double-stranded RNA with 3'-trinucleotide overhangs, acting as immunostimulatory RNA (isRNA). This molecule demonstrated notable antiproliferative effects on cancer cells, inhibited tumor growth, and elicited immunostimulatory and antiviral responses by inducing cytokine and interferon production. Within this study, we compared the efficiency of lung fibrosis development, initiated in mice by BLM or LPS using different schemes of induction. Then we compared the effect of isRNA used in a preventive or therapeutic regimen on the development of fibrosis in selected BLM- and LPS-induced mouse models and showed that isRNA can be used in pathological conditions accompanied by the development of inflammation and the risk of fibrosis formation, without adverse side effects. Prophylactic regimen of isRNA application is beneficial for prevention of the development of pulmonary fibrosis.

The enhancement of early diagnosis of lung cancer is mandatory to improve prognosis. We observed the increase cancer stem cells (CSC) and circulating tumor cells (CTC) in blood of mice on d3 after Lewis lung carcinoma (LLC) cell implantation before disease symptom. Besides we have developed an approach to reprogramming immune cells by inhibiting the MAPK/ERK pathway through MEKi and the PD-1/PD-L1 immune checkpoint signaling pathway. We hypothesized that reprogramming of spleen CD8+ T-cells could also create a population of immune cells with high antitumor activity. We reprogrammed CD8+ T-cells derived from the spleen of C57BL/6 mice (rsCD8+T-cells). The rsCD8+T-cells were able to migrate to lung and were more resistant after the exhaustion in vitro in comparison with naïve sCD8+T-cells. In the orthotopic LLC model, the rsCD8+T-cells therapy increased the amount of proliferating CD8+ and CD4+ T-cells in blood and lung from mice. The amount of CSC decreased in the blood and lung of mice treated with rsCD8+ T-cells. A morphological study revealed a decrease in the number of metastases in lung tissue. The antitumor effects of rsCD8+T-cells are based on the activation of the host immune response by increasing the populations of CD8+ and CD4+ T-cells and apoptosis of CSCs.

Among the various types of gas sensors, the chemoresistive gas sensors based on metal oxides are considered the most attractive ones due to their simple operation, low costs and miniaturization. Thin films of V2O5 undoped and doped with TiO2 were studied as nitrogen dioxide, methane and hydrogen sensors. The experimental kinetics of the electrical conductivity changes due to introduction and removal of gas on metal oxide gas sensors were successfully explained in terms of the Langmuir adsorption theory.

Meningitis is a severe disease associated with death in children under five with highest rates of infections under age of one. Vaccines for Neisseria meningitides and Haemophilus influenza are used to prevent the main causative agents of meningitis. Administration of H. influenzae type b (Hib) vaccine is recommended at 2, 4 and 6 months with a booster dose at 18 months. N. meningitidis has two commercially available vaccines, the pure polysaccharide is recommended at 24 months meanwhile the protein-conjugated vaccines at 12 months. We sought in this study to examine if coadministering the vaccines for the two main meningitis causing bacteria might be synergistic as a preliminary step towards the possibility of shuffling immunization schedule. So, we coadministered Hib vaccine with commercially available vaccines either quadrate (ACWY) polysaccharide meningococcal (Men) or conjugated meningococcal (Nim) vaccines in Balb/C mice (n = 6/group) and compared to each vaccine administered separately and controls. Thirty-five days post immunization, we measured specific antibodies titers. Hib vaccine increased Men antibody titers significantly for serotypes Y and W. When Hib vaccine was coadministrated with Nim, antibody titer for Y, W and A significantly increased. For serotype C, there was no significant difference in antibody titers among immunized groups. As for effect of meningococcal vaccines on Hib, Men significantly increased Hib antibody titers while Nim had no effect. Collectively, our data suggested that coadministration of Hib and Men or Nim vaccines was safe and had synergistic effect on immune responses elicited to both vaccines. Further studies are needed before immunization schedule modifications. Such immunization schedule recommendation should provide better protection against this life-threatening disease in young children.

The development of computational acoustics allows simulation of sound generation and propagation in complex environment. In particular, meshfree methods are widely used to solve acoustics problems through arbitrarily distributed field points and approximation smoothness flexibility. As a Lagrangian meshfree method, smoothed particle hydrodynamics (SPH) method reduce the difficulty in solving problems with deformable boundaries, complex topologies, or multiphase medium. The traditional SPH method has been applied in acoustic simulation. This study presents the corrective smoothed particle method (CSPM), which is a combination of SPH kernel estimate and Taylor series expansion. The CSPM is introduced as a Lagrangian approach to improve accuracy in solving acoustic wave equations in the time domain. Moreover, a boundary treatment technique based on the hybrid meshfree and finite difference time domain (FDTD) method is proposed to represent different acoustic boundaries with particles. To model sound propagation in pipes with different boundaries, soft, rigid, and absorbing boundary conditions are built with this technique. Numerical results show that the CSPM algorithm is consistent and demonstrates convergence with exact solutions. Main computational parameters are discussed, and different boundary conditions are validated to be effective for benchmark problems in computational acoustics.

This work presents a novel approach for the study of the movement of droplets on inclined surfaces under the influence of gravity and chemical heterogeneities. The developed numerical methodology uses data-driven modeling to extend the applicability limits of an analytically derived reduced-order model for the contact line velocity. More specifically, while the reduced-order model is able to capture the effects of the chemical heterogeneities to a satisfactory degree, it does not account for gravity. To alleviate this shortcoming, datasets generated from direct numerical simulations are used to train a data-driven model for the contact line velocity, which is based on the Fourier neural operator and corrects the reduced-order model predictions to match the reference solutions. This hybrid surrogate model, which comprises of both analytical and data-driven components, is then integrated in time to simulate the droplet movement, offering a speedup of five orders of magnitude compared to direct numerical simulations. The performance of this hybrid model is quantified and assessed in different wetting scenarios, by considering various inclination angles and values for the Bond number, demonstrating the accuracy of the predictions as long as the adopted parameters lie within the ranges considered in the training dataset.

Urban rail transit hub platform is the most important area for passenger flow distribution. In order to calculate passenger flow volume in platform and evaluate platform service level during rush hours, this paper presents a method for modeling and simulation of passenger flow distribution in platform. Passenger flow distribution model (PFDM) is proposed based on the basic analysis and the superposition principle of passenger flow. Simulation design for PFDM is proposed by Anylogic, which contains simulation process and simulation model. Experiment results show that PFDM and simulation design are effective and accordant with the reality scenario, and the simulation precision is comparatively ideal. This research could provide a beneficial reference for train scheduling and operation management under the viewpoint of traffic safety and service level.

Soil and Water Assessment Tool (SWAT) was used to simulate five glacierized river basins that are global in coverage and vary in climate. The river basins included the Narayani (Nepal), Vakhsh (Central Asia), Rhone (Switzerland), Mendoza (Central Andes, Argentina), and Central Dry Andes (Chile) with a total area of 85,000 km2. A modified SWAT snow algorithm was applied in order to consider spatial variation of associated snow melt /accumulation by elevation band across each subbasin. In the previous studies, melt rates varied as a function of elevation resulting from an air temperature gradient while the snow parameters were constant throughout the entire basin. A major improvement of the new snow algorithm is separating the glaciers from seasonal snow based on their characteristics. Two SWAT snow algorithms were evaluated in simulation of monthly runoff from glaciered watershed: 1) the snow parameters are lumped (i.e. constant throughout the entire basin) and 2) the snow parameters are spatially variable based on elevation band-subbasin (i.e. modified snow algorithm). Applying the distributed SWAT snow algorithm improved the model performance in simulation of monthly runoff with snow-glacial regime, so that mean RSR decreased to 0.49 from 0.55 and NSE increased to 0.75 from 0.69. Improvement of model performance was negligible in simulation of monthly runoff from the basins with monsoon runoff regime.

Electrical contacts are important circuit components with diverse industrial applications, and their failure can lead to multiple unwanted effects. Hence, the behavior of electrical contacts is a widely studied topic in scientific literature based on various approaches, tools, and techniques. The present study proposes a numerical modeling and simulation approach based on the Holm contact theory to study the dependence between the electric potential and the temperature within an electrical contact. Structured in 5 sections, the research was conducted using COMSOL Multiphysics software and its solid-state mechanics, electric current, and heat transfer modules in order to highlight contact behavior from mechanical, electrical and thermal points of view: the von Mises stress, contact force, the electric field amplitude, the variation of the electrical potential along the current path, the temperature gradient, and dependence of temperature along the contact elements edges were obtained by simulation and graphically represented. The results are in line with the expectations and with past research that was studied in the literature review.

This study analyses regional development in one of the poorest provinces in China, Guizhou Province, between 2000 and 2012 using a multiscale and multi-mechanism framework. In general, regional inequality has been declining since 2000. In addition, economic development in Guizhou Province presented spatial agglomeration and club convergence, which shows how the development pattern of one core area, two-wing areas and a contiguous area at the edge of the province have been developed between 2006 and 2012. Multilevel regression analysis revealed that industrialization and investment level were the primary driving forces of regional economic disparity in Guizhou Province. The influences of marketization and decentralization on regional economic disparity were relatively weak. Investment level reinforced regional economic disparity and the development of core-periphery structure in the province. However, investment level actually weakened the regional economic disparity in Guizhou Province when the variable of time was considered. In addition, both the topography and urban–rural differentiation were the two main reasons for forming a core-periphery structure in Guizhou Province.

A power factor correction (PFC) rectifier is compulsory for any electronic circuitry connected to the electrical grid. The majority of PFCs that are utilized are based on a step-up converter that supplies high DC voltage at its output terminal. Electric vehicle battery voltage varies from a few hundred to almost a thousand volts. Thus, an additional conversion step is obligatory when designing an all-brand universal charger. This paper presents a new type of front-end versatile step up / down three voltage level PFC. The rectifier can operate in continuous conduction mode or discontinuous conduction mode. First, the rectifier’s principle of operation is described, and then an innovative rectifier is analyzed for continuous and discontinuous conduction modes. Finally, the proposed theory is experimentally validated in a multiplier-less dual loop mode at discontinuous conduction modes. It was shown that although there is no multiplier use in the control circuitry, the power factor is near unity. It was revealed that the rectifier could swing the output voltage from 50 V to 900 V while the input voltage was 230 Vrms. The innovative topology suits any standard PFC rectifier, three-level voltage supplement, and dual-stage low-voltage power supply.

