The zebrafish is now an important model organism for cancer biology studies and provides some unique and complementary opportunities in comparison to the mammalian equivalent. The translucency of zebrafish has allowed in vivo live imaging studies of tumour initiation and progression at the cellular level thus providing novel insights into our understanding of cancer. Here we summarise and discuss available transgenic zebrafish tumour models and what we have gleaned from them with respect to cancer inflammation. In particular, we focus on the host inflammatory response toward transformed cells during the pre-neoplastic stage of tumour development. We discuss features of tumour associated macrophages and neutrophils in mammalian models and present evidence which supports the idea that these inflammatory cells promote early stage tumour development and progression. Direct live imaging of tumour initiation in zebrafish models has shown that the intrinsic inflammation induced by pre-neoplastic cells is tumour promoting. Signals mediating leukocyte recruitment to pre-neoplastic cells in zebrafish correspond to signals mediating leukocyte recruitment in mammalian tumours. The activation state of macrophages and neutrophils recruited to pre-neoplastic cells appears to be heterogenous, as seen in mammalian models, which provides an opportunity to study the plasticity of innate immune cells during tumour initiation. Although several potential mechanisms are described that might mediate the trophic function of innate immune cells during tumour initiation in zebrafish, there are several unknowns that are yet to be resolved. Rapid advancement of genetic tools and imaging technologies for zebrafish will facilitate research into the mechanisms that modulate leukocyte function during tumour initiation and identify targets for cancer prevention.

Adult stem cells (ASCs) can be cultured with difficulty from most tissues, often requiring chemical or transgenic modification to achieve adequate quantities. We show here that mouse primary fibroblasts grown in suspension change from the elongated and flattened morphology observed under standard adherent culture conditions generating rounded cells with large nuclei and scant cytoplasm expressing the mesenchymal stem cell (MSC) marker (Sca1; Ly6A) within 24hrs. Based on this initial observation, we describe here a suspension culture method that, irrespective of the lineage used, mouse fibroblast, primary human somatic cells (fibroblasts, hepatocytes and keratinocytes), is capable of generating a high yield of cells in spheroid form which display expression of ASCs surface markers, circumventing the anoikis which often occurs at this stage. Moreover, mouse fibroblasts-derived spheroids can be differentiated into adipogenic and osteogenic lineages. Analysis of single cell RNA sequence data identified 8 distinct cell clusters with one in particular comprising approximately 10% of the cells showing high levels of proliferative capacity expressing high levels of genes related to MSCs and self-renewal as well as extracellular matrix (ECM). We believe the rapid, high-yield generation of proliferative, multi-potent ASC-like cells by the process we term suspension-induced stem cell transition (SIST) could have significant implications for regenerative medicine.

Proteinuria is known to be associated with all-cause and cardiovascular mortality, and nephrotic syndrome is defined by the level of proteinuria and hypoalbuminemia. With advances in medicine, new causative genes for genetic kidney diseases are being discovered increasingly frequently. We reviewed articles on proteinuria/nephrotic syndrome, focal segmental glomerulosclerosis, membranous nephropathy, diabetic kidney disease/nephropathy, hypertension/nephrosclerosis, Alport syndrome, and rare diseases, which have been studied in mouse models. Significant progress has been made in understanding the genetics and pathophysiology of kidney diseases thanks to advances in science, but research in this area is ongoing. In the future, genetic analyses of patients with proteinuric kidney disease/nephrotic syndrome may ultimately lead to personalized treatment options.

Ovarian cancer is the deadliest gynecological malignancy of the reproductive organs in the United States. Cyclin-dependent kinase 1 (CDK1) is an important cell cycle regulatory protein that spe-cifically controls the G2/M phase transition of the cell cycle. RO-3306 is a selective, ATP-competitive, and cell-permeable CDK1 inhibitor that shows potent anti-tumor activity in multiple pre-clinical models. In this study, we investigated the effect of CDK1 expression on the prognosis of patients with ovarian cancer and the anti-tumorigenic effect of RO-3306 in both ovarian cancer cell lines and a genetically engineered mouse model of high-grade serous ovarian cancer (KpB model). In 147 patients with epithelial ovarian cancer, overexpression of CDK1 was significantly associated with poor prognosis, compared with a low expression group. RO-3306 significantly inhibited cellular proliferation, induced apoptosis, caused cellular stress, and reduced cell migration. Treatment of KpB mice with RO-3306 for four weeks showed a significant decrease in tumor weight under obese and lean conditions without obvious side effects. Overall, our results demonstrate that inhibition of CDK1 activity by RO-3306 effectively reduces cell proliferation and tumor growth, providing biological evidence for future clinical trials of CDK1 inhibitors in ovarian cancer

A hallmark of Alzheimer’s disease (AD) are the proteinaceous aggregates formed by the amyloid-beta peptide (Aβ) that is deposited inside the brain as amyloid plaques. The accumulation of aggregated Aβ may initiate or enhance pathologic processes in AD. According to the amyloid hypothesis any agent that has the capability to inhibit Aβ aggregation and/or destroy amyloid plaques represents a potential disease modifying drug. In 2023, a humanized IgG1 monoclonal antibody (lecanemab) against the Aβ soluble protofibrils was approved by US FDA for AD therapy thus providing compelling support to the amyloid hypothesis. To acquire a deeper insight on the in vivo Aβ aggregation, various animal models, including aged herbivores and carnivores, non-human primates, transgenic rodents, fish and worms are widely exploited. This review is based on the recent data obtained using transgenic animal AD models and presents experimental verification of the critical role in Aβ aggregation seeding of the interactions between zinc ions, Aβ with the isomerized Asp7 (isoD7- Aβ) and the α4β2 nicotinic acetylcholine receptor.

The term neuroinflammation defines the reactions of astrocytes and microglia to alterations in homeostasis in the diseased central nervous system (CNS), the exacerbation of which contributes to the neurodegenerative effects of Alzheimer's disease (AD). Local environmental conditions, such as the presence of proinflammatory molecules, mechanical properties of the extracellular matrix (ECM) and local cell-cell interactions, are determinants of glial cell phenotypes. In AD, the load of the cytotoxic/proinflammatory amyloid β peptide (Aβ) is a microenvironmental component increasingly growing in the CNS, imposing time-evolving challenges on resident cells. This study aimed at investigating the temporal and spatial variations of the effects produced by this process on astrocytes and microglia, either directly or by interfering in their interactions. Ex vivo confocal analyses of hippocampal sections from the mouse model TgCRND8 at different ages have shown that overproduction of Aβ peptide induced early and time persistent disassembly of functional astroglia syncytium and promoted a senile phenotype of reactive microglia, hindering Aβ clearance. In the late stages of disease, these patterns were altered in the presence of Aβ-plaques, surrounded by typically reactive astrocytes and microglia. Morphofunctional characterization of peri-plaque gliosis revealed a direct contribution of astrocytes in plaque buildup that might result in shielding Aβ-peptide cytotoxicity and, as a side effect, in exacerbating neuroinflammation.

Alzheimer’s disease (AD) poses a significant public health challenge due to its irreversible and progressive nature while lack of a cure. As a potential strategy to combat AD, its prevention becomes increasingly attractive. Mild Cognitive Impairment due to AD (MCI-AD) represents a critical transitional stage between normal age-related cognitive decline and more severe AD conditions, occurring just before dementia onset. Unfortunately, there is currently no established animal model that accurately recapitulates MCI-AD characteristics. While many laboratories have traditionally used normally aged wild-type animals as experimental models, this approach falls short in representing the inherently worse state of MCI-AD compared to normal aging. To address this gap, we introduce an animal model—a transgenic mouse line with genetic inactivation of G protein-coupled receptor kinase-5 (GRK5), commonly known as the GRK5 knockout (GRK5KO) mouse. These GRK5KO mice exhibit amnesia, cognitive deficits, increased β-amyloid levels, neurofibrillary tangle (NFT) immunopositive axonopathy, and hippocampal neurodegenerative changes. Importantly, these pathological alterations predominantly impact the entorhinal, transentorhinal, and hippocampal cortices, aligning with human MCI-AD criteria and Braak stage II of human AD progression. Notably, female GRK5KO mice show approximately 2.5 times more NFT-positive axonopathy than males, mirroring the higher prevalence of AD cases in women. Collectively, existing data strongly supports the GRK5KO mouse as a qualified animal model for studying MCI-AD.