Existing research indicates that mineralization of Carlin-type gold deposit is related to geological structures, but current studies mostly focus on the qualitative association, and lack quantitative analysis of the relationship between mineralization and structural features, which limits the potential for predictive mineral exploration. In this study, the Nibao Carlin-type gold deposit was selected as the research area to conduct three-dimensional geological modeling, spatial analysis, and three-dimensional prospectivity modeling. Spatial analysis revealed that the majority of gold ore bodies are situated near the main fault, with gold mineralization primarily occurring within a spatial range of approximately -80 meters to 20 meters from the main fault plane. This spatial distribution predominantly aligns in a SW-NE direction. Spatial characteristic extraction of fault slope indicators suggests that the slope angles are conducive to the migration and accumulation of ore-forming hydrothermal fluids, with ore body metal content rapidly increasing within an angle range of approximately 20° to 60°. The shape analysis of the mainfault indicates that the principal spaces of mineralization enrichment are within -10m to 20m of the fault plane undulations, where gold resources are concentrated in a relatively flat area. However, the degree of mineralization is more pronounced in the protruding sections than in the depressed areas. The areas with significant dip changes in faults display higher variations in orebody attitudes, with mineralization noticeably weaker in areas where the fault steepness changes markedly. Ore-bearing units exhibit significantly higher grades within the -17° to 3° interval of fault steepness transition. This interval also sees a rapid accumulation of gold resources. The Nibao gold mine's mineralization is derived from deep, ore-bearing hydrothermal fluids ascending along major fractures, precipitating, and accumulating in favorable ore-hosting spaces (faults, anticline cores) and lithological combinations (sedimentary tuffs, tuffs). Three deep potential gold targets were identified, highlighting the deep western edge of the F1 fault and the deep southeast-trending lower plate as prospective areas for future exploration. This study underscores the effectiveness of 3D prospective modeling as an indispensable tool for elucidating the spatial distribution of fault-controlled Carlin-type gold deposits and their tectonic determinants.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

Developmental hazard evaluation is an important part of assessing chemical risks during pregnancy. Toxicological outcomes from prenatal testing in pregnant animals result from complex chemical-biological interactions, and while New Approach Methods (NAMs) based on in vitro bioactivity profiles of human cells offer promising alternatives to animal testing, most of these assays lack cellular positional information, physical constraints, and regional organization of the intact embryo. Here, we engineered a fully computable model of the embryonic disc in the compucell3d.org modeling environment to simulate epithelial-mesenchymal transition of epiblast cells and self-organization of mesodermal domains (chordamesoderm, paraxial, lateral plate, posterior/extraembryonic). Cell fate in the model is determined by an autonomous homeobox (HOX) clock driven by morphogenetic signals (e.g., FGF, WNT, ATRA, CDX). Executing the model renders a quantitative cell-level computation of mesodermal subpopulations and consequences of perturbation based on known embryogeny. For example, synthetic perturbation of the control network rendered altered phenotypes (cybermorphs) mirroring experimental mouse embryology, with 50% reductions in FGF4, FGF8 and BMP4 signaling resulting in 86%, 98% and 59% reductions, respectively in the posterior mesodermal population, while ATRA exposure also resulted in a 78% decrease in this population. This model enables integration of in vitro chemical bioactivity data for specific molecular targets with known embryology to test mechanistic veracity and quantitative prediction of altered development.

The liver diseases are posing serious threat to human health associated with abusive use of allopathy medicines, especially in developing economies like Pakistan. The strengthening of detoxification system using natural products might be a suitable option to minimize the liver problems. In this current research, Zingiber officinale and Azadirachta indica were evaluated for their hepatoprotective role. For the purpose, 20 Sprague Dawley rats were equally divided into four groups i.e., negative control, paracetamol positive control, 2.5% ginger and 2% neem powder, respectively. During 42 days study, the levels of bilirubin and liver enzymes significantly elevated due to liver damage. Although, the values dropped (20-25%) in treatment group. Serum glucose and serum lipid profile increased in positive control group, but reduced (5-10%) in both ginger and neem groups. The serum protein profile declined in liver damage group, however, improved (~5%) in treatment groups. The hematological parameters slightly declined in liver damage group, but increased in ginger and neem groups. Moreover, the white blood cells differential count and renal parameters showed abnormal values in liver damage group, but improved after treatment. This study is promising and highlighted the hepato-protective role of neem and ginger that may open several avenues of research.

Abstract: The SARS-CoV-2 pandemic has reemphasized the urgent need for broad-spectrum antiviral therapies. We developed a computational workflow using scRNA-Seq data to assess cellular metabolism during viral infection. With this workflow we predicted the capacity of cells to sustain SARS-CoV-2 virion production in patients and found a tissue-wide induction of metabolic pathways that support viral replication. Expanding our analysis to influenza A and dengue viruses, we identified metabolic targets and inhibitors for potential broad-45 spectrum antiviral treatment. These targets were highly enriched for known interaction partners of all analyzed viruses. Indeed, phenformin, an NADH:ubiquinone oxidoreductase inhibitor, suppressed SARS-CoV-2 and dengue virus replication. Atpenin A5, blocking succinate dehydrogenase, inhibited SARS-CoV-2, dengue virus, respiratory syncytial virus, and influenza A with high selectivity indices. In vivo, phenformin showed antiviral activity against SARS-CoV-2 in a Syrian hamster model. Our work establishes host metabolism as druggable for broad-spectrum antiviral strategies, providing invaluable tools for pandemic preparedness.

Digital twins are an emerging technology that could be harnessed for the digitalization of the industry. Steel industry systems contain a large number of electro-hydraulic components, as proportional valves. An input-output model for a novel water proportional cartridge valve is derived from physical modelling based on fluid mechanics, dynamics, and electrical principles. The valve is a two-stage valve with two 2/2-way water proportional valves as the pilot stage and a marginally stable poppet-type cartridge valve as the main valve. The orifice equation, which is based on Bernoulli principles, is approximated by a polynomial which makes parameter estimation easier and makes modelling possible without measuring pressure of the varying control volume situated in the pilot stage part of the valve. Data were collected when the valve was operating as a component in a closed-loop system as part of a press-mill machine in a steel manufacturing plant. Parameter estimation was made by convex optimization with physical constraints to overcome problems caused by poor system excitation. For comparison, a simple linear model was derived and the least squares method used for parameter estimation. A thorough estimation of the parameters relative errors is presented. The model contains 5 parameters related to the design parameters of the valve. The modelled position output is in good agreement with experimental data for training and test data. The model can be used for real time monitoring of the valve’s status by the model parameters. One of the model parameters varies linearly with production cycles. Thus, aging of the valve can be monitored.

Currently, obesity is a critical global public health burden. Numerous studies have demonstrated the regulation of the pathogenesis of obesity and metabolic abnormalities by the gut microbiota and microbial factors; however, their involvement in the various degrees of obesity is not yet understood well. Previously, obesity has been shown to be associated with decreased levels of vitamin B12. Considering exclusive microbial production of vitamin B12, we hypothesised that a decrease in cobalamin levels in obese individuals may be at least partially caused by its depleted production in the intestinal tract by the commensal microbiota. In the present study, our aim was to estimate the abundance of enzymes and metabolic pathways for vitamin B12 synthesis in the gut microbiota of mouse models of alimentary and genetically determined obesity, to evaluate the contribution of the obesogenic microbiome to vitamin B12 synthesis in the gut. We have defined a significantly lower representation of enzymes and metabolic pathways for vitamin B12 biosynthesis in obese mice compared to non-obese mice, wherein enzyme depletion was more pronounced in lepr(-/-) (db/db) mice, which developed severe obesity. The representation of enzymes involved in cobalamin synthesis is strongly correlated with representation of several microbes in high-fat diet fed mice, whereas there were almost no correlations in db/db mice. Therefore, the degree of obesity and the composition of the correspondent microbiota are the main contributors to the representation of genes and pathways for cobalamin biosynthesis in the mouse gut.

In this study, we present comprehensive climatologies of effective ultraviolet (UV) quantities and photosynthetically active radiation (PAR) over Cyprus for the period 2004 to 2023, leveraging the synergy of earth observation (EO) data and radiative transfer model simulations. The EO dataset, encompassing satellite and re-analysis data for aerosols, total ozone column, and water vapor, alongside cloud modification factors, to capture the nuanced dynamics of Cyprus's atmospheric conditions. With a temporal resolution of 15 minutes and a spatial of 0.05°x0.05°, these climatologies undergo rigorous validation against established satellite datasets and are further evaluated through comparisons with ground-based global horizontal irradiance measurements provided by the Meteorological Office of Cyprus. This dual-method validation approach not only underscores the models' accuracy but also highlights their proficiency in capturing intra-daily cloud coverage variations. Our analysis extends to investigating the long-term trends of these solar radiation quantities, examining their interplay with changes in cloud attenuation, aerosol optical depth (AOD), and total ozone column (TOC). Significant decreasing trends in the noon ultraviolet index (UVI), of -2 to -4% per decade have been found in Autumn, especially marked on the island’s Northeastern part, mainly originating from the (significant) positive trends in TOC. The significant decreasing trends in TOC, of -2 to -3% per decade that were found in Spring do not result in correspondingly significant positive trends in the noon UVI since variations in cloudiness and aerosols also have a strong impact on the UVI in this season. The seasonal trends in the Daylight Integral (DLI) were generally not significant. These insights provide a valuable foundation for further studies aimed at developing public health strategies and enhancing agricultural productivity, highlighting the critical importance of accurate and high-resolution climatological data.

There are several challenges on how to attain energy efficiency while maintaining balance among factors affecting energy consumption such as power rating and temperature setpoints of cooling units, room temperature and humidity, and indoor air quality (IAQ). A real-time energy and IAQ monitoring system were installed in an educational building to profile the operational power consumption of inverter-based air condition unit (ACU) installed in each room. Polynomial curve and neural fitting regression analysis were applied to the real-time power consumption, indoor temperature and humidity, and carbon dioxide (CO2) level data. The derived models were able to provide the stabilizing indoor thermal and air conditions of the room to reach steady state ACU power consumption. These collected data and calculated parameters can be used to define rules in automating control of cooling appliances for an efficient energy utilization. The regression approaches, using real-time data, have determined the influence of indoor heat conditions and carbon dioxide levels on ACU power consumption. These parameters were utilized to establish consistent values for temperature, humidity, and carbon dioxide levels under stable settings of inverter-based air conditioning units.

The alcoholic fermentation process with agitation/static, followed by the acetic fermentation submerged in banana was evaluated. Kinetics parameters of alcoholic fermentation for the maximum ethanol/glycerol metabolites in agitated process was 29 and 27 h, and in static 47 and 45 h, respectively. For acetic fermentation, the kinetics parameters were medium time of 39.9 h, acetic acid yield of 53.1% and acetic acid productivity of 0.216 g/Lh. Wines from agitated/static process presented 5.73 and 6.81% (v/v) of alcohol content, respectively. Wine obtained by the static process presented higher concentrations of volatile compounds. The vinegar showed 49.2 g/L of acetic acid and the esters concentrations were higher than in wine. The wine and vinegar minerals were consistent with amount observed in the pulp, with an increase in sulphur concentration after alcoholic fermentation and decrease after acetic fermentation. Products showed chemical and composition of sensory and nutritional interest.

Agricultural greenhouse is largely answered in the agricultural sphere, despite the shortcomings it has, including overheating during the day and night cooling which sometimes results in the thermal inversion mainly due to its low inertia. The glasshouse dressed chapel is relatively more efficient than the conventional tunnel greenhouse. Its proliferation on the ground is more or less timid because of its relatively high cost[14-22]. Agricultural greenhouse aims to create a favorable microclimate to the requirements of growth and development of culture, from the surrounding weather conditions, produce according to the cropping calendars fruits, vegetables and flower species out of season and widely available along the year. It is defined by its structural and functional architecture, the quality thermal, mechanical and optical of its wall, with its sealing level and the technical and technological accompanying[12-13]. The greenhouse is a very confined environment, where multiple components are exchanged between key stakeholders and them factors are light, temperature and relative humidity[8]. This state of thermal evolution is the level sealing of the cover of its physical characteristics to be transparent to solar, absorbent and reflective of infrared radiation emitted by the enclosure where the solar radiation trapping effect otherwise called "greenhouse effect" and its technical and technological means of air that accompany. The socio-economic analysis of populations in the world leaves appear especially the last two decades of rapid and profound transformations These changes are accompanied by changes in eating habits, mainly characterized by rising consumption spread along the year[14]. To effectively meet this demand, greenhouse-systems have evolved, particularly towards greater control of production conditions (climate, irrigation, ventilation techniques, CO2 supply, etc ...). Technological progress has allowed the development of greenhouses so that they become increasingly sophisticated and of an industrial nature (heating, air conditioning, control, computer, regulation, etc ...). New climate driving techniques have emerged, including the use of control devices from the classic to the use of artificial intelligence[10-11] such as neural networks and / or fuzzy logic, etc... As a result, the greenhouse growers prefer these new technologies while optimizing the investment in the field to effectively meet the supply and demand of these fresh products cheaply and widely available throughout the year.

Water resources provided by alpine glaciers are an important pillar for people living in the arid regions in the west of China. In this study, the HBV (Hydrologiska Byrans Vattenavdelning) light model was applied to simulate glacier mass balance and runoff in the Koxkar River Basin (KRB) on the south slope of Mt. Tumur, western Tianshan Mts.. Daily temperature and precipitation were calculated by multiple linear regressions and gradient-inverse distance weighting, respectively, based on in-situ observed data by automatic weather stations (AWSs) in the basin (2007–2009) and at four meteorological stations neighbering the basin (1959–2009). Observed daily air temperature and precipitation were taken as input data for the HBV model, which was calibrated using runoff in 2007/08 and 2009/10, and validated in 2008/09 and 2010/11. Generally, the model could simulate runoff very well. The annual glacier mass balance and runoff were calculated using the HBV model driven by interpolated meteorological data for the period of 1959–2009. The simulated glacier mass balance were reasonable when compared with those observed values at nearby glaciers, indicating a decrease trend of mass balance in the basin with an average value of –370.4 mm a^-1 since 1959. The annual runoff showed a slight increase trend (5.51 mm a^-1). Futher analysis indicated that the runoff is more sensitive to temperature than precipitation amuont in the Koxkar river basin.

Residual stress (RS) is the most challenging problem in metal additive manufacturing (AM) since the build-up of high tensile RS may influence the fatigue life, corrosion resistance, crack initiation, and failure of the additively manufactured components. While tensile RS is inherent in all the AM processes, fast and accurate prediction of stress state within the part is extremely valuable and would result in optimization of the process parameters in achieving a desired RS and control of the build process. This paper proposes a physics-based analytical model to rapidly and accurately predict the RS within the additively manufactured part. In this model, a transient moving point heat source (HS) is utilized to determine the temperature field. Due to the high temperature gradient within the proximity of the melt pool area, material experience high thermal stress. Thermal stress is calculated by combining three sources of stresses known as stresses due to the body forces, normal tension, and hydrostatic stress in a homogeneous semi-infinite medium. The thermal stress determines the RS state within the part. Consequently, by taking the thermal stress history as an input, both the in-plane and out of plane RS distributions are found from incremental plasticity and kinematic hardening behavior of the metal by considering volume conservation in plastic deformation in coupling with the equilibrium and compatibility conditions. In this modeling, material properties are temperature-sensitive since the steep temperature gradient varies the properties significantly. Moreover, the energy needed for the solid-state phase transition is reflected by modifying the specific heat employing the latent heat of fusion. Furthermore, the multi-layer and multi-scan aspects of metal AM are considered by including the temperature history from previous layers and scans. Results from the analytical RS model presented excellent agreement with XRD measurements employed to determine the RS in the Ti-6Al-4V specimens.

This review aims to explore the intricate relationship between epigenetic mechanisms, stress, and affective disorders, focusing on how early life experiences and coping mechanisms contribute to susceptibility to mood disorders. Epigenetic factors play a crucial role in regulating gene expression without altering the DNA (deoxyribonucleic acid) sequence, and recent research has revealed associations between epigenetic changes and maladaptive responses to stress or psychiatric disorders. A scoping review of 33 studies employing the PRISMA-S (Preferred Reporting Items for Systematic Reviews and Meta-Analyses – Statement) guidelines investigates the role of stress-induced epigenetic mechanisms and coping strategies in affective disorders' occurrence, development, and progression. The analysis encompasses various stress factors, including childhood trauma, work-related stress, and dietary deficiencies, alongside epigenetic changes such as DNA methylation and altered gene expression. Findings indicate that specific stress-related genes frequently exhibit epigenetic changes associated with affective disorders. Moreover, the review examines coping mechanisms in patients with bipolar disorder and major depressive disorder, revealing mixed associations between coping strategies and symptom severity. While active coping is correlated with better outcomes, emotion-focused coping may exacerbate depressive or manic episodes. Overall, this review underscores the complex interplay between genetic predisposition, environmental stressors, coping mechanisms, and affective disorders. Understanding these interactions is essential for developing targeted interventions and personalized treatment strategies for individuals with mood disorders. However, further research is needed to elucidate specific genomic loci involved in affective disorders and the clinical implications of coping strategies in therapeutic settings.

Batch and transport experiments were used to investigate the remediation of a loamy sand soil contaminated with Cr(VI) using zero valent iron nanoparticles (nZVI) stabilized by the carboxy methyl cellulose (CMC-nZVI). The effect of pH, ionic strength (IS), and flow rate on the removal efficiency of Cr(VI) were investigated under equilibrium (uniform transport) and non-equilibrium (Two-site sorption) transport using the Hydrus-1D model. The overall removal efficiency ranged from 70 to over 90% based on the chemical characteristics of the CMC-nZVI suspension and the transport conditions. The concentration and pH of the CMC-nZVI suspension had the most significant effect on the removal efficiency and transport of Cr(VI) in the soil. The average removal efficiency of Cr(VI) was increased from 24.1 to 75.5% when the concentration of CMC-nZVI nanoparticles was increased from 10 to 250 mg L-1, mainly because of the increased total surface area at larger particle concentration. Batch experiments showed that removal efficiency of Cr(VI) was much larger under acidic conditions. The average removal efficiency of Cr(VI) reached 90.1 and 60.5 % at pH 5 and 7, respectively. The Two-site sorption model described quite well (r2 = 0.96-0.98) the transport of Cr(VI) in soil as compared to the uniform transport model (r2 = 0.81-0.98). The average retardation of Cr(VI) was 3.51 and 1.61 at pH 5 and 7, respectively, indicating earlier arrival for the breakthrough curves and shorter time to reach maximum relative concentration at lower pH. The Hydrus-1D model has proven to be an efficient tool for assessing the removal of Cr(VI) pollutants, offering innovative, cost-effective, and environmentally friendly remediation methodologies.

Despite advances in understanding of the molecular pathogenesis of glioma, outcomes remain dismal. Developing successful treatments for glioma requires faithful in vivo disease modeling and rigorous preclinical testing. Murine models, including xenograft, syngeneic, and genetically engineered models, are used to study gliomagenesis, identify methods of tumor progression, and test novel treatment strategies. Since the discovery of highly recurrent isocitrate dehydrogenase (IDH) mutations in lower-grade gliomas, there is increasing emphasis on effective modeling of IDH mutant brain tumors. Improvements in preclinical models that capture the phenotypic and molecular heterogeneity of gliomas are critical for the development of effective new therapies. Herein, we explore the current status, advancements, and challenges with contemporary murine glioma models.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

Climate warming is expected to have pronounced effects on Arctic and Subarctic ecosystems, especially regions underlain by discontinuous and relatively warm permafrost. The main goal of this research is to evaluate the vulnerability and dynamics of permafrost under climate warming across the various ecotypes in respect of ecosystem stability, socioeconomic impact, and for better understanding possible future environmental changes. We suggested the new version of the spatially distributed permafrost dynamics model (GIPL2-MPI), which is developed in the Geophysical Institute, University of Alaska Fairbanks. This model is based on the ecosystem approach to simulate the permafrost dynamics, which we are discussing in this paper. We combined ground-based observations and numerical freeze/thaw modeling using climate-ecosystem-permafrost interactions to understand the physical processes and mechanisms controlling permafrost physical state. We predict the changes in permafrost conditions using output from two GCMs (NCAR-CCSM4 and GFDL-CM3) and Five-Model Average Ensemble for the RCP-4.5 and RCP-8.5 scaled down to 1 by 1 km spatial resolution (https://uaf-snap.org/) across entire Alaska. Our result shows that by the end of the current century widespread near-surface permafrost degradation could begin everywhere in Alaska southward of the Brooks Range as well as across some spots at the North Slope Alaska.

The massive amount of human biological, imaging and clinical data produced by multiple and diverse sources, necessitates integrative modeling approaches able to summarize all this information into answers to specific clinical questions. In this paper, we present a hypermodeling scheme able to combine models of diverse cancer aspects regardless of their underlying method or scale. Describing tissue-scale cancer cell proliferation, biomechanical tumor growth, nutrient transport, genomic-scale aberrant cancer cell metabolism, and cell signaling pathways that regulate the cellular response to therapy, the hypermodel integrates mutation, miRNA expression, imaging, and clinical data. The constituting hypomodels as well as their orchestration and links are described. Two specific cancer types, Wilms tumor (nephroblastoma) and non-small cell lung cancer, are addressed as proof of concept study cases. Personalized simulations over the actual anatomy of a patient have been carried out. The hypermodel has also applied to predict tumor control after radiotherapy and the relationship between tumor proliferative activity and response to neoadjuvant chemotherapy. Our innovative hypermodel holds promise as a digital twin based clinical decision support system and the core of future in silico trial platforms, although additional retrospective adaptation and validation is necessary.

The use of unmanned aerial aircrafts (UAVs) is governed by strict regulatory frameworks that prioritize safety. To guarantee safety, it is necessary to acquire and maintain situational awareness (SA) throughout the operation. Existing Canadian regulations require pilots to operate their aircrafts in visual line-of-sight. Therefore, the task of acquiring and maintaining SA primary falls to the pilots. However, the development of aerial transport is entering a new era with the adoption of a highly dynamic and complex system known as advanced air mobility (AAM), which involves UAV operating autonomously beyond visual line-of-sight. SA must therefore be acquired and maintained primarily by each UAV through specific technologies and procedures. In this paper, we review these technologies and procedures in order to decompose the SA of the UAV in the AAM. We then use the system modeling language to provide a high-level structural and behavioral representation of the AAM as a system having UAV as its main entity. In a case study, we analyze one of the flagships UAVs of our industrial partner. Results show that this UAV doesn’t have all the technologies and methodologies necessary to achieve all the identified SA goals identified for the safety of the AAM. This work is a theoretical framework intended to contribute to the realization of the AAM, and we also expect to impact the future design and utilization of UAVs.

Glioblastoma (GBM) is the most aggressive brain cancer. To model GBM in research, orthotopic brain tumor models, including syngeneic models like GL261 and genetically engineered mouse models like TRP, are used. In longitudinal studies, tumor growth and treatment response are typ-ically tracked with in vivo imaging, including bioluminescence imaging (BLI), which is quick, cost-effective, and easily quantifiable. However, BLI requires luciferase-tagged cells, and recent studies indicate that the luciferase gene can elicit an immune response, leading to tumor rejection and experimental variation. We sought to optimize the engraftment of two luciferase-expressing GBM models, GL261 Red-FLuc and TRP-mCherry-FLuc, showing differences in tumor take, with GL261 Red-FLuc cells requiring immunocompromised mice for 100% engraftment. Immuno-histochemistry and MRI revealed distinct tumor characteristics: GL261 Red-FLuc tumors were well-demarcated with densely packed cells, high mitotic activity, and vascularization. In con-trast, TRP-mCherry-FLuc tumors were large, invasive, and necrotic, with perivascular invasion. Quantifying tumor volume using the HALO® AI analysis platform yielded results comparable to manual measurements, providing a standardized and efficient approach for reliable high-throughput analysis of luciferase-expressing tumors. Our study highlights the importance of considering tumor engraftment when using luciferase-expressing GBM models, providing in-sights for preclinical research design.

Adult T-cell leukemia (ATL) is an aggressive hematologic disease caused by human T-cell leukemia virus type 1 (HTLV-1) infection. Various animal models of HTLV-1 infection/ATL have been established to elucidate the pathogenesis of ATL and develop appropriate treatments. For analyses employing murine models, transgenic and immunodeficient mice are used because of the low infectivity of HTLV-1 in mice. HTLV-1 Tax and HBZ transgenic mice spontaneously develop tumors, and roles for both Tax and HBZ in cell transformation and tumor growth have been established. Severely immunodeficient mice were able to engraft ATL cell lines and have been used in preclinical studies of candidate molecules for the treatment of ATL. HTLV-1-infected humanized mice with an established human immune system are a suitable model to characterize cells in the early stages of HTLV-1 infection. This review outlines the characteristics of mouse models of HTLV-1 infection/ATL and describes progress made in elucidating the pathogenesis of ATL and developing related therapies using these mice.