The complex color patterns on the wings and body of Drosophila guttifera (D. guttifera) are emerging as model systems for studying evolutionary and developmental processes. Studies regarding these processes depend on overexpression and down-regulation of developmental genes, which ultimately rely upon an effective transgenic system. Methods describing transgenesis in Drosophila melanogaster (D. melanogaster) have been extensively reported in several studies. However, these methods cannot be directly applied to D. guttifera due to the low egg production rate and very delicate embryos’ pre-injection treatment requirements. In this protocol, we describe extensively a comprehensive method used for generating transgenic D. guttifera. Using the protocol described here, we are able to establish transgenic lines, identifiable by the expression of Enhanced Green Fluorescent Protein (EGFP) in the eye disks of D. guttifera larvae. The entire procedure, from injection to screening for transgenic larvae, can be completed in approximately 30 days and should be relatively easy to adapt to other non-model Drosophila species, for which no white-eyed mutants exist.

Mechanical properties of cardiomyocytes from different transmural regions are heterogeneous in the left ventricular wall. The cardiomyocyte mechanical environment affects this heterogeneity because of mechano-electric feedback mechanisms. In the present study, we investigated the effects of load upon transmural differences in contraction of subendocardial (ENDO) and subepicardial (EPI) single cells isolated from the murine left ventricle. Various loads were applied to the cells using carbon fiber techniques for single myocytes. To simulate experimentally obtained results and to predict mechanisms underlying the cellular response to change in load, our mathematical models of the ENDO and EPI cells were used. Extent of the transmural gradient in the time course of contractions was independent of the loading conditions where unloaded and heavy loaded (isometric) contractions were examined, but the regional gradient of the relaxation time characteristics tended to decrease when the load decreased. Under auxotonic contractions, time to peak contraction (T_max) was significantly longer in ENDO cells than in EPI cells at low preload. An increase in preload (axial stretch) prolonged T_max in both cell types; however, the prolongation was greater in EPI cells, resulting in a decrease in transmural gradient in T_max at high preload. The [Ca²⁺]_i transient decay time constant was consistent with the greater preload dependency in T_max of EPI cells. Our modified mathematical models reproduced experimental results, suggesting that differences in cooperativity of cross bridges and calcium troponin C complex interactions between the ENDO and EPI cardiomyocytes may contribute to the different cellular responses to stretch, which may provide a decrease in transmural dispersion of cellular shortening in the intact heart.

Previously, we described a 19-base pair double-stranded RNA with 3'-trinucleotide overhangs, acting as immunostimulatory RNA (isRNA). This molecule demonstrated notable antiproliferative effects on cancer cells, inhibited tumor growth, and elicited immunostimulatory and antiviral responses by inducing cytokine and interferon production. Within this study, we compared the efficiency of lung fibrosis development, initiated in mice by BLM or LPS using different schemes of induction. Then we compared the effect of isRNA used in a preventive or therapeutic regimen on the development of fibrosis in selected BLM- and LPS-induced mouse models and showed that isRNA can be used in pathological conditions accompanied by the development of inflammation and the risk of fibrosis formation, without adverse side effects. Prophylactic regimen of isRNA application is beneficial for prevention of the development of pulmonary fibrosis.

The enhancement of early diagnosis of lung cancer is mandatory to improve prognosis. We observed the increase cancer stem cells (CSC) and circulating tumor cells (CTC) in blood of mice on d3 after Lewis lung carcinoma (LLC) cell implantation before disease symptom. Besides we have developed an approach to reprogramming immune cells by inhibiting the MAPK/ERK pathway through MEKi and the PD-1/PD-L1 immune checkpoint signaling pathway. We hypothesized that reprogramming of spleen CD8+ T-cells could also create a population of immune cells with high antitumor activity. We reprogrammed CD8+ T-cells derived from the spleen of C57BL/6 mice (rsCD8+T-cells). The rsCD8+T-cells were able to migrate to lung and were more resistant after the exhaustion in vitro in comparison with naïve sCD8+T-cells. In the orthotopic LLC model, the rsCD8+T-cells therapy increased the amount of proliferating CD8+ and CD4+ T-cells in blood and lung from mice. The amount of CSC decreased in the blood and lung of mice treated with rsCD8+ T-cells. A morphological study revealed a decrease in the number of metastases in lung tissue. The antitumor effects of rsCD8+T-cells are based on the activation of the host immune response by increasing the populations of CD8+ and CD4+ T-cells and apoptosis of CSCs.

Meningitis is a severe disease associated with death in children under five with highest rates of infections under age of one. Vaccines for Neisseria meningitides and Haemophilus influenza are used to prevent the main causative agents of meningitis. Administration of H. influenzae type b (Hib) vaccine is recommended at 2, 4 and 6 months with a booster dose at 18 months. N. meningitidis has two commercially available vaccines, the pure polysaccharide is recommended at 24 months meanwhile the protein-conjugated vaccines at 12 months. We sought in this study to examine if coadministering the vaccines for the two main meningitis causing bacteria might be synergistic as a preliminary step towards the possibility of shuffling immunization schedule. So, we coadministered Hib vaccine with commercially available vaccines either quadrate (ACWY) polysaccharide meningococcal (Men) or conjugated meningococcal (Nim) vaccines in Balb/C mice (n = 6/group) and compared to each vaccine administered separately and controls. Thirty-five days post immunization, we measured specific antibodies titers. Hib vaccine increased Men antibody titers significantly for serotypes Y and W. When Hib vaccine was coadministrated with Nim, antibody titer for Y, W and A significantly increased. For serotype C, there was no significant difference in antibody titers among immunized groups. As for effect of meningococcal vaccines on Hib, Men significantly increased Hib antibody titers while Nim had no effect. Collectively, our data suggested that coadministration of Hib and Men or Nim vaccines was safe and had synergistic effect on immune responses elicited to both vaccines. Further studies are needed before immunization schedule modifications. Such immunization schedule recommendation should provide better protection against this life-threatening disease in young children.

: The interaction of the Activating Transcription Factor 6 (ATF6), a key effector of the unfolded protein response (UPR) in the endoplasmic reticulum, with the neuronal calcium sensor Downstream Regulatory Element Antagonist Modulator (DREAM) is a potential therapeutic target in neurodegeneration. Modulation of the interaction ATF6-DREAM with repaglinide (RP) induced neuroprotection in a model of Huntington´s disease. Amyotrophic Lateral Sclerosis (ALS) is a neurodegenerative disorder with no cure, characterized by the progressive loss of motoneurons resulting in muscle denervation, atrophy, paralysis and death. The aim of this work was to investigate the potential therapeutic significance of DREAM as a target for intervention in ALS. We found that the expression of the DREAM protein was reduced in the spinal cord of SOD1G93A mice compared to wild type littermates. RP treatment improved motor strength and reduced the expression of the ALS progression marker collagen type XIX1 (Col191 mRNA) in the quadriceps muscle in SOD1G93A mice. Moreover, treated SOD1G93A mice showed reduced motoneuron loss and glial activation and increased ATF6 processing in the spinal cord. These results indicate that the modulation of the DREAM-ATF6 interaction ameliorates ALS symptoms in SOD1G93A mice.

Plants significantly shape root-associated microbiota, making rhizosphere microbes useful environmental indicator organisms for safety assessment. Here, we report the pyrosequencing of the bacterial 16S ribosomal RNA in rhizosphere soil samples collected from transgenic cry1Ab/cry1Ac Bt rice Huahui No. 1 (GM crop) and its parental counterpart, Minghui63. We identified a total of 2,579 quantifiable bacterial operational taxonomic units (OTUs). Many treatment-enriched microbial OTUs were identified, including 14 NonGM-enriched OTUs and 10 GM-enriched OTUs. The rhizosphere microbiota communities were influenced more strongly by growth in the field than by rice varieties. Furthermore, Huahui No. 1 transgenic Bt rice had a greater impact on the rhizosphere bacterial communities than Minghui63. Early developmental stages of the transgenic Bt rice had a significant impact on many Bacillaceae communities. While soil chemical properties were not significantly altered by the presence of transgenic Bt rice, we found peak expression level of Bt proteins during the seedling stage, which may be an intriguing factor for bacterial diversity variations. Based on these findings, we conclude that transgenic Bt rice has a significant impact on root-associated bacteria. This information may be leveraged in future environmental safety assessments of transgenic Bt rice varieties.