Pericentromeric regions of chromosomes enriched in tandemly repeated satellite DNA although representing a significant part of eukaryotic genomes are still understudied mainly due to interdisciplinary knowledge gaps. Recent studies suggest their important role in genome regulation, karyotype stability and evolution. Thus, the idea of satellite DNA as a junk part of the genome was refuted. Integration of data about molecular composition, chromosome behaviour and details of in situ organization of pericentromeric regions is of great interest. The objective of this work was a cytogenetic analysis of the interactions of pericentromeric regions non-homologous chromosomes in mouse spermatocytes using immuno-FISH. We analysed two events: the associations between cerntomeric regions of X chromosome and autosomes, and associations between centromeric regions of autosomal bivalents forming chromocenters. We conclude that X chromosome form temporary synaptic associations with different autosomes in early meiotic prophase I which normally can be found at pachytene-diplotene without signs of pachytene arrest. These associations are formed between the satellite DNA-enriched centomeric regions of X chromosome and different autosomes but not involve the satellite-poor centromeric region of Y-chromosome. We suggest the mechanism of X chromosome competitive replacement from such associations during synaptic correction. We showed that centromeric region of the X chromosome remains free of γH2Ax-dependent chromatin inactivation, while Y chromosome is completely inactivated. This findings highlights the predominant role of associations between satellite DNA-enriched regions of different chromosomes including X. We assume that X-autosome temporary associations is a manifestation of an additional synaptic disorders checkpoint. These associations are normally corrected before the late diplotene. We revealed that the intense spreading conditions applied to the spermatocytes I nuclei did not lead to destruction of stretched chromatin fibers i.e. elongated chromocenters enriched in satellite DNA. Revealed by us tight associations between pericentromeric regions of different autosomal bivalents and X chromosome may represent the basis for repeat stability maintenance in autosomes an X chromosome. The consequences of our findings are discussed. We obtained the preparations of mouse spermatocytes nuclei in the meiotic prophase I using two approaches: standard and extremely intense surface spread techniques. Using immuno-FISH we visualized tandemly repeated mouse Major and Minor satellite DNA located in the pericentromeric regions of chromosomes and performed a morphological comparison of the standard- and intensely spreaded meiotic nuclei. Based on our results, we assume the remarkable strength of the chromocenter-mediated associations, “chromatin “bridges”, between different bivalents at the pachytene and diplotene stages. We have demonstrated that the chromocenter “bridges” between the centromeric ends of meiotic bivalents are enriched in both tandemly repeated Major and Minor satellite DNA. Association of centromeric regions of autosomal bivalents and X-chromosome but not with Y-chromosome correlates with the absence of Major and Minor satellites on Y-chromosome. We suggest that revealed tight associations between pericentromeric regions of bivalents may represent the network-like system providing dynamic stability of chromosomal territories, as well as add new data for the hypothesis of ectopic recombination in these regions which supports sequence homogeneity between non-homologous chromosomes and does not contradict the meiotic restrictions imposed by the crossing-over interference near centromeres. We conclude that nuclear architecture in meio-sis may play an essential role in contacts between the non-homologous chromosomes providing the specific characteristics of pericentromeric DNA.

Methionine 77 in calmodulin can be stereospecifically oxidized to methionine sulfoxide by mammalian methionine sulfoxide reductase A. Whether this has in vivo significance is unknown. We therefore created a mutant mouse in which wild-type calmodulin-1 was replaced by a calmodulin containing a mimic of methionine sulfoxide at residue 77. Total calmodulin levels were unchanged in the homozygous M77Q mutant, which is viable and fertile. No differences were observed on learning tests, including the Morris water maze and associative learning. Cardiac stress test results were also the same for mutant and wild type mice. .However, young male and female mice were 20% smaller than wild type mice, although food intake was normal for their weight. Young M77Q mice were notably more active and exploratory than wild type mice. This behavior difference was objectively documented on the treadmill and open field tests. The mutant mice ran 20% longer on the treadmill than controls, and in the open field test, the mutant mice explored more than controls and exhibited reduced anxiety These phenotypic differences bore a similarity to those observed in mice lacking calcium/calmodulin kinase Iiα (CaMKIIα). We then showed that M77Q calmodulin was less effective in activating CaMKIIα than wild type calmodulin. Thus, characterization of the phenotype of a mouse expressing a constitutively active mimic of calmodulin led to the identification of the first calmodulin target that can be differentially regulated by the oxidation state of Met77. We conclude that reversible oxidation of methionine 77 in calmodulin by MSRA can regulate cellular function.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

This study investigated the effects of silibinin, derived from milk thistle (Silybum marianum), on lipopolysaccharide (LPS)-induced morphological changes in mouse macrophages. Silibinin was treated at various doses and time points to assess its effects on macrophage activation including morphological changes and phagocytosis. Silibinin effectively inhibited LPS-induced pseudopodia formation and size increase, while unstimulated cells remained round. Silibinin's impact on phagocytosis was dose- and time-dependent, showing a decrease. We explored its mechanism of action on kinases using a MAPK array. Among the three MAPK family members tested, silibinin had a limited effect on JNK and p38 but significantly inhibited ERK1/2 and related RSK1/2. Silibinin also inhibited MKK6, AKT3, MSK2, p70S6K, and GSK-3β. These findings highlight silibinin's potent inhibitory effects on phagocytosis and morphological changes in macrophages. We suggest its potential as an anti-inflammatory agent due to its ability to target key inflammatory pathways involving ERK1/2 and related kinases. Overall, this study demonstrates the promising therapeutic properties of silibinin in modulating macrophage function and inflammation.

The circadian clock regulates daily changes in behavioral, endocrine and metabolic activities in mammals. Circadian rhythms in cellular physiology are significantly affected by aging. In particular, we previously found that aging has profound impact on daily rhythms in mitochondrial functions, leading to increased oxidative stress. However, this is unlikely due to malfunction of molecular clocks in the suprachiasmatic nucleus or peripheral tissues, as robust clock oscillations are observed therein in old animals. Nonetheless, aging induces changes in gene expression levels and rhythms in various peripheral and probably central tissues. In this article, we review findings on the roles of the circadian clock and aging in regulating mitochondrial rhythms and redox homeostasis. Chronic sterile inflammation is implicated in mitochondrial dysfunction and increased oxidative stress during aging. In particular, upregulation of CD38 by inflammatory response can disturb mitochondrial functions in multiple ways.

There is evidence that spaceflight poses acute and late risks on the central nervous system. To explore possible mechanisms, the proteomic changes following spaceflight in mouse brain were characterized. Space Shuttle Atlantis (STS-135) was launched at the Kennedy Space Center on a 13-day mission. Within 3–5 hours after landing, brain tissue was collected to evaluate protein expression profiles using quantitative proteomic analysis. Our results showed that there were 26 proteins that were significantly altered after spaceflight in the grey and/or white matter. While there was no overlap between the white and grey matter in terms of individual proteins, there was overlap in terms of function, synaptic plasticity, vesical activity, protein/organelle transport, and metabolism. Our data demonstrate that exposure to the spaceflight environment induces significant changes in protein expression related to neuronal structure and metabolic function. This might lead to a significant impact on brain structural and functional integrity that could affect the outcome of space missions.

Metal creep has been a subject of extensive study for more than 110 years, because it affects the useful life of engineering components operating at high temperatures. It is even more so with ever-increasing operating temperatures of propulsion/power-generation systems by the environmental regulations to reduce greenhouse emissions. This review summaries the recent development in creep modeling with regards to creep strain evolution, creep rate, creep ductility, creep life and fracture mode, attempting to provide a comprehensive mechanism-based framework to address all the important creep phenomena and the long-standing issue of long-term creep life prediction with microstructural evolution and environmental effects.

Stunting, during the Covid-19 pandemic, is increasingly becoming a big problem in the world, especially in poor and developing countries. Observational studies have shown that stunting is associated with poor nutrition, especially a plant-based diet, inflammation, caused by infection, enteric dysfunction, an environment with clean water, inadequate sanitation and hygiene (WASH), and endogenous inflammation associated with excess adiposity. This causes nutritional interventions to be often unsuccessful (Kemenkes RI, 2018).The government intervenes to reduce stunting to the target party, which is divided into two categories. The first category is specific nutrition intervention, namely monitoring children under five at the posyandu, giving immunizations, giving vitamin A, giving Supplementary Foods (PMT), and others. The second category is sensitive nutrition interventions, namely the provision of drinking water and proper sanitation, postnatal family planning (KB) services, providing information related to stunting, food social assistance, conditional cash assistance, and others. (KEMEN-PMK, 2018). WHO states, that the impact of stunting can be divided into short-term and long-term impacts. The short-term impacts are; increased incidence of morbidity and mortality; cognitive, motor, and verbal development in children is not optimal; and increased healthcare costs. While the long-term impact; Posture that is not optimal as an adult (shorter than usual); Increased risk of obesity and other diseases; The decline in reproductive health; Less than optimal learning capacity and performance during school years; and Low productivity and work capacity (Kemenkes RI, 2018). The nursing goal is to help people achieve quality, holistic health. Implementation of Modeling and Role Modeling Theory is an option in implementing nursing care for children with stunting. “Modeling” is gaining an understanding of the client’s world from the client’s perspective. That is to build a “model” of the client’s worldview. “Role‑Modeling” is based on the assumption that all humans want to interact with others, they want to carry out selected roles in society. Role-Modeling is using the client’s model of the world to plan interventions that meet his or her perceived needs, grow, develop and heal. Role-Modeling requires that we aim to build trust, promote a positive orientation and a sense of control, affirm strengths and set specific mutual goals.

Student retention is one indicator of accountability in the implementation of educational programs. Achievement of student retention rates indicates the performance of the quality objectives of an institution or college. To get an accurate picture of the factors related to retention, we need to do modeling. The retention variable is the time response variable measured in semester units. One of the statistical analyzes that can be used to analyze response data in time is survival analysis. The selection of an accurate analytical method in modeling will produce valid conclusions and impact making policies that are right and on target. This paper presents alternative modeling of student retention in distance education using survival analysis. The method used is a literature review. This paper also briefly describes distance education, open and distance education, distance education students' characteristics, distance education student retention, and survival models for modeling student retention in distance education.

The objective of this study was to analyze the mental workload using EEG and eye tracking data and classify it using machine learning algorithms. The machine learning model was developed based on the simultaneous recording of eye tracking and EEG measurements during the experimental process. The experiments involved 15 university students, consisting of 7 women and 8 men. Throughout the experiments, the researchers utilized the n-back memory task and the NASA-Task Load Index (TLX) subjective rating scale to assess various levels of mental workload. The findings revealed that as the task difficulty increased, there was an increase in the diameter of both the right and left pupils, the number of fixations, the number and duration of saccades, and the number and duration of blinks. Conversely, variables related to fixation duration decreased. The EEG results indicated that theta power in the prefrontal, frontal, and front central regions increased with task difficulty. Additionally, alpha power increased in the frontal regions but decreased in the temporal, parietal, and occipital regions as the task became more challenging. Furthermore, low beta power significantly decreased in almost all brain regions as the task difficulty increased. In terms of the four-class classification problem, the mental workload level can be predicted with an accuracy rate of 76.59% using 34 selected features. This study has made a significant contribution to the literature by presenting a four-class mental workload estimation model that utilizes different machine learning algorithms.

The mouse visual system recently became the most popular model to study the cellular and circuit mechanisms of sensory processing. However, the importance of eye movements in mice only started to be appreciated recently. Eye movements provide a basis for active sensing and deliver insights into various brain functions and dysfunctions. A plethora of knowledge on the central control of eye movements and their role in perception and behaviour arose from work on primates. However, an overview of the known eye movement types in mice and a comparison to primates is missing.Here, we review the eye movement types described to date in mice and compare them to those observed in primates. We discuss the central neuronal mechanisms for their generation and control. Furthermore, we review the mounting literature on eye movements in mice during head-fixed and freely moving behaviours. Finally, we highlight gaps in our understanding and suggest future directions for research.

Traumatic brain injury (TBI) can result in persistent sensorimotor and cognitive deficits, which occur through a cascade of deleterious pathophysiological events over time. In this study, we investigated the hypothesis that neurodegeneration caused by TBI leads to impairments in sensorimotor function. TBI induces the activation of the caspase-3 enzyme, which triggers cell apoptosis in an in vivo model of fluid percussion injury (FPI). We analyzed caspase-3 mediated apoptosis by TUNEL staining and PARP and annexin V western blotting. We correlated the neurodegeneration with sensorimotor deficits by conducting the animal behavioral tests including grid walk, balance beam, inverted screen test, and climb test. Our study demonstrated that the excess cell death or neurodegeneration correlated with the neuronal dysfunction and sensorimotor impairments associated with TBI.

Pregnancy is a complex biological process which is associated with significant metabolic and hemodynamic changes of the maternal body which allow a normal fetal growth. The inability to adapt to these changes can affect the cardiovascular health. During pregnancy, women may experience mood swings, anxiety and emotional ambivalence. These symptoms can lead to stress and have a negative impact on the mental well-being of expectant mothers. It is crucial to know the aspects that can influence the development of cardiovascular problems among pregnant women in order to manage these cases properly. The current narrative review explores and summarizes the evidence regarding the impact of stress and anxiety on cardiovascular health in pregnant women. Understanding the physiological adaptations that the body undergoes throughout pregnancy is crucial for educating and supporting individuals as well as healthcare professionals. This enables them to recognize any risk factors or pathological conditions that may exacerbate pregnant women's health. In order to reduce maternal morbidity and mortality from cardiovascular disease, a psychological and cardiovascular risk factor screening that is done either before or during pregnancy may be able to identify situations that call for particular medical and/or psychological therapies.

Malaria comprises a spectrum of disease syndromes and the immune system is a major participant in malarial disease. This is particularly true in relation to the immune responses elicited against blood stages of Plasmodium-parasites that are responsible for the pathogenesis of infection. Mouse models of malaria are commonly used to dissect the immune mechanisms underlying disease. While no one mouse model of Plasmodium infection completely recapitulates all the features of malaria in humans, collectively the existing models are invaluable for defining the events that lead to the immunopathogenesis of malaria. Here we review the different mouse models of Plasmodium infection that are available, and highlight some of the main contributions these models have made with regards to identifying immune mechanisms of parasite control and the immunopathogenesis of malaria.

In this study, the degradation characteristics of radio-frequency (RF) low-noise amplifier (LNA) based on silicon-germanium (SiGe) heterojunction bipolar transistors (HBTs) due to total ionizing dose (TID) are investigated. The small-signal equivalent model of a SiGe HBT is utilized to analyze circuit-level performance including the input and the output matching and noise figure (NF). As a target circuit, an LNA with a cascode common-emitter stage with emitter degeneration is studied and the equation of each performance parameter is derived. The RF LNA fabricated using commercial 350 nm SiGe technology was exposed to X-ray irradiation with the total dose up to 3 Mrad (SiO2). The experimental results exhibit that modeled device parameters estimate the degraded circuit performance. In addition, the relative impact of each parameter on the circuit metrics is revealed, which is expected from the derived design equations. The key device parameters for modeling TID-induced circuit degradations include the base resistance, the transconductance, and the base-to-emitter capacitance.

Sperm DNA integrity and chromatin status serve as pivotal indicators of sperm quality, given their in-tricate link to sperm function, embryo development, and overall fertility. Defects in chromatin com-paction, which are often associated with compromised protamine content, can lead to damaged DNA strands. In this study, chromatin status and possible correlation with DNA damage was assessed in males of three mouse species: Mus musculus, M. spretus and M. spicilegus. We employed various staining methods, including aniline blue, methylene blue (Diff-Quik), toluidine blue and chromomy-cin A3, to assess chromatin compaction in cauda epididymal sperm. Samples were also analyzed by the sperm chromatin structure assay (SCSA) to estimate DNA fragmentation (%tDFI, %HDS). Analyses were carried out on freshly collected sperm and cells incubated for 3 h in a Hepes-buffered modified Tyrode's medium simulating conditions of the female reproductive tract. Notably, the analysis of chromatin status yielded minimal abnormal values across all three species, employing diverse meth-odologies. SCSA analyses revealed distinct variations in %tDFI between species. Following sperm incubation, the percentages of sperm stained with methylene blue exhibited differences among the species and were significantly correlated to the DNA fragmentation index. HDS demonstrated correla-tions with the percentages of sperm stained by aniline blue, methylene blue and chromomycin A3. Overall, chromatin compaction was high across all species, with limited differences among them. The relationship between chromatin status and DNA integrity appeared to be related to levels of sperm competition among species.

Aging is a major risk factor for Alzheimer's disease (AD). AD mouse models are frequently used to assess pathology, behavior, and memory in AD research. While the pathological characteristics of AD are well established, our understanding of the changes in the metabolic phenotypes with age and pathology is limited. In this work, we used the Promethion cage systems® to monitor changes in physiological metabolic and behavioral parameters with age and pathology in wild-type and 5xFAD mouse models. Then, we assessed whether these parameters could be altered by treatment with oleocanthal, a phenolic compound with neuroprotective properties. Findings demonstrated metabolic parameters such as body weight, food and water intake, energy expenditure, dehydration, and respiratory exchange rate, and the behavioral parameters of sleep patterns and anxiety-like behavior are altered by age and pathology. However, the effect of pathology on these parameters was significantly greater than normal aging, which could be linked to amyloid-β deposition and blood-brain barrier (BBB) disruption. In addition, and for the first time, our findings suggest an inverse correlation between sleep hours and BBB breakdown. Treatment with oleocanthal improved the assessed parameters and reduced anxiety-like behavior symptoms and sleep disturbances. In conclusion, aging and AD are associated with metabolism and behavior changes, with the changes being greater with the latter, which were rectified by oleocanthal. In addition, our findings suggest that monitoring changes in metabolic and behavioral phenotypes could provide a valuable tool to assess disease severity and treatment efficacy in AD mouse models.

Gamma-aminobutyric acid (GABA) and glycine act as inhibitory neurotransmitters. Three types of inhibitory neurons and terminals, GABAergic, GABA/glycine co-releasing, and glycinergic, are orchestrated in the spinal cord neural circuits and play key roles in the regulation of pain, locomotive movement, and respiratory rhythms. Herein, we first describe GABAergic and glycinergic transmission and inhibitory networks, which consist of three types of terminals, in the mature mouse spinal cord. Second, we describe the developmental formation of GABAergic and glycinergic networks, with specific focus on the differentiation of neurons, formation of synapses, maturation of removal systems, and changes in their action. GABAergic and glycinergic neurons are derived from the same domains of the ventricular zone. Initially, GABAergic neurons are differentiated and their axons form synapses. Some of these neurons remain GABAergic in lamina I and II. Many of GABAergic neurons convert to co-releasing state. The co-releasing neurons and terminals remain in the dorsal horn, whereas many of co-releasing ones ultimately become glycinergic in the ventral horn. During the development of terminals and the transformation from radial glia to astrocytes, GABA and glycine receptor subunit compositions markedly change, removal systems mature, and GABAergic and glycinergic action shifts from excitatory to inhibitory.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

Volatile compounds, abundant in breath, can be used to accurately diagnose and monitor a range of medical conditions. This offers a non-invasive, low-cost approach with screening applications; however, uptake of this diagnostic approach has been limited by conflicting published outcomes. Most published reports rely on large scale screening of the public, at single time points and without reference to ambient air. Here, we present a novel approach to volatile sampling from cellular headspace and mouse breath that incorporates multi-time point analysis and ambient air subtraction revealing compound flux as an effective proxy of active metabolism. This approach to investigating breath volatiles offers a new avenue for disease biomarker discovery and diagnosis. Using gas chromatography mass spectrometry (GC/MS), we focus on low molecular weight, metabolic substrate/by-product compounds and demonstrate that this non-invasive technique is sensitive (reproducible at ~1 µg cellular protein, or ~500,000 cells) and capable of precisely determining cell type, status and treatment. Isolated cellular models represent components of larger mammalian systems and we show that stress- and pathology-indicative compounds are detectable in mice, supporting further investigation using this methodology as a tool to identify volatile targets in human patients.

Magnetic resonance elastography (MRE) has revealed sexual dimorphism in brain stiffness in healthy individuals and multiple sclerosis (MS) patients. In the animal model of MS, experimental autoimmune encephalomyelitis (EAE), we showed previously that inflammation-induced brain softening was associated with alterations of the extracellular matrix (ECM). However, it remained unclear whether the brain ECM presents sex-specific properties that can be visualized by MRE. Therefore, we aimed here at quantifying sexual dimorphism in brain viscoelasticity in association with ECM changes in healthy and inflamed brains. Multifrequency MRE was applied to the midbrain of healthy and EAE mice of both sexes to quantitatively map regional stiffness. To define differences in brain ECM composition, gene expression of the key basement membrane components laminin (Lama4, Lama5), collagen (Col4a1, Col1a1) and fibronectin (Fn1) was investigated by RT-qPCR. We showed that the healthy male cortex expressed less Lama4, Lama5, Col4a1 but more Fn1 (all p < 0.05) than the healthy female cortex, which was associated with 9% softer properties (p = 0.044) in that region. At peak EAE, cortical softening was similar in both sexes compared to healthy tissue, with an 8% difference remaining between males and females during EAE (p < 0.001). Cortical Lama4, Lama5 and Col4a1 expression increased 2 to 3-fold in EAE in both sexes while Fn1 decreased only in males (all p < 0.05). No significant sex differences in stiffness were detected in other brain regions. In conclusion, sexual dimorphism in the ECM composition of cortical tissue in the mouse brain is reflected by in vivo stiffness measured with MRE and should be considered in future studies by sex-specific reference values.

Chronic Chagas Cardiomyopathy (CCC) results from infection with the protozoan parasite Trypanosoma cruzi and is a prevalent cause of heart disease in endemic countries. We previously found that cardiac fibrosis can vary widely in C3H/HeN mice chronically infected with T. cruzi JR strain, mirroring the spectrum of heart disease in humans. In this study, we examined functional cardiac abnormalities in this host:parasite combination to determine its potential as an experimental model for CCC. We utilized electrocardiography (ECG) to monitor T. cruzi-infected mice and determine whether ECG markers could be correlated with cardiac function abnormalities. We found that the C3H/HeN:JR combination frequently displayed early onset CCC indicators, such as sinus bradycardia and right bundle branch block, as well as prolonged PQ, PR, RR, ST and QT intervals in the acute stage. Our model exhibited high levels of cardiac inflammation and enhanced iNOS expression in the acute stage, but denervation did not appear to have a role in pathology. These results demonstrate the potential of the C3H/HeN:JR host:parasite combination as a model for CCC that could be used for screening new compounds targeted at cardiac remodeling and for examining the potential of anti-parasitic drugs to prevent or alleviate CCC development and progression.