The amino acid proline accumulates in plants during abiotic stresses such as drought and salinity and is considered a reliable marker of environmental stress. While its accumulation is well established, its precise role in stress tolerance and its underlying molecular mechanism remain less clear. To address these issues, we performed a meta-analysis - a robust statistical technique that synthesizes results from multiple independent studies while accounting for experimental differences. We focused on 16 physiological and morphological parameters affected by drought and salt stress in transgenic plants expressing proline metabolic genes. For each parameter, we calculated the effect size as the response ratio (RR), which represents the logarithm of the mean value in the transgenic group over the mean value of the control group (lnRR). Under stress, most parameters exhibited significantly higher response ratios in the transgenic group, confirming the beneficial effects of proline during drought and salt stress. Surprisingly, under non-stressed conditions, most stress markers showed no significant differences between transgenic and non-transgenic plants, despite elevated proline levels in the former. These results suggest that the benefits of proline may be related to proline catabolism or may only become apparent during stress, possibly due to interactions with reactive oxygen species (ROS), which accumulate predominantly under stress conditions.

Fifteen transgenic shoot clones (TS A-TS O) regenerated from Hypericum perforatum hairy roots were evaluated for growth characteristics, phenylpropanoid, and naphthodianthrone production, as well as non-enzymatic and enzymatic antioxidant status. Transgenic shoots displayed higher biomass production and non-altered phenotype compared to control shoots. Phenylpropanoid production in TS was not related to phenylalanine ammonia lyase activity indicating that alternative enzymes could be involved in the regulation of phenylpropanoid/flavonoid biosynthesis. The positive correlation between phenylpropanoids (phenolic acids, flavonoids, flavan-3-ols, tannins) and non-enzymatic antioxidant assays suggested that these compounds are the main contributors to the redox state and radical scavenging properties of TS clones. More importantly, enhanced naphthodianthrone production (hypericin, pseudohypericin and protopseudohypericin) in TS was associated with the number of leaf dark glands. Concerning the enzymatic antioxidant status of TS, guaiacol peroxidase was shown as the main enzyme that turn down H2O2 levels, while the up-regulation of superoxide dismutase coincided with decreased O2•− production. The efficiency of antioxidant enzymes for O2•− and H2O2 neutralization declined the MDA level and consequently delayed lipid peroxidation in TS clones. Altogether, H. perforatum transgenic shoots could be proposed as a prospective biotechnological system for scale-up production of naphthodianthrones and phenylpropanoids with antioxidant properties.

Lipid dysregulation is critically involved in hepatocellular carcinoma (HCC). Further, male predi-lection and Ras pathway hyperactivation are distinct characteristics of HCC. However, mecha-nisms underlying their connections remain unknown. The aim of the present study was to perform a comprehensive lipidomics analysis of a Hras12V transgenic mice (Ras-Tg) model of HCC induced by hepatocyte-specific Ras pathway activation and characterized by male predilection and a dis-rupted lipid metabolism. A total of 3437 lipids were identified in HCC (T) and peri-tumor tissues (P) of Ras-Tg mice and liver tissues of wild-type mice (W) of both sexes. Longitudinal comparisons of W, P, and T yielded 359 differentially expressed lipids (DELs) in male mice and 306 DELs in female mice. Generally, glycerolipid accumulation, glycerophospholipid reduction and monounsaturated fatty acid synthesis improvement were more frequent in T compared to P. The expression change pattern analysis revealed common and characteristic DELs positively/negatively associated with HCC or the Ras oncogene. Further lipid metabolism pathway investigations revealed that disordered lipid and fatty acid biosynthesis contributed to glycerolipid accumulation and glycerophospholipid re-duction in T. Comparisons between P and W suggests that different responses to the Ras oncogene in mice of different sexes, as well as higher amounts of aberrantly regulated lipids in males, may contribute to male-biased hepatocarcinogenesis. However, lateral comparisons between sexes showed a converging trend during hepatocarcinogenesis, explaining the poor efficacy for gen-der-specific therapies. In conclusion, the common and characteristic DELs and lipid metabolism pathways in HCC initiated by the Ras oncogene from sexually dimorphic hepatocytes provide novel insights into the clinical diagnosis and management of HCC.

Currently, obesity is a critical global public health burden. Numerous studies have demonstrated the regulation of the pathogenesis of obesity and metabolic abnormalities by the gut microbiota and microbial factors; however, their involvement in the various degrees of obesity is not yet understood well. Previously, obesity has been shown to be associated with decreased levels of vitamin B12. Considering exclusive microbial production of vitamin B12, we hypothesised that a decrease in cobalamin levels in obese individuals may be at least partially caused by its depleted production in the intestinal tract by the commensal microbiota. In the present study, our aim was to estimate the abundance of enzymes and metabolic pathways for vitamin B12 synthesis in the gut microbiota of mouse models of alimentary and genetically determined obesity, to evaluate the contribution of the obesogenic microbiome to vitamin B12 synthesis in the gut. We have defined a significantly lower representation of enzymes and metabolic pathways for vitamin B12 biosynthesis in obese mice compared to non-obese mice, wherein enzyme depletion was more pronounced in lepr(-/-) (db/db) mice, which developed severe obesity. The representation of enzymes involved in cobalamin synthesis is strongly correlated with representation of several microbes in high-fat diet fed mice, whereas there were almost no correlations in db/db mice. Therefore, the degree of obesity and the composition of the correspondent microbiota are the main contributors to the representation of genes and pathways for cobalamin biosynthesis in the mouse gut.

Three carbon-chain extension genes associated with fatty acid synthesis in cotton, namely GhKAR, GhHAD, and GhENR, play important roles in oil accumulation in cotton seeds. In the present study, these three genes were cloned and characterized. The expression patterns of GhKAR, GhHAD and GhENR in the high seed oil content cultivars 10H1007, 10H1014, and 10H1041 differed somewhat compared with those of 2074B with low seed oil content at different stages of seed development. GhKAR showed all three cultivars showed higher transcript levels than that of 2074B at 10, 40 and 45 DPA. The expression pattern of GhHAD showed a lower transcript level than that of 2074B at both 10 and 30 DPA but higher transcript level than that of 2074B at 40 DPA. GhENR showed a lower transcript level than that of 2074B at both 15 and 30 DPA. The highest transcript levels of GhKAR and GhENR were detected at 15 DPA in 10H1007, 10H1014, and 10H1041 compared with 2074B. From 5 to 45 days post anthesis (DPA) cotton seed, the oil content accumulated continuously in the developing seed. Oil accumulation reached the peak at 40 DPA to 45 DPA and slightly decreased in mature seed. In addition, GhKAR and GhENR showed different expression patterns in fiber and ovule development processes, in which they showed high expression levels at 20 DPA during fiber elongation stage, but their expression level peaked at 15 DPA during ovule development processes. These two genes showed the lowest expression levels at the late seed maturation stage, while GhHAD showed peak at 10 DPA of fiber development. Compared to 2074B, the oil contents of GhKAR and GhENR overexpression lines increased 1.05~1.08 folds. These results indicated that GhHAD, GhENR and GhKAR were involved in both seed oil synthesis and fiber elongation with dual biological functions in cotton.

Strong evidence indicates that insulin resistance contributes to the development of Alzheimer´s disease by promoting inflammation, oxidative stress, and blood vessel damage. Conversely, neuroinflammation induces insulin resistance by targeting insulin signaling molecules: the insulin receptor substrates 1 and 2 (IRS1/2). In addition, neuroinflammation is strongly linked to reduced levels of brain-derived neurotrophic factor (BDNF) expression. BDNF is a key factor for neuronal survival, and its expression is compromised in neurodegenerative disorders. In this study, we show that, in a triple-transgenic (3xTg) mice model of Alzheimer’s disease, the BDNF and IRS2 but not the IRS1 mRNA expression levels were reduced in the hippocampus, together with higher levels of TNFα, compared with wild-type mice. Subgroups of control and 3xTg mice received short and long treatments of Abscisic Acid (ABA), a phytohormone with anti-inflammatory and insulin-sensitizing capabilities. We found that the short ABA treatment can increase the IRS1 and IRS2 mRNA expression both in wild-type and 3xTg mice, concomitant with reducing pro-inflammatory cytokine TNFα in 3xTg mice. However, earlier, and thus longer treatments are required to rescue the BDNF mRNA levels. Our data strongly confirm that ABA administration is a potential treatment to prevent Alzheimer´s disease, via lowering neuroinflammation, potentially rescuing insulin signaling molecules and BDNF mRNA expression.

Mass insect rearing can have a range of applications, for example in biological control of insects. Since the performance of released biological control agents determines efficacy, the competitive fitness of insects post release is a key variable. Here, we tested whether inoculation with a gut symbiont, Enterobacter cloacae, and gnotobiotic rearing of larvae could improve insect growth and male competitive fitness of a transgenic diamondback moth, which has shown variation in fitness when reared in different insectaries. All larvae were readily infected with the focal symbiont. Under gnotobiotic rearing pupal weights were reduced and there was a marginal reduction in larval survival. However, gnotobiotic rearing substantially improved the fitness of transgenic males. In addition, in gnotobiotic conditions, inoculation with the gut symbiont increased pupal weights and male fitness, increasing the proportion of transgenic progeny from 20 to 30% relative to symbiont-free insects. Gnotobiotic conditions may improve the fitness of transgenic males by excluding microbial contaminants, while symbiont inoculation could further improve fitness by providing additional protection against infections, or by normalizing insect physiology. The simple innovation of incorporating antibiotic into diet, and inoculating insects with symbiotic bacteria that are resistant to that antibiotic, could provide a readily transferable tool for other insect rearing systems.

Despite advances in understanding of the molecular pathogenesis of glioma, outcomes remain dismal. Developing successful treatments for glioma requires faithful in vivo disease modeling and rigorous preclinical testing. Murine models, including xenograft, syngeneic, and genetically engineered models, are used to study gliomagenesis, identify methods of tumor progression, and test novel treatment strategies. Since the discovery of highly recurrent isocitrate dehydrogenase (IDH) mutations in lower-grade gliomas, there is increasing emphasis on effective modeling of IDH mutant brain tumors. Improvements in preclinical models that capture the phenotypic and molecular heterogeneity of gliomas are critical for the development of effective new therapies. Herein, we explore the current status, advancements, and challenges with contemporary murine glioma models.

Consumer preference for products made from transgenic technology has been widely studied, yet few studies exist exploring the factors influencing producers’ adoption of transgenic technology. Based on field surveys in Chinese provinces of Shanxi, Henan and Shandong, we employed a gambling experiment to capture producers’ risk preferences by estimating their risk aversion coefficients. We further estimated producers’ risk amplification and risk perception of GM technology. Using ordered logit model and Poisson model we identified the major factors influencing producers’ adoption of transgenic technology. We found the factors impacted the decision of producers from different regions in different ways. The results showed that over 60% of participants amplified the risk of transgenic crops. When there was potential risk, producers might not be rational even if they had high level of knowledge and cognition about the technology. Our results shed light on government policies aiming to increase the adoption of new technologies by producers.

The main problem in creating anti-coronavirus vaccines that target mainly proteins of the outer membrane of the virus remains the rapid variability of the RNA genome of the pathogen that encodes these proteins. In addition, the introduction of technologies that can provide affordable and fast production of flexible vaccine formulas that easily adapt to the emergence of new subtypes of SARS-CoV-2 is required. Universal oligonucleotide vaccine can take into account the dynamics of rapid changes in the virus genome, as well as be synthesized on automatic DNA synthesizers in large quantities in a short time. In this brief report, the effectiveness of four phosphorothioate constructs of the La-S-so type oligonucleotide vaccine will be evaluated for the first time on transgenic mice [B6.Cg-Tg (K18-ACE2)2]. In our primary trials, the oligonucleotide vaccine increased the survival rate of animals infected with SARS-CoV-2 and also reduced the destructive effects of the virus on the lung tissue of mice. The obtained results show the perspective of the development of vaccine constructs of the La-S-so type for the prevention of coronavirus infections, including those caused by SARS-СoV-2.

Endoplasmic reticulum (ER) is an important organelle responsible as protein synthesis regulator in plant. High salinity can also lead to the activation of ER stress, caused by the accumulation of misfolded protein. This could lead to a stress response mechanism, unfolded protein response (UPR). Failure of UPR to reverse the effect of protein misfolding will activate Programmed Cell Death (PCD). Metacaspase genes regulate programmed cell death (PCD) in plants. The present study was focused on comprehensive gene analyses of the expression patterns of type II rice metacaspase (OsMC) genes in response to the endoplasmic reticulum (ER) and salinity stress in rice leaf and OsMC4 in callus. A strong evidence of unfolded protein response (UPR) during tolerance to both ER and salinity stress was found in the present study. Overexpression of OsMC4 in rice callus as a fusion protein with TagRFP and controlled by the CaMV35 promoter caused major changes in the expression of the stress ER-marker genes, protein disulfide isomerase (PDI) and Binding immunoglobulin Protein (BiP), and OsMC4 in overexpressing calli. These expression analyses of the OsMC family provide valuable information for further functional studies on the biological roles of OsMCs in PCD related to ER and salinity stress responses.

(1) Background: Some evidence suggests that cannabidiol (CBD) has potential to help alleviate HIV symptoms due to its antioxidant and anti-inflammatory properties. Here we examined acute CBD effects on various behaviors and the endocannabinoid system in HIV Tat transgenic mice. (2) Methods: Tat transgenic mice (female/male) were injected with CBD (3,10,30 mg/kg) and assessed for antinociception, activity, coordination, anxiety, and recognition memory. Brains were taken to quantify endocannabinoids and related lipids. Additionally, CBD and metabolite 7-hydroxy-CBD were quantified in the plasma and cortex. (3) Results: Tat decreased striatal-related nociception and locomotion, with some sex-dependent effects on coordination. CBD had no effect on nociception and coordination, but increased locomotor activity. For anxiety, differential CBD effects were noted for sex, with decreasing anxiety-like behavior in males only. In the striatum and spinal cord, male sex was associated with lower 2-arachidonoylglycerol and with elevated concentrations of its proinflammatory metabolite arachidonic acid. CBD metabolism was altered by sex and Tat. (4) Conclusion: Findings indicate that acute CBD effects are not altered by HIV Tat, and CBD has minimal effects on behavior and the endocannabinoid system. Interestingly, sex-dependent alterations were noted for endocannabinoids and related lipids, which may be of relevance in view of potential CBD-based treatment options for people living with HIV.

A new variant of the SARS-CoV-2 Omicron BA.5 virus has displaced all previous variants of the virus around the world. Preliminary assessment of the effectiveness of drugs for the prevention and treatment of COVID-19 requires the availability of infection models in animals. In this study, we characterize the infection model SARS-CoV-2 Omicron BA.5 and its progeny sublineage BE.1 in hACE2-transgenic mice and in Syrian hamsters. Both sublineages turned out to be pathogenic for animals – the challenged animals showed weight loss, a high level of viral load and acute inflammation in the lungs. Part of BA.5-infected mice died after virus challenge, indicating that this virus variant is more pathogenic than the previous BA.1 variant but less pathogenic than Wuhan variant.

The production and N-glycosylation of recombinant human butyrylcholinesterase (BChE), a model highly glycosylated therapeutic protein, in a transgenic rice cell suspension culture treated with kifunensine, a strong α-mannosidase I inhibitor, was studied in a 5 L bioreactor. A media exchange was performed at day 7 of cultivation by removing spent sugar rich media (NB+S) and adding fresh sugar free (NB-S) media to induce the rice α-amylase 3D (RAmy3D) promoter to produce rice recombinant human BChE (rrBChE). Using a 1.25X concentrated sugar-free medium together with an 80% reduced working volume during the media exchange lead to a total active rrBChE production level of 79 ± 2 µg (g FW)^-1 or 7.5 ± 0.4 mg L^-1 in the presence of kifunensine, which is 1.5-times higher than our previous bioreactor runs using normal sugar free medium with no kifunensine treatment. Importantly, the amount of secreted active rrBChE in culture medium was enhanced in the presence of kifunensine, comprising 44% of the total active rrBChE at day 5 post-induction. Coomassie stained SDS-PAGE gel and Western blot analyses reveal different electrophoretic migration of purified rrBChE bands with and without kifunensine treatment, which is attributed to different N-glycoforms. N-Glycosylation analysis shows substantial increase of oligomannose glycans (Man5/6/7/8) in rrBChE treated with kifunensine compared to controls. However, mass transfer limitation of kifunensine is likely the major reason for incomplete inhibition of α-mannosidase I in this bioreactor study.