Coxsackievirus B3 (CVB3) is one of the most common pathogens that cause myocarditis in humans. However, a sufficient therapeutic drug was not developed yet. Caboxamycin, a benzoxazole antibiotic, isolated from the culture broth of the marine strain Streptomyces sp., SC0774, displayed an antiviral effect in the CVB3-infected HeLa cells and CVB3-induced myocarditis mouse model. Caboxamycin significantly inhibited CVB3 VP1 production and cleavage of translation factor eIF4G1 from CVB3-infected HeLa cells at a 100 μg/ml concentration. Moreover, virus RNA amplification was dramatically reduced by caboxamycin treatment in HeLa cells. The caboxamycin cardiac protective effect was observed on the CVB3-mediated myocarditis mice model. The caboxamycin-treated mice survival was significantly increased compared to untreated mice (treated vs untreated, 100 vs 45 %). Heart histologic findings showed that myocardium damage and inflammation were significantly decreased by caboxamycin treatment. Caboxamycin directly inhibited caspase3 activity and cardiac myocytes apoptosis. These results suggested that caboxamycin strongly suppressed cardiac myocyte apoptosis and effectively inhibited the proliferation of CVB3 from in vitro and in vivo conditions. Furthermore, this study proposed that caboxamycin could potentially be applied in developing a new antiviral drug for CVB3-induced myocarditis.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

Ferroptosis is a unique variety of non-apoptotic cell death, driven by massive lipid oxidation in an iron-dependent manner. Since Ferroptosis was introduced as a concept in 2012, it was shown it's essential role in the pathogenesis in neurodegenerative diseases and an important role in therapy-resistant cancer cells. Thus, a detailed molecular understanding of both canonical and alternative ferroptosis pathways are required. There is a set of widely used chemical agents to modulate ferroptosis using different pathway targets: Erastin blocks cystine-glutamate antiporter, system xc-; ML210 directly inactivate GPX4; L-buthionine sulfoximine (BSO) inhibits γ-glutamylcysteine synthetase, an essential enzyme for glutathione synthesis de novo. Most studies were focused on lipidomic profiling of model systems undergoing death in a ferroptotic modality.

Miscarriage due to blastocyst implantation failure occurs in up to two-thirds of all miscarriage cases in human. The calcium ion has been shown to be involved in many cellular signal transduction pathways as well as in the regulation of cell adhesion, which is necessary for the embryo implantation process. Exposure to endocrine-disrupting chemicals (EDs) during early gestation results in disruption of intrauterine implantation and uterine reception, leading to implantation failure. In this study, ovarian estrogen (E2), bisphenol A (BPA), or 4-tert-octylphenol (OP), with or without ICI 182,780 (ICI) were injected subcutaneously from gestation day 1 to gestation day 3 post-coitus. The expression levels of the calcium transport genes were assessed in maternal uteri and implantation sites. The number of implantation sites was significantly low in the OP group, and implantation sites were absent in the E2 and EDs+ICI groups. There were different calcium transient transport channel expression levels in uterus and implantation site samples. The levels of TRPV5 and TRPV6 gene expression were significantly increased by EDs with/without ICI treatment in uterus. Whereas, TRPV5 and TRPV6 gene expression were significantly lower in implantation sites samples. NCX1 and PMCA1 mRNA levels were significantly decreased by OP and BPA in the implantation site samples. Compared to vehicle treatment in uterus, both the MUC1 mRNA and protein levels were markedly high in all but the BPA group. Taken together, these results suggest that both BPA and OP can impair embryo implantation through alteration of calcium transport gene expressions and by affecting uterine receptivity.

Molecular modeling is widely utilized in subjects including but not limited to physics, chemistry, biology, materials science and engineering. Impressive progress has been made in development of theories, algorithms and software packages. To divide and conquer, and to cache intermediate results have been long standing principles in development of algorithms. Not surprisingly, Most of important methodological advancements in more than half century of molecule modeling are various implementations of these two fundamental principles. In the mainstream classical computational molecular science based on force fields parameterization by coarse graining, tremendous efforts have been invested on two lines of algorithm development. The first is coarse graining, which is to represent multiple basic particles in higher resolution modeling as a single larger and softer particle in lower resolution counterpart, with resulting force fields of partial transferability at the expense of some information loss. The second is enhanced sampling, which realizes "dividing and conquering" and/or "caching" in configurational space with focus either on reaction coordinates and collective variables as in metadynamics and related algorithms, or on the transition matrix and state discretization as in Markov state models. For this line of algorithms, spatial resolution is maintained but no transferability is available. Deep learning has been utilized to realize more efficient and accurate ways of "dividing and conquering" and "caching" along these two lines of algorithmic research. We proposed and demonstrated the local free energy landscape approach, a new framework for classical computational molecular science and a third class of algorithm that facilitates molecular modeling through partially transferable in resolution "caching" of distributions for local clusters of molecular degrees of freedom. Differences, connections and potential interactions among these three algorithmic directions are discussed, with the hope to stimulate development of more elegant, efficient and reliable formulations and algorithms for "dividing and conquering" and "caching" in complex molecular systems.

The author demonstrates a stable Lagrangian solid modeling method, tracking the interactions of solid mass particles rather than using a meshed grid. This numerical method avoids the problem of tensile instability often seen with smooth particle applied mechanics by having the solid particles apply stresses expected with Hooke's law, as opposed to using a smoothing function for neighboring solid particles. This method has been tested successfully with a bar in tension, compression, and shear, as well as a disk compressed into a flat plate, and the numerical model consistently matched the analytical Hooke's law as well as Hertz contact theory for all examples. The solid modeling numerical method was then built into a 2-D model of a pressure vessel, which was tested with liquid water particles under pressure and simulated with smoothed particle hydrodynamics. This simulation was stable, and demonstrated the feasibility of Lagrangian specification modeling for fluid–solid interactions.

Asphaltene is a component of crude oil that, if mishandled, may create substantial transportation and industrial concerns. It is a solid by nature, with a diverse set of molecular compositions. Furthermore, the oil industry has identified emulsion generation and clogging precipitate as key concerns. The emulsified water droplets in the process are just what give the raw oil its increased viscosity; hence, power is squandered to transport the oil around. The information has been separated into sections based on simulation, solubilization, agglomeration, precipitation, and evidence of model chemicals in the literature. We have included research that investigates the bulk rheology and interfacial rheology of asphaltene to describe its interfacial activity more clearly.

The aim of this study is to model hydrodynamic processes of the Istanbul Strait with its stratified flow characteristic and calibrate the most important parameters using local and global search algorithms. For that two open boundary conditions are defined, which are in the North and South part of the Strait. Observed bathymetric, hydrographic, meteorological and water level data are used to set up the Delft3D-FLOW model. First, the sensitivities of model parameters on the numerical model outputs are assessed using PEST toolbox. Then, the model is calibrated based on the objective functions focusing on the flowrates of upper and lower layers. The salinity and temperature profiles of the Strait are only used for model validation. The results show that the calibrated model outputs of Istanbul Strait are reliable and consistent with the in-situ measurements. The sensitivity analysis reveals that the Spatial Low-Pass Filter Coefficient, Horizontal Eddy Viscosity, Prandtl-Schmidt Number, Slope in log-log Spectrum and Manning Roughness Coefficient are most sensitive parameters affecting flowrate performance of the model. The agreement between observed salinity profiles and simulated model outputs is promising whereas the match between observed and simulated temperature profiles is weak showing that the model can be improved particularly for simulating the mixing layer.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Research on microglia in Down syndrome (DS) has shown that microglial activation, increased inflammatory gene expression, and oxidative stress occur at different ages in DS brains. However, most studies resulted in simplistic definitions of microglia as quiescent or active, ignoring potential intermediate states. However, a recent work on microglial cells in young DS brains indicated that those evolve through different intermediate activation phenotypes before reaching a full activated state. Here we used single nucleus RNA sequencing, to examine how trisomy affects microglial states in the Ts65Dn mouse model of DS. Despite no substantial changes in the proportion of glial populations, differential expression analysis revealed cell type-specific gene expression changes, most notably in astroglia, microglia, and oligodendroglia. Focusing on microglia, we identified differential expression of genes associated with different microglial states, including disease-associated microglia (DAMs), activated response microglia (ARMs), and human Alzheimer’s disease microglia (HAMs), in trisomic microglia. Furthermore, pseudotime analysis reveals a unique reactivity profile in Ts65Dn microglia, with fewer in a homeostatic state and more in an intermediate aberrantly reactive state than in euploid microglia. This comprehensive understanding of microglial transcriptional dynamics sheds light on potential pathogenetic mechanisms but also possible avenues for therapy for neurodevelopmental disorders.

A cell-surface ectonucleotidase CD39 mediates the conversion of extracellular ATP into immunosuppressive adenosine with another ectonucleotidase CD73. The elevated adenosine in the tumor microenvironment (TME) attenuates antitumor immunity, which promotes tumor cell immunologic escape and progression. Anti-CD39 monoclonal antibodies (mAbs), which suppress the enzymatic activity, can be applied to antitumor therapy. Therefore, an understanding of the relationship between the inhibitory activity and epitope of mAbs is important. We previously established an anti-mouse CD39 (mCD39) mAb, C₃₉Mab-1 using the Cell-Based Immunization and Screening (CBIS) method. In this study, we determined the critical epitope of C₃₉Mab-1 using flow cytometry. We performed the PA tag (12 amino acids)-substituted analysis (named PA scanning) and RIEDL tag (5 amino acids)-substituted analysis (named RIEDL scanning) to determine the critical epitope of C₃₉Mab-1 using flow cytometry. By the combination of PA scanning and RIEDL scanning, we identified the conformational epitope, spanning three segments of 275^th to 279^th, 282^nd to 291^st, and 306^th to 323^rd amino acids of mCD39. These analyses would contribute to the identification of the conformational epitope of membrane proteins.

Cyclin-dependent kinase-like 5 (CDKL5) deficiency disorder (CDD) is a rare neurodevelopmental disease caused by mutations in the X-linked CDKL5 gene. CDD is characterized by a broad spectrum of clinical manifestations, including early-onset refractory epileptic seizures, intellectual disability, hypotonia, visual disturbances, and autism-like features. The Cdkl5 knockout (KO) mouse recapitulates several features of CDD, including autistic-like behavior, impaired learning and memory, and motor stereotypies. These behavioral alterations are accompanied by diminished neuronal maturation and survival, reduced dendritic branching and spine maturation, and marked microglia activation. There is currently no cure or effective treatment to ameliorate the symptoms of the disease. Aerobic exercise is known to exert multiple beneficial effects in the brain, not only by increasing neurogenesis, but also by improving motor and cognitive tasks. To date, no studies have analyzed the effect of physical exercise on the phenotype of a CDD mouse model. In view of the positive effects of voluntary running on the brain of mouse models of various human neurodevelopmental disorders, we sought to determine whether voluntary daily running, sustained over a month, could improve brain development and behavioral defects in Cdkl5 KO mice. Our study showed that long-term voluntary running improved hyperlocomotion and impulsivity behaviors, and memory performance of Cdkl5 KO mice. This is correlated with increased hippocampal neurogenesis, neuronal survival, spine maturation, and inhibition of microglia activation. These behavioral and structural improvements were associated with increased BDNF levels. Given the positive effects of BDNF on brain development and function, the present findings support the positive benefits of exercise as an adjuvant therapy for CDD.

The vascular endothelium is key target for immune, and thrombotic responses that has to be controlled in successful xenotransplantation. Several genes were identified that if induced or overexpressed help to regulate the inflammatory response and preserve the transplanted organ function and metabolism. However, few studies addressed combined expression of such genes. The aim of this work was to evaluate in vivo the effects of the simultaneous expression of a three human genes in a mouse generated using the multi-cistronic F2A technology. Male 3-month-old mice that express human heme oxygenase 1 (hHO-1), ecto-5’-nucleotidase (hE5NT), and ecto-nucleoside triphosphate diphosphohydrolase 1 (hENTPD1) (Transgenic) were compared to wild-type FVB mice (Control). Background analysis include extracellular nucleotide catabolism enzymes profile on the aortic surface, blood nucleotide concentration and serum L-arginine metabolites. Furthermore, inflammatory stress induced by LPS in transgenic and control mice was used to characterize interleukin 6 (IL-6) and adhesion molecules endothelium permeabil-ity responses. Transgenic mice had significantly higher rates of extracellular adenosine triphosphate and adenosine monophosphate hydrolysis on the aortic surface in comparison to control. Increased levels of blood AMP and adenosine were also noticed in transgenics. Moreover, transgenic ani-mals demonstrated the decrease in serum monomethyl-L-arginine level and a higher L-arginine/ monomethyl-L-arginine ratio. Importantly, significantly decreased serum IL-6, and adhesion mol-ecule levels were observed in transgenic mice in comparison to control after LPS treatment. Fur-thermore, reduced endothelial permeability in the LPS-treated transgenic mice was noted as com-pared to LPS-treated control. The human enzymes (hHO-1, hE5NT, hENTPD1) simultaneously encoded in transgenic mice demonstrated benefits in sev-eral biochemical and functional aspects of endothelium. This is consistent in use of this approach in the context of xenotransplantation.

Non-alcoholic steatohepatitis (NASH), which is the most severe manifestation of non-alcoholic fatty liver disease (NAFLD), has been recognized as a major hepatocellular carcinoma (HCC) catalyst. However, the molecular mechanism of NAFLD-NASH-HCC sequence remains unclear and a specific and effective treatment for NASH has not yet been established. The progress in this field depends on the availability of reliable preclinical models which show the steady progress to NASH, liver cirrhosis, and HCC. However, most of NASH mouse models that have been described to date develop NASH generally for more than 24 weeks and there is an uncertainty of HCC development. To overcome such shortcomings of experimental NASH studies, we established a novel NASH-HCC mouse model with very high reproducibility, generality, and convenience. We treated male C57BL/6J mice with a newly developed choline-deficient and methionine-restricted high-fat diet (CDMRHFD) for 60 weeks. Treatment of CDMRHFD for 3 weeks revealed marked steatosis, lobular inflammation, and fibrosis, histologically diagnosed as NASH. Liver cirrhosis was observed in all mice with 36-week treatment. Liver nodule emerged at 12 weeks of the treatment, and diameter >2 mm liver tumors developed in all mice at 24 weeks of the treatment. In conclusion, our rapidly progressive and highly reproducible NASH-liver cirrhosis-HCC model is helpful for preclinical development and research on the pathogenesis of human NAFLD-NASH-HCC. Our mouse model would be useful for the development of novel chemistry for NASH-HCC-targeted therapies or HCC prevention strategies.

Two putative boar pheromones (Androstenone and Androstenol) were discovered in endangered mouse deer during captive breeding program. This study further examined the molecular characteristics, pheromone synthesis pathway, and the functional role of these pheromones in reproduction of mouse deer. CYP17A1 and CYB5 genes were cloned and expressed in HEK-293, COS-7 cell lines and gonads of mouse deer to investigate CYP17A1 gene’s andien-β-synthase activity towards synthesis of sex pheromones in mouse deer. An enzyme immunoassay was also developed and standardized to measure the fecal androstenone during reproductive cycles of mouse deer. Results showed that mouse deer’s CYP17A1 gene possesses andien-β-synthase activity and could transform pregnenolone into 5,16-androstadien-3β-ol. The expression of CYP17A1 gene upregulated in the testis and ovary, compared to other tissues in mouse deer. Significantly elevated pheromones and estrogens were recorded prior to delivery and postpartum estrus / mating in mouse deer. Further, there were weak correlations between fecal pheromones and estrogens/ androgens in mouse deer during breeding season. The findings suggest that the boar pheromones might play a direct role in the reproductive activities of mouse deer which might be used for breeding of mouse deer elsewhere.

Ketogenic diet (KD) is getting in the focus as auxiliary cancer therapy, since it provides sufficient energy supply for healthy cells, while impairing energy production in tumor cells underlying the Warburg effect. Thereby, it can assist in inhibiting tumor growth and simultaneously counteract cachexia, which is frequently observed in cancer patients under chemotherapy. In order to provide molecular evidence for the proposed synergistic inhibition of tumor growth, we applied untargeted quantitative metabolome analysis on a breast cancer xenograft mouse model. Healthy mice and such bearing breast cancer xenografts and receiving chemotherapy were compared after treatment with control diet and KD. Metabolomic profiling was performed on plasma samples, applying high-performance liquid chromatography coupled to tandem mass spectrometry. Statistical analysis revealed metabolic fingerprints comprising numerous significantly regulated features in the group of mice bearing breast cancer. This fingerprint disappeared after treatment with KD, resulting in recovery to the metabolic status observed in healthy mice receiving control diet. Moreover, amino acid metabolism as well as fatty acid transport were found to be affected by both, the tumor and the applied KD. Our results provide clear evidence of a significant molecular effect of KD in the context of tumor growth inhibition.

Background/Goals: The gut hormone PYY secreted from intestinal L-cells has been implicated in the mechanisms of satiation via Y2-receptor (Y2R) signaling in the brain and periphery and is a major candidate for mediating the beneficial effects of bariatric surgery on appetite and body weight. Methods: Here we assessed the role of Y2R signaling in the response to low- and high-fat diets and its role in the effects of Roux-en-Y gastric bypass (RYGB) surgery on body weight, body composition, food intake, energy expenditure and glucose handling, in global Y2R-deficient (Y2RKO) and wildtype mice made obese on high-fat diet. Results: Both male and female Y2RKO mice responded normally to low- and high-fat diet in terms of body weight, body composition, fasting levels of glucose and insulin, as well as glucose and insulin tolerance for up to 30 weeks of age. Contrary to expectations, obese Y2RKO mice also responded similarly to RYGB compared to WT mice for up to 20 weeks after surgery, with initial hypophagia, sustained body weight loss, and significant improvements in fasting insulin, glucose tolerance, HOMA-IR, and liver weight compared to sham-operated mice. Furthermore, non-surgical Y2RKO mice weight-matched to RYGB showed the same improvements in glycemic control as Y2RKO mice with RYGB that were similar to WT mice. Conclusions: PYY signaling through Y2R is not required for the normal appetite-suppressing and body weight-lowering effects of RYGB in this global knockout mouse model. Potential compensatory adaptations of PYY signaling through other receptor subtypes or other gut satiety hormones such as GLP-1 remain to be investigated.

C-C motif chemokine receptor 1 (CCR1/CD191) is a member of G-protein-coupled receptors, and is expressed on myeloid cells, such as neutrophils and macrophages. Because the CCR1 signaling promotes tumor expansion in the tumor microenvironment (TME), the modification of TME is an effective strategy for cancer therapy. Although CCR1 is an attractive target for solid tumors and hematological malignancies, anti-CCR1 therapeutic agents have not been approved. Here, we established a novel anti-mouse CCR1 (mCCR1) monoclonal antibody (mAb), C₁Mab-6 (rat IgG_2b, kappa), using the Cell-Based Immunization and Screening (CIBS) method. Flow cytometry and Western blot analyses showed that C₁Mab-6 recognizes mCCR1 specifically. The dissociation constant of C₁Mab-6 for mCCR1-overexpressed Chinese hamster ovary-K1 was determined as 3.9×10^-9 M, indicating that C₁Mab-6 possesses a high affinity to mCCR1. These results suggest that C₁Mab-6 could be a useful tool for targeting CCR1 in preclinical mouse models.

The differentiation of ESCs into cardiomyocytes in vitro is an excellent and reliable model system for studying normal cardiomyocyte development in mammals, modeling cardiac diseases, and for use in drug screening. Mouse ESC differentiation still provides relevant biological information about cardiac development. However, the current methods for efficiently differentiating ESCs into cardiomyocytes are limiting. Here, we describe a “WNT Switch” method to efficiently commit mouse ESCs into cardiomyocytes using the small molecule WNT signaling modulators CHIR99021 and XAV939 in vitro. This method significantly improves the yield of beating cardiomyocytes, reduces number of treatments, and is less laborious.

Atherogenic lipoproteins may impair vascular reactivity, leading to tissue damage in various organs, including the eye. This study aimed to investigate whether ophthalmic artery reactivity is affected in mice lacking the apolipoprotein E gene (ApoE-/-), a model for hypercholesterolemia and atherosclerosis. Twelve-month-old male ApoE-/- mice and age-matched wild-type controls were used to assess vascular reactivity using videomicroscopy. Moreover, vascular mechanics, lipid content, levels of reactive oxygen species (ROS), expression of pro-oxidant redox enzymes and of the lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) were determined in vascular tissue. Unlike the aorta, the ophthalmic artery of ApoE-/- mice developed no signs of endothelial dysfunction and no signs of excessive lipid deposition. Remarkably, levels of ROS, nicotinamide adenine dinucleotide phosphate oxidase 1 (NOX1), NOX2, NOX4, and of LOX-1 were increased in the aorta but not in the ophthalmic artery of ApoE-/- mice. Our findings suggest that ApoE-/- mice develop endothelial dysfunction in the aorta by increased oxidative stress via involvement of LOX-1, NOX1 and NOX2, whereas NOX4 may participate in media remodeling. In contrast, the ophthalmic artery appears to be resistant to chronic apolipoprotein E deficiency. Lack of LOX-1 expression/overexpression in response to increased ox-LDL levels may be a possible mechanism of action.

The CC chemokine receptor 3 (CCR3) is a receptor for CC chemokines, including CCL5/RANTES, CCL7/MCP-3, and CCL11/eotaxin. CCR3 is expressed on the surface of eosinophils, basophils, a subset of Th2 lymphocytes, mast cells, and airway epithelial cells. CCR3 and its ligands are involved in airway hyperresponsiveness in allergic asthma, ocular allergy, and cancers. Therefore, CCR3 is an attractive target for those therapies. Previously, anti-mouse CCR3 (mCCR3) monoclonal antibodies (mAbs), C3Mab-3 (rat IgG2a, kappa), and C3Mab-4 (rat IgG2a, kappa) were developed using the Cell-Based Immunization and Screening (CBIS) method. In this study, the binding epitope of these mAbs was investigated using flow cytometry. The CCR3 extracellular domain-substituted mutant analysis showed that C3Mab-3, C3Mab-4, and a commercially available mAb (J073E5) recognized the N-terminal region (amino acids 1–38) of mCCR3. Next, the alanine scanning was conducted in the N-terminal region. The results revealed that Ala2, Phe3, Asn4, and Thr5 of mCCR3 are involved in C3Mab-3 binding, whereas Ala2, Phe3, and Thr5 are essential to C3Mab-4 binding, and Ala2 and Phe3 are crucial to J073E5 binding. These results reveal the involvement of the N-terminus of mCCR3 in the recognition of C3Mab-3, C3Mab-4, and J073E5.

Background: Pre-treatment with lipopolysaccharide (LPS) protected the kidney against a later lethal ischemia. To reveal the mechanisms of renal cross-tolerance and septic acute kidney injury we investigated the effects of LPS on miRNA expression in the kidney. Methods: Male NMRI mice were injected with 40 and 10 mg/kg LPS ip. and sacrificed at 1.5 and 6 hours (early preconditioning, EP) and at 24 and 48 hours (late preconditioning, LP). The miRNA profile was established using miRCURY LNA™ microarray and confirmed with qPCR. Results: Plasma urea concentration peaked at 24 hours after LPS and decreased thereafter. Renal TNF-α and IL-6 mRNA were extremely elevated at all time-points. miRNome changes were mild at 1.5 hours, most miRNAs were altered at 6 and 24 hours and declined by 48 hours. Not all miRNAs could be assayed or validated by qPCR. In EP miR-762 was newly identified and validated and was the most elevated miRNA with both methods. In LP miR-21a-5p was the most influenced miRNA followed by miR-451a, miR-144-3p and miR-146a-5p. MiR-21a-3p increased significantly in both EP and LP. Conclusion: miR-762 might attenuate the LPS-induced immune response during EP and the miR-144/451 cluster is involved in LPS-induced renal preconditioning.