Although wheat is used worldwide as a staple food, it can give rise to adverse reactions, for which the triggering factors have not been identified yet. These reactions can be caused mainly by kernel proteins, both gluten and non-gluten proteins. Among these latter, -amylase/trypsin inhibitors (ATI) are involved in baker’s asthma and realistically in Non Celiac Wheat Sensitivity (NCWS). In this paper, we report characterization of three transgenic lines obtained from the bread wheat cultivar Bobwhite silenced by RNAi in three ATI genes CM3, CM16 and 0.28. We have obtained transgenic lines showing an effective decrease of the activity of target genes that, although showing a higher trypsin inhibition as a pleiotropic effect, generate a lower reaction when tested with sera of patients allergic to wheat, accounting for the important role of the three target proteins in wheat allergies. Finally, these lines show unintended changes differences in high molecular weight glutenin subunits (HMW-GS) accumulation, involved in technological performances, but do not show differences in terms of yield. The development of new genotypes accumulating a lower amount of proteins potentially or effectively involved in such pathologies, not only offers the possibility to use them as a basis for the production of varieties with a lower impact on adverse reaction, but also to test if these proteins are actually implicated in those pathologies for which the triggering factor has not been established yet.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

Brassica yellows virus (BrYV) is a tentative species of the genus Polerovirus, which occurs widely and mostly damage Brassicaceae plants in East Asia. Since BrYV could not be transmitted mechanically, an insect transmission method is required for further virus research. Here, a reliable and unrestricted method was described, in which non-viruliferous aphids (Myzus persicae) acquired BrYV from transgenic Arabidopsis thaliana plants with virus full length genome germinated from seeds and frozen infected leaves were used to transmit the virus to healthy plants, and there was no significant difference in acquisition rate though transmission rate from frozen infected leaves was somehow lower compared to fresh infected leaves. This novel simple method could be applied to preservation of virus inocula, evaluation of variety resistance to BrYV, biological research on interaction among BrYV, aphid and host, which also provide a new idea on establishing a basic method using virus genomic transgenic plants or frozen infected leaves for other poleroviruses research.

The receptor tyrosine kinase Ret plays a critical role in regulating enteric nervous system (ENS) development. Ret is important for proliferation, migration, and survival of enteric progenitor cells (EPCs). Ret also promotes neuronal fate, but its role during neuronal differentiation and in the adult ENS is less well understood. Inactivating RET mutations are associated with ENS diseases, e.g. Hirschsprung Disease, in which distal bowel lacks ENS cells. Zebrafish is an established model system for studying ENS development and modeling human ENS diseases. One advantage of the zebrafish model system is that their embryos are transparent allowing visualization of developmental phenotypes in live animals. However, we lack tools to monitor Ret expression in live zebrafish. Here, we developed a new BAC transgenic line that expresses GFP under the ret promoter. We find that EPCs and the majority of ENS neurons express ret:GFP during ENS development. In the adult ENS, GFP+ neurons are equally present in female and male. In homozygous mutants of ret and sox10 – another important ENS developmental regulator gene – GFP+ ENS cells are absent. In summary, we characterize a ret:GFP transgenic line as a new tool to visualize and study the Ret signaling pathway from early development through adulthood.

Gram-negative bacterial infections pose a significant threat to public health. Toll-like receptor 4 (TLR4) recognizes bacterial lipopolysaccharide (LPS) and induces innate immune responses, autophagy and cell death, which have major impacts on the body physiological homeostasis. However, the role of TLR4 in bacterial LPS-induced autophagy and apoptosis in large mammals remains unknown, which are closer to humans than rodents in many physiological characteristics. So far, few reports focus on the relationship between TLR, autophagy and apoptosis in large mammal levels. We urgently need more tools to further explore their crosstalk. Here, we generated a TLR4-enriched mammal model (sheep) and found that a high-dose LPS treatment blocked autophagic degradation and caused strong innate immune responses and severe apoptosis in PBMCs of transgenic offspring. Excessive accumulation of autophagosomes/autolysosomes might contribute to LPS-induced apoptosis in PBMCs of transgenic animals. Further study demonstrated that inhibiting TLR4 downstream NF-κB or p38 MAPK signaling pathways reversed the LPS-induced autophagy activity and apoptosis. These results indicate that the elevated TLR4 aggravates LPS-induced PBMCs apoptosis by leading to lysosomal dysfunction and impaired autophagic flux, which is associated with TLR4 downstream NF-κB and MAPK signaling pathways. This study provides a novel TLR4-enriched mammal model to study its potential effects on autophagy activity, inflammation, oxidative stress and cell death. These findings also enriched the biological functions of TLR4 and provided powerful evidence for bacterial infection.

E2F4 was initially described as a transcription factor with a key function in the regulation of cell quiescence. Nevertheless, a number of recent studies have established that E2F4 can also play a relevant role in cell and tissue homeostasis as well as tissue regeneration. For these non-canonical functions, E2F4 can also act in the cytoplasm, where it is able to interact with many homeostatic and synaptic regulators. Since E2F4 is expressed in the nervous system, it may fulfill a crucial role in brain function and homeostasis, being a promising multifactorial target for neurodegenerative diseases and brain aging. The regulation of E2F4 is complex as it can be chemically modified through acetylation, from which we present evidence in the brain, as well as methylation, and phosphorylation. The phosphorylation of E2F4 within a conserved threonine motif induces cell cycle re-entry in neurons, while a dominant negative form of E2F4 (E2F4DN), in which the conserved threonines have been substituted by alanines, has been shown to act as a multifactorial therapeutic agent for Alzheimer’s disease (AD). We have generated transgenic mice neuronally expressing E2F4DN. We have recently shown using this mouse strain that expression of E2F4DN in 5xFAD mice, a known murine model of AD, improved cognitive function, reduced neuronal tetraploidization, and induced a transcriptional program consistent with modulation of amyloid-beta (Abeta) peptide proteostasis and brain homeostasis recovery. 5xFAD/E2F4DN mice also showed reduced microgliosis and astrogliosis in both cerebral cortex and hippocampus at 3-6 months of age. Here we have analyzed the immune response in 1 year-old 5xFAD/E2F4DN mice, concluding that reduced microgliosis and astrogliosis is maintained at this late stage. In addition, the expression of E2F4DN also reduced age-associated microgliosis in wild-type mice, thus stressing its role as a brain homeostatic agent. We conclude that E2F4DN transgenic mice represent a promising tool for the evaluation of E2F4 as a therapeutic target in neuropathology and brain aging.

Existing evidence suggest that lactoferrin might be beneficial for Alzheimer’s disease. We aimed to determine the effects of lactoferrin intervention on cognitive function from APP/PS1 mice, and possible mechanisms involved in. Both young and middle-aged male APP/PS1 mice were divided into control and lactoferrin group with 16 weeks’ intervention. Lactoferrin intervention had no effects on cognitive function from both young and middle-aged mice, and no key markers involved in Aβ, tau pathology, neuro-inflammation and synaptic plasticity were altered post lactoferrin intervention. In regards to gut microbiota profiles, in the young mice, lactoferrin elevated α diversity index including ACE and Chao 1, and reduced the relative abundance of the genera Bacteroides and Alistipes and elevated Oscillibacter, in addition, Oscillibacter, Anaerotruncus, EF096579_g, EU454405_g, Mollicutes_RF39, EU474361_g, EU774448_g, and EF096976_g were specifically abundant post Lf intervention via LEfSe analysis. In the middle-aged mice, the relative abundance of the phylum Proteobacteria, as well as the genera Oscillospira, Coprococcus and Ruminococcus was significantly reduced post Lf intervention, additionally, S24_7, Bacteroidia, Bacteroidetes and Methylobacterium were specific via LEfSe analysis post lactoferrin intervention. In conclusion, dietary lactoferrin might be beneficial for gut microbiota homeostasis although might have no effects on cognition.

Glioblastoma (GBM) is the most aggressive brain cancer. To model GBM in research, orthotopic brain tumor models, including syngeneic models like GL261 and genetically engineered mouse models like TRP, are used. In longitudinal studies, tumor growth and treatment response are typ-ically tracked with in vivo imaging, including bioluminescence imaging (BLI), which is quick, cost-effective, and easily quantifiable. However, BLI requires luciferase-tagged cells, and recent studies indicate that the luciferase gene can elicit an immune response, leading to tumor rejection and experimental variation. We sought to optimize the engraftment of two luciferase-expressing GBM models, GL261 Red-FLuc and TRP-mCherry-FLuc, showing differences in tumor take, with GL261 Red-FLuc cells requiring immunocompromised mice for 100% engraftment. Immuno-histochemistry and MRI revealed distinct tumor characteristics: GL261 Red-FLuc tumors were well-demarcated with densely packed cells, high mitotic activity, and vascularization. In con-trast, TRP-mCherry-FLuc tumors were large, invasive, and necrotic, with perivascular invasion. Quantifying tumor volume using the HALO® AI analysis platform yielded results comparable to manual measurements, providing a standardized and efficient approach for reliable high-throughput analysis of luciferase-expressing tumors. Our study highlights the importance of considering tumor engraftment when using luciferase-expressing GBM models, providing in-sights for preclinical research design.

Adult T-cell leukemia (ATL) is an aggressive hematologic disease caused by human T-cell leukemia virus type 1 (HTLV-1) infection. Various animal models of HTLV-1 infection/ATL have been established to elucidate the pathogenesis of ATL and develop appropriate treatments. For analyses employing murine models, transgenic and immunodeficient mice are used because of the low infectivity of HTLV-1 in mice. HTLV-1 Tax and HBZ transgenic mice spontaneously develop tumors, and roles for both Tax and HBZ in cell transformation and tumor growth have been established. Severely immunodeficient mice were able to engraft ATL cell lines and have been used in preclinical studies of candidate molecules for the treatment of ATL. HTLV-1-infected humanized mice with an established human immune system are a suitable model to characterize cells in the early stages of HTLV-1 infection. This review outlines the characteristics of mouse models of HTLV-1 infection/ATL and describes progress made in elucidating the pathogenesis of ATL and developing related therapies using these mice.

Pericentromeric regions of chromosomes enriched in tandemly repeated satellite DNA although representing a significant part of eukaryotic genomes are still understudied mainly due to interdisciplinary knowledge gaps. Recent studies suggest their important role in genome regulation, karyotype stability and evolution. Thus, the idea of satellite DNA as a junk part of the genome was refuted. Integration of data about molecular composition, chromosome behaviour and details of in situ organization of pericentromeric regions is of great interest. The objective of this work was a cytogenetic analysis of the interactions of pericentromeric regions non-homologous chromosomes in mouse spermatocytes using immuno-FISH. We analysed two events: the associations between cerntomeric regions of X chromosome and autosomes, and associations between centromeric regions of autosomal bivalents forming chromocenters. We conclude that X chromosome form temporary synaptic associations with different autosomes in early meiotic prophase I which normally can be found at pachytene-diplotene without signs of pachytene arrest. These associations are formed between the satellite DNA-enriched centomeric regions of X chromosome and different autosomes but not involve the satellite-poor centromeric region of Y-chromosome. We suggest the mechanism of X chromosome competitive replacement from such associations during synaptic correction. We showed that centromeric region of the X chromosome remains free of γH2Ax-dependent chromatin inactivation, while Y chromosome is completely inactivated. This findings highlights the predominant role of associations between satellite DNA-enriched regions of different chromosomes including X. We assume that X-autosome temporary associations is a manifestation of an additional synaptic disorders checkpoint. These associations are normally corrected before the late diplotene. We revealed that the intense spreading conditions applied to the spermatocytes I nuclei did not lead to destruction of stretched chromatin fibers i.e. elongated chromocenters enriched in satellite DNA. Revealed by us tight associations between pericentromeric regions of different autosomal bivalents and X chromosome may represent the basis for repeat stability maintenance in autosomes an X chromosome. The consequences of our findings are discussed. We obtained the preparations of mouse spermatocytes nuclei in the meiotic prophase I using two approaches: standard and extremely intense surface spread techniques. Using immuno-FISH we visualized tandemly repeated mouse Major and Minor satellite DNA located in the pericentromeric regions of chromosomes and performed a morphological comparison of the standard- and intensely spreaded meiotic nuclei. Based on our results, we assume the remarkable strength of the chromocenter-mediated associations, “chromatin “bridges”, between different bivalents at the pachytene and diplotene stages. We have demonstrated that the chromocenter “bridges” between the centromeric ends of meiotic bivalents are enriched in both tandemly repeated Major and Minor satellite DNA. Association of centromeric regions of autosomal bivalents and X-chromosome but not with Y-chromosome correlates with the absence of Major and Minor satellites on Y-chromosome. We suggest that revealed tight associations between pericentromeric regions of bivalents may represent the network-like system providing dynamic stability of chromosomal territories, as well as add new data for the hypothesis of ectopic recombination in these regions which supports sequence homogeneity between non-homologous chromosomes and does not contradict the meiotic restrictions imposed by the crossing-over interference near centromeres. We conclude that nuclear architecture in meio-sis may play an essential role in contacts between the non-homologous chromosomes providing the specific characteristics of pericentromeric DNA.

Methionine 77 in calmodulin can be stereospecifically oxidized to methionine sulfoxide by mammalian methionine sulfoxide reductase A. Whether this has in vivo significance is unknown. We therefore created a mutant mouse in which wild-type calmodulin-1 was replaced by a calmodulin containing a mimic of methionine sulfoxide at residue 77. Total calmodulin levels were unchanged in the homozygous M77Q mutant, which is viable and fertile. No differences were observed on learning tests, including the Morris water maze and associative learning. Cardiac stress test results were also the same for mutant and wild type mice. .However, young male and female mice were 20% smaller than wild type mice, although food intake was normal for their weight. Young M77Q mice were notably more active and exploratory than wild type mice. This behavior difference was objectively documented on the treadmill and open field tests. The mutant mice ran 20% longer on the treadmill than controls, and in the open field test, the mutant mice explored more than controls and exhibited reduced anxiety These phenotypic differences bore a similarity to those observed in mice lacking calcium/calmodulin kinase Iiα (CaMKIIα). We then showed that M77Q calmodulin was less effective in activating CaMKIIα than wild type calmodulin. Thus, characterization of the phenotype of a mouse expressing a constitutively active mimic of calmodulin led to the identification of the first calmodulin target that can be differentially regulated by the oxidation state of Met77. We conclude that reversible oxidation of methionine 77 in calmodulin by MSRA can regulate cellular function.

Plant height is one of the key agronomic traits for improving the yield of sweetpotato. The phytohormones, especially gibberellins (GAs) are crucial to regulate plant height. The 9-cis-epoxycarotenoid dioxygenase (NCED) is the key enzyme for abscisic acid (ABA) biosynthesis signalling in higher plants. However, its role in regulating plant height has not been reported to date. Here, we cloned a NCED gene, IbNCED1, from sweetpotato cultivar Jishu26. This gene encoded the 587-amino acid polypeptide containing an NCED superfamily domain. The expression level of IbNCED1 was highest in the old tissues in the field-grown Jishu26. The expression of IbNCED1 was induced by ABA and GA. Overexpression of IbNCED1 promoted the accumulation of ABA and inhibited the content of active GA3 and plant height, and affected the expression levels of genes involved in the GA metabolic pathway. IbNCED1 overexpression reduced sensitivity to GA3 and exogenous application of GA3 could rescue the dwarf phenotype. In conclusion, we suggest that IbNCED1 regulates plant height and development by controlling the accumulation of active GA3 signalling pathway in transgenic sweetpotato.

Improvement of agronomic traits in crops through gene editing (GE) relies on efficient trans-formation protocols for delivering the CRISPR/Cas9-coded transgenes. Recently, a few embryo-genesis-related genes have been described, the co-delivery of which significantly increases the transformation efficiency with reduced genotype dependency. Here we characterized the trans-genic and GE events in wheat (cv. Fielder) when transformed with the GROWTH-REGULATING FACTOR 4 (GRF4) and its cofactor GRF-INTERACTING FACTOR 1 (GIF1) chimeric gene. Trans-formation efficiency in our experiments ranged from 22% to 68%, and the editing events were faithfully propagated into the following generation. Both low and high copy number integration events were recovered in the T0 population with the various level of integrity of the left and right T-DNA borders. We also generated a population of wheat plants with ten different gRNAs targeting 30 loci in the genome. Comparison of the epigenetic profiles at the target sites and editing efficiency revealed a significant positive correlation between chromatin accessibility and muta-genesis rate. Overall, preliminary screening of the transgene quality and GE events in the T0 population of plants regenerated through the co-delivery of GRF-GIF can allow for the propagation of the best candidates for further phenotypic analysis.

Circular RNAs (circRNAs) served as covalently closed single-stranded RNAs have been proposed to influence plant development and stress resistance. Grapevine is the most economically valuable fruit crops cultivated worldwide and threaten by various abiotic stresses. Herein, we reported that a circRNA (Vv-circPTCD1) processed from the second exon of a pentatricopeptide repeat family gene PTCD1 was preferentially expressed in leaves and responded to salt and drought but not heat stress in grapevine. Additionally, the second exon sequence of PTCD1 was highly conserved but the biogenesis of Vv-circPTCD1 is species-dependent in plants. It was further found that the overexpressed Vv-circPTCD1 can slightly decreased abundance of the cognate host gene and the neighboring genes were barely affected in grapevine callus. Furthermore, we also successfully overexpressed the Vv-circPTCD1, and found that the Vv-circPTCD1 deteriorated the growth during heat, salt, and drought stresses in Arabidopsis. However, the biological effects on grapevine callus were not always consistent with that of Arabidopsis. Interestingly, we found that the transgenic plants of linear counterpart sequence also conferred the same phenotypes as that of circRNA during the three stress conditions, no matter what species. Those results imply that although the sequences are conserved, the biogenesis and functions of Vv-circPTCD1 are species-dependent. Our results indicate that the plant circRNA function investigation should be conducted in homologous species, which support valuable reference for further plant circRNA studies.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

This study investigated the effects of silibinin, derived from milk thistle (Silybum marianum), on lipopolysaccharide (LPS)-induced morphological changes in mouse macrophages. Silibinin was treated at various doses and time points to assess its effects on macrophage activation including morphological changes and phagocytosis. Silibinin effectively inhibited LPS-induced pseudopodia formation and size increase, while unstimulated cells remained round. Silibinin's impact on phagocytosis was dose- and time-dependent, showing a decrease. We explored its mechanism of action on kinases using a MAPK array. Among the three MAPK family members tested, silibinin had a limited effect on JNK and p38 but significantly inhibited ERK1/2 and related RSK1/2. Silibinin also inhibited MKK6, AKT3, MSK2, p70S6K, and GSK-3β. These findings highlight silibinin's potent inhibitory effects on phagocytosis and morphological changes in macrophages. We suggest its potential as an anti-inflammatory agent due to its ability to target key inflammatory pathways involving ERK1/2 and related kinases. Overall, this study demonstrates the promising therapeutic properties of silibinin in modulating macrophage function and inflammation.

The circadian clock regulates daily changes in behavioral, endocrine and metabolic activities in mammals. Circadian rhythms in cellular physiology are significantly affected by aging. In particular, we previously found that aging has profound impact on daily rhythms in mitochondrial functions, leading to increased oxidative stress. However, this is unlikely due to malfunction of molecular clocks in the suprachiasmatic nucleus or peripheral tissues, as robust clock oscillations are observed therein in old animals. Nonetheless, aging induces changes in gene expression levels and rhythms in various peripheral and probably central tissues. In this article, we review findings on the roles of the circadian clock and aging in regulating mitochondrial rhythms and redox homeostasis. Chronic sterile inflammation is implicated in mitochondrial dysfunction and increased oxidative stress during aging. In particular, upregulation of CD38 by inflammatory response can disturb mitochondrial functions in multiple ways.

There is evidence that spaceflight poses acute and late risks on the central nervous system. To explore possible mechanisms, the proteomic changes following spaceflight in mouse brain were characterized. Space Shuttle Atlantis (STS-135) was launched at the Kennedy Space Center on a 13-day mission. Within 3–5 hours after landing, brain tissue was collected to evaluate protein expression profiles using quantitative proteomic analysis. Our results showed that there were 26 proteins that were significantly altered after spaceflight in the grey and/or white matter. While there was no overlap between the white and grey matter in terms of individual proteins, there was overlap in terms of function, synaptic plasticity, vesical activity, protein/organelle transport, and metabolism. Our data demonstrate that exposure to the spaceflight environment induces significant changes in protein expression related to neuronal structure and metabolic function. This might lead to a significant impact on brain structural and functional integrity that could affect the outcome of space missions.

The mouse visual system recently became the most popular model to study the cellular and circuit mechanisms of sensory processing. However, the importance of eye movements in mice only started to be appreciated recently. Eye movements provide a basis for active sensing and deliver insights into various brain functions and dysfunctions. A plethora of knowledge on the central control of eye movements and their role in perception and behaviour arose from work on primates. However, an overview of the known eye movement types in mice and a comparison to primates is missing.Here, we review the eye movement types described to date in mice and compare them to those observed in primates. We discuss the central neuronal mechanisms for their generation and control. Furthermore, we review the mounting literature on eye movements in mice during head-fixed and freely moving behaviours. Finally, we highlight gaps in our understanding and suggest future directions for research.

Traumatic brain injury (TBI) can result in persistent sensorimotor and cognitive deficits, which occur through a cascade of deleterious pathophysiological events over time. In this study, we investigated the hypothesis that neurodegeneration caused by TBI leads to impairments in sensorimotor function. TBI induces the activation of the caspase-3 enzyme, which triggers cell apoptosis in an in vivo model of fluid percussion injury (FPI). We analyzed caspase-3 mediated apoptosis by TUNEL staining and PARP and annexin V western blotting. We correlated the neurodegeneration with sensorimotor deficits by conducting the animal behavioral tests including grid walk, balance beam, inverted screen test, and climb test. Our study demonstrated that the excess cell death or neurodegeneration correlated with the neuronal dysfunction and sensorimotor impairments associated with TBI.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Myocilin is an enigmatic glaucoma-associated glycoprotein whose biological role remains incompletely understood. To gain novel insight into its normal function, we used transposon-mediated transgenesis to generate the first zebrafish line stably overexpressing myocilin [Tg(actb1:myoc-2A-mCherry)]. qPCR showed an approximately four-fold increased myocilin expression in transgenic zebrafish embryos (144 hpf). Adult (13 months old) transgenic animals displayed variable and age-dependent ocular anterior segment alterations. Almost 60% of two-years old male, but not female, transgenic zebrafish developed enlarged eyes with severe asymmetrical and variable abnormalities in the anterior segment, characterized by corneal limbus hypertrophy, and thickening of the cornea, iris, annular ligament and lens capsule. The most severe phenotype presented small or absent ocular anterior chamber and pupils, due to iris overgrowth along with dysplastic retinal growth and optic nerve hypertrophy. Immunohistochemistry revealed increased presence of myocilin in most altered ocular tissues of adult transgenic animals, as well as signs of retinal gliosis, and expanded ganglion cells and nerve fibers. The preliminary results indicate that these cells contributed to retinal dysplasia. Visual impairment was demonstrated in all old male transgenic zebrafish. Transcriptomic analysis of the abnormal transgenic eyes identified disrupted expression of genes involved in lens, muscular and extracellular matrix activities, among other processes. In summary, the developed transgenic zebrafish provides a new tool to investigate this puzzling protein and provides evidence for the role of zebrafish myocilin in ocular anterior segment and retinal biology, through the influence of extracellular matrix organization and cellular proliferation.

Malaria comprises a spectrum of disease syndromes and the immune system is a major participant in malarial disease. This is particularly true in relation to the immune responses elicited against blood stages of Plasmodium-parasites that are responsible for the pathogenesis of infection. Mouse models of malaria are commonly used to dissect the immune mechanisms underlying disease. While no one mouse model of Plasmodium infection completely recapitulates all the features of malaria in humans, collectively the existing models are invaluable for defining the events that lead to the immunopathogenesis of malaria. Here we review the different mouse models of Plasmodium infection that are available, and highlight some of the main contributions these models have made with regards to identifying immune mechanisms of parasite control and the immunopathogenesis of malaria.

Sperm DNA integrity and chromatin status serve as pivotal indicators of sperm quality, given their in-tricate link to sperm function, embryo development, and overall fertility. Defects in chromatin com-paction, which are often associated with compromised protamine content, can lead to damaged DNA strands. In this study, chromatin status and possible correlation with DNA damage was assessed in males of three mouse species: Mus musculus, M. spretus and M. spicilegus. We employed various staining methods, including aniline blue, methylene blue (Diff-Quik), toluidine blue and chromomy-cin A3, to assess chromatin compaction in cauda epididymal sperm. Samples were also analyzed by the sperm chromatin structure assay (SCSA) to estimate DNA fragmentation (%tDFI, %HDS). Analyses were carried out on freshly collected sperm and cells incubated for 3 h in a Hepes-buffered modified Tyrode's medium simulating conditions of the female reproductive tract. Notably, the analysis of chromatin status yielded minimal abnormal values across all three species, employing diverse meth-odologies. SCSA analyses revealed distinct variations in %tDFI between species. Following sperm incubation, the percentages of sperm stained with methylene blue exhibited differences among the species and were significantly correlated to the DNA fragmentation index. HDS demonstrated correla-tions with the percentages of sperm stained by aniline blue, methylene blue and chromomycin A3. Overall, chromatin compaction was high across all species, with limited differences among them. The relationship between chromatin status and DNA integrity appeared to be related to levels of sperm competition among species.

Aging is a major risk factor for Alzheimer's disease (AD). AD mouse models are frequently used to assess pathology, behavior, and memory in AD research. While the pathological characteristics of AD are well established, our understanding of the changes in the metabolic phenotypes with age and pathology is limited. In this work, we used the Promethion cage systems® to monitor changes in physiological metabolic and behavioral parameters with age and pathology in wild-type and 5xFAD mouse models. Then, we assessed whether these parameters could be altered by treatment with oleocanthal, a phenolic compound with neuroprotective properties. Findings demonstrated metabolic parameters such as body weight, food and water intake, energy expenditure, dehydration, and respiratory exchange rate, and the behavioral parameters of sleep patterns and anxiety-like behavior are altered by age and pathology. However, the effect of pathology on these parameters was significantly greater than normal aging, which could be linked to amyloid-β deposition and blood-brain barrier (BBB) disruption. In addition, and for the first time, our findings suggest an inverse correlation between sleep hours and BBB breakdown. Treatment with oleocanthal improved the assessed parameters and reduced anxiety-like behavior symptoms and sleep disturbances. In conclusion, aging and AD are associated with metabolism and behavior changes, with the changes being greater with the latter, which were rectified by oleocanthal. In addition, our findings suggest that monitoring changes in metabolic and behavioral phenotypes could provide a valuable tool to assess disease severity and treatment efficacy in AD mouse models.

Gamma-aminobutyric acid (GABA) and glycine act as inhibitory neurotransmitters. Three types of inhibitory neurons and terminals, GABAergic, GABA/glycine co-releasing, and glycinergic, are orchestrated in the spinal cord neural circuits and play key roles in the regulation of pain, locomotive movement, and respiratory rhythms. Herein, we first describe GABAergic and glycinergic transmission and inhibitory networks, which consist of three types of terminals, in the mature mouse spinal cord. Second, we describe the developmental formation of GABAergic and glycinergic networks, with specific focus on the differentiation of neurons, formation of synapses, maturation of removal systems, and changes in their action. GABAergic and glycinergic neurons are derived from the same domains of the ventricular zone. Initially, GABAergic neurons are differentiated and their axons form synapses. Some of these neurons remain GABAergic in lamina I and II. Many of GABAergic neurons convert to co-releasing state. The co-releasing neurons and terminals remain in the dorsal horn, whereas many of co-releasing ones ultimately become glycinergic in the ventral horn. During the development of terminals and the transformation from radial glia to astrocytes, GABA and glycine receptor subunit compositions markedly change, removal systems mature, and GABAergic and glycinergic action shifts from excitatory to inhibitory.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

Wheat gluten contains epitopes that trigger celiac disease (CD). A life-long strict gluten-free diet is the only treatment accepted for CD. However, very low-gluten wheat may provide an alternative treatment to CD. Conventional plant breeding methods are not sufficient to produce celiac-safe wheat. RNA interference technology, to some extent, succeeded in the development of safer wheat varieties. However, these varieties had multiple challenges in their implementation. Clustered Regularly Interspaced Short Palindromic Repeats-associated nuclease 9 (CRISPR/Cas9) is a versatile gene-editing tool that has the ability to edit the immunogenic gluten genes. So far, only a few studies have applied CRISPR/Cas9 to modify the wheat genome. In this article, we reviewed published literature that applied CRISPR/Cas9 in wheat genome editing to investigate the current status of the CRISPR/Cas9 system to produce a low-immunogenic wheat variety. We found that in recent years, the CRISPR/Cas9 system has been continuously improved to edit the complex hexaploid wheat genome. Although some reduced immunogenic wheat varieties have been reported, CRISPR/Cas9 has still not been fully explored in editing the wheat genome. We conclude that further studies are required to apply the CRISPR/Cas9 gene-editing system efficiently for the development of celiac-safe wheat variety and to establish it as a “tool to celiac safe wheat.”

Salinity is considered as one of the most important abiotic challenges that affect crop productivity. Plant hormones, including salicylic acid (SA), are key factors in the defence signalling output triggered during plant responses against environmental stresses. We have previously reported in peach a new SA biosynthetic pathway from mandelonitrile (MD), the molecule at the hub of the cyanogenic glucoside turnover in Prunus sp. In this work, we have studied whether this new SA biosynthetic pathway is also present in plum and the possible role this pathway plays in plant plasticity under salinity, focusing on the transgenic plum line J8-1, which displays stress tolerance via an enhanced antioxidant capacity. The SA biosynthesis from MD in non-transgenic and J8-1 micropropagated plum shoots was studied by metabolomics. Then the response of J8-1 to salt stress in presence of MD or Phe (MD precursor) was assayed by measuring: chlorophyll content and fluorescence parameters, stress related hormones, levels of non-enzymatic antioxidants, the expression of two genes coding redox-related proteins, and the content of soluble nutrients. The results from in vitro assays suggest that the SA synthesis from the MD pathway demonstrated in peach is not clearly present in plum, at least under in vitro conditions. Nevertheless, in J8-1 NaCl-stressed seedlings, an increase in SA was recorded as a result of the MD treatment, suggesting that MD could be involved in the SA biosynthesis under NaCl stress conditions in plum plants. We have also shown that the plum line J8-1 was tolerant to NaCl under greenhouse conditions, and this response was somewhat different in MD-treated plants. In that regards, the MD treatment produced an increase in SA, jasmonic acid (JA) and reduced ascorbate (ASC) contents as well as in the coefficient of non-photochemical quenching (qN) and the gene expression of Non-Expressor of Pathogenesis-Related 1 (NPR1) and thioredoxin H (TrxH) under salinity conditions, suggesting a crosstalk between different signalling pathways (NPR1/Trx and SA/JA) leading to salinity tolerance in the transgenic plum line J8-1.

Volatile compounds, abundant in breath, can be used to accurately diagnose and monitor a range of medical conditions. This offers a non-invasive, low-cost approach with screening applications; however, uptake of this diagnostic approach has been limited by conflicting published outcomes. Most published reports rely on large scale screening of the public, at single time points and without reference to ambient air. Here, we present a novel approach to volatile sampling from cellular headspace and mouse breath that incorporates multi-time point analysis and ambient air subtraction revealing compound flux as an effective proxy of active metabolism. This approach to investigating breath volatiles offers a new avenue for disease biomarker discovery and diagnosis. Using gas chromatography mass spectrometry (GC/MS), we focus on low molecular weight, metabolic substrate/by-product compounds and demonstrate that this non-invasive technique is sensitive (reproducible at ~1 µg cellular protein, or ~500,000 cells) and capable of precisely determining cell type, status and treatment. Isolated cellular models represent components of larger mammalian systems and we show that stress- and pathology-indicative compounds are detectable in mice, supporting further investigation using this methodology as a tool to identify volatile targets in human patients.

Magnetic resonance elastography (MRE) has revealed sexual dimorphism in brain stiffness in healthy individuals and multiple sclerosis (MS) patients. In the animal model of MS, experimental autoimmune encephalomyelitis (EAE), we showed previously that inflammation-induced brain softening was associated with alterations of the extracellular matrix (ECM). However, it remained unclear whether the brain ECM presents sex-specific properties that can be visualized by MRE. Therefore, we aimed here at quantifying sexual dimorphism in brain viscoelasticity in association with ECM changes in healthy and inflamed brains. Multifrequency MRE was applied to the midbrain of healthy and EAE mice of both sexes to quantitatively map regional stiffness. To define differences in brain