Most human genetic disease arises from point mutations. These genetic diseases can theoretically be corrected by gene therapy but clinic practice is still far from mature. Nearly half of the pathogenic single-nucleotide polymorphisms (SNPs) are caused by G:C>A:T or T:A>C:G base changes. The best current methods to repair these changes are by base editing without footprint using recently developed CRISPR-Cas9 technology by David Liu’s lab. These base editing methods have been confirmed with precision and efficiency in cultured mammalian cells, but it is barely confirmed and the efficiency is still very low. Animal models are important in dissecting pathogenic mechanism for human genetic diseases and efficacy testing of base correction in vivo. Cytidine base editor BE4 is a newly developed version of cytidine base editing system that converts cytidine (C) to uridine (U) in cultured mammalian cells but has not been proven in vivo. In this study, we have tested this system in cells to inactivate GFP gene and in mice by introducing single-base substitution that leads to a stop codon in tyrosinase gene. High percentage albino coat-colored mice were obtained from black coat-colored donor zygotes after pronuclei microinjection. Sequencing results showed that expected base changes were obtained with high precision and efficiency (56.25%). There are no off-targeting events identified in predicted off-target sites. Results confirm BE4 system can work in vivo with high precision and efficacy, and has great potentials in clinic to repair human genetic mutations.

Hemodynamic relevance of differently located stenoses of the internal jugular veins remains undetermined. It particularly concerns nozzle-like strictures in the upper parts of these veins and stenotic jugular valves located at the end of this vein. This study was aimed at understanding flow disturbances caused by such stenoses. Computational fluid dynamics software, Flowsquare+, was used. We constructed 3-dimensional models of venous outflow, comprising two alternative routes: tube representing the internal jugular vein and irregular network representing the vertebral veins. At the beginning of the tube representing the internal jugular vein, differently-shaped and sized short strictures, representing nozzle-like strictures were built in. At the end of this tube, differently-shaped membranes, representing the jugular valve, were built in. With the use of computational fluid dynamics modeling, we studied how these two obstacles influenced the outflow. We found that the most relevant outflow disturbances were evoked by nozzle-like strictures in the upper part of the internal jugular vein that were either small, long or asymmetrically positioned. Very tight stenotic valves and septum-like malformed valve were equally hemodynamically relevant. These findings suggest that both upper and lower strictures of the internal jugular vein can be of clinical significance.

Cirina forda caterpillars are a significant protein source in Central Africa, yet their preservation and consumption pose challenges. This study investigates the drying of Cirina forda caterpillars to enhance preservation methods and product quality. Caterpillars were subjected to drying experiments at temperatures ranging from 40°C to 70°C, using tunnel and oven dryers. The drying kinetics was analyzed using mathematical models, revealing a water diffusion-limited mechanism in all the tested conditions. The Newton model provided adequate estimations of the drying behavior, facilitating further practical dryer design. Shrinkage analysis indicated a two-step process independent of the drying conditions. Achieving a moisture content suitable for prolonged storage resulted in substantial volume loss, highlighting the challenges of preserving dried caterpillars. These findings shed light on how to optimize drying processes for Cirina forda caterpillars, crucial for sustaining protein sources in Central Africa.

Modeling what makes an advertisement persuasive, i.e., eliciting the desired response from consumer, is critical to the study of propaganda, social psychology, and marketing. Despite its importance, computational modeling of per- suasion in computer vision is still in its infancy, primarily due to the lack of benchmark datasets that can provide persuasion-strategy labels associated with ads. Motivated by persuasion literature in social psychology and marketing, we introduce an extensive vocabulary of persuasion strategies and build the first ad image corpus annotated with persuasion strategies. We then formulate the task of persuasion strategy prediction with multi-modal learning, where we design a multi-task attention fusion model that can leverage other ad-understanding tasks to predict persuasion strategies. Further, we conduct a real-world case study on 1600 advertising campaigns of 30 Fortune-500 companies where we use our model’s predictions to analyze which strategies work with different demographics (age and gender). The dataset also provides image segmentation masks, which labels persuasion strategies in the corresponding ad images on the test split. We publicly release our code and dataset: https://midas-research.github.io/persuasion-advertisements/

The aim of this work is to introduce a mathematical model representing the evolution of the temperature in a vegetation cover and the ground underneath it. Vegetation, and its interaction with soil, plays a very important role in the protection of soil surface from the action of sun and precipitations. A reduction in the vegetated mass increase the risk of desertification, soil erosion or surface runoffs which which can give rise to soil loss and sediment retention. These processes can favour climate change and global warming, which are major concerns nowadays. The mathematical model presented takes into account the main processes involved in vegetation cover and the interaction with the soil, among which, we can mention the Leaf Area Index, which is a dimensionless quantity defined as the one-sided green leaf area per unit ground surface area, or albedo and co-albedo which are clearly influenced by the vegetation. It is also considered a nonlinear heat capacity in the soil which incorporates the latent heat of fusion, when the phase change takes place. The numerical technique used to solve the mathematical model is based on a finite volume scheme with Weighted Essentially Non Oscillatory technique for spatial reconstruction and the third order Runge-Kutta Total Variation Diminishing numerical scheme is used for time integration. Some numerical examples are solved to obtain the distribution of temperature both in the vegetation cover and the soil.

Factorization reduces computational complexity and is therefore an important tool in statistical machine learning of high dimensional systems. Conventional molecular modeling, including molecular dynamics and Monte Carlo simulations of molecular systems, is a large research field based on approximate factorization of molecular interactions. Recently, the local distribution theory was proposed to factorize global joint distribution of a given molecular system into trainable local distributions. Belief propagation algorithms are a family of exact factorization algorithms for trees and are extended to approximate loopy belief propagation algorithms for graphs with loops. Despite the fact that factorization of probability distribution is their common foundation, computational research in molecular systems and machine learning studies utilizing belief propagation algorithms have been carried out independently with respective track of algorithm development. The connection and differences among these factorization algorithms are briefly presented in this perspective, with the hope to intrigue further development in factorization algorithms for physical modeling of complex molecular systems.

There are many pollution and environment problem in the human ecosystem. There are different methods are used to removal of sulfur from sour gases for example Basic Claus process and Modified Claus process . There are different chemical software are used for simulation and optimization of Claus process for example Aspen Plus and Chemcad ECT. The Gibbs free energy method is introduced and model of Claus process. There are new parameter are introduced in reaction furnace to reduce the error from 33% to 7 %. The waste heat boiler is installed at the reaction furnace in which high pressure stream is produced and study the decomposition the hydrogen sulphide. The new rate of reaction is introduced of the enhancement of H2 production in chemical process. The simulation of reaction furnace in Aspen plus software is the maximum utilization of process. Due to suitable operating condition of reaction furnace is caused the maximum destruction of ammonia gas in the reactor. When we are increasing the oxygen concentration and temperature of feed is causing decreasing the ammonia production in reaction furnace. It is below than acceptance value of ammonia is 150 ppm in the reaction furnace. The presence of oxygen components, Sulfur oxide, hydroxide components are effect on decreasing the amount of ammonia in furnace and temperature is about at 1350⁰C. It is noted that when the production of sulfur recovery is decrease in Claus process and the production of carbon monoxide is increase in the thermal section at the existence. Now we are work on parametric studies of furnace that could be causes the production of ammonia destruction and CO emission in the Claus process. Due to optimize the reaction furnace parameter are help to get large of sulfur production, ammonia gas destruction, increased the catalyst life and decreased of dangerous gases.

Design and advancement of the durable urban train infrastructures are of utmost importance for reliable mobility in the smart cities of the future. Given the importance of urban train lines, tunnels, and subway stations, these structures should be meticulously analyzed. In this research, two-dimensional modeling and analysis of the soil-structure mass of the Alan Dasht station of Mashhad Urban Train are studied. The two-dimensional modeling was conducted using Hashash’s method and displacement interaction. After calculating the free-field resonance and side distortion of the soil mass, this resonance was entered into PLAXIS finite element program, and finally, stress and displacement contours together with the bending moment, shear force and axial force curves of the structure were obtained.

This paper deals with the analytical modeling and control of rectilinear snake robots. During recent times snake robots have created much interest among researchers. The rectilinear pattern gait is one of the four biological snake locomotion modes. Rectilinear snakes have been widely used in rescue operations especially in rough terrains especially in narrow spaces where human intervention is not easy. Computational analysis of rectilinear motion is done using MATLAB.

This study analyzes the modeling and dynamics of a novel passive in Multi-Degree-of-Freedom (MDOF) vibration isolation platform which can achieve significant isolation effect. Symmetrical Scissor-Like structures (SLSs) are utilized in the proposed MDOF isolation platform as the supporting and isolation elastic components. Based on the mathematical modeling and theoretical analysis of the MDOF vibration isolation system with SLSs, the effect of structural parameter and joint friction on stiffness and damping properties is investigated. It is shown that due to geometric relations within the SLSs, the natural frequencies can be reduced via adjusting structural parameters of the SLS for different direction vibration isolation. Theoretical and experimental results show that the SLS isolation platform can achieve much better loading capacity and vibration isolation performance simultaneously by only using linear passive components because of the MDOF adjustable stiffness property. Therefore, with low costing and energy consumption, the proposed novel isolation platform can provide the improvement of vibration suppression in various engineering practices.

The physics of the human brain has two components – basic physics common to all mammals and the physics of thinking inherent only in man. The development of the mental component of the structural and functional organization of the brain in phylogeny was associated with the chiral factor of the external environment, and in ontogenesis - with the social factor. The sensitivity of the brain to these factors was based on the single-connected nature of its aqueous basis, the mechanism of electromagnetic induction, and the features of the thermodynamics of the brain in a state of night sleep. In order to unify the description of the mechanism of electromagnetic processes in the brain, the concept of a quasiphoton has been introduced, combining all forms of excitation of electronic and molecular-cellular structures of the brain. Equivalent schemes of vibrational contours of neural network elements and macrostructures of the brain are proposed. Estimates of the kinetic parameters (activation energy, velocity) of the physical processes underlying the energy-information exchange of the brain with the external environment are made. Mechanisms of operative (physical) and permanent (chemical) memory of the brain, including a model of nonlocal quantum correlations, are discussed.

In order to alter and adjust the shape of the membrane, cells harness various mechanisms of curvature generation. Many of these curvature generation mechanisms rely on the interactions between peripheral membrane proteins, integral membrane proteins, and lipids in the bilayer membrane. One of the challenges in modeling these processes is identifying the suitable constitutive relationships that describe the membrane free energy that includes protein distribution and curvature generation capability. Here, we review some of the commonly used continuum elastic membrane models that have been developed for this purpose and discuss their applications. Finally, we address some fundamental challenges that future theoretical methods need to overcome in order to push the boundaries of current model applications.

Our study investigated the innate immune response to Toxoplasma gondii infection by assessing microglial phenotypic changes and sickness behavior as inflammatory response markers post-ocular tachyzoite instillation. Disease progression in Swiss albino mice was compared with documented outcomes in BALB/c mice using identical ocular route and parasite burden (2x105 tachyzoites), with saline as control. Contrary to expectations, Swiss albino mice displayed rapid, lethal disease progression, marked by pronounced sickness behaviors and mortality within 11-12 days post-infection, while survivors showed no apparent signs of infection. Comparative analysis revealed T. gondii-infected BALB/c mice exhibited reduced avoidance of feline odors, while in-fected Swiss albino mice showed enhanced avoidance responses. There was a significant increase in microglial cells in the dentate gyrus molecular layer of infected Swiss albino mice compared to BALB/c mice and their respective controls. Hierarchical cluster and discriminant analyses iden-tified three microglial morphological clusters, differentially affected by T. gondii infection across strains. BALB/c mice exhibited increased microglial branching and complexity, while Swiss al-bino mice showed reduced shrunk microglial arbors, diminishing morphological complexity. These findings highlight strain-specific differences in disease progression and inflammatory reg-ulation, indicating lineage-specific mechanisms in inflammatory responses, tolerance, and re-sistance. These elements are critical in devising control measures for toxoplasmosis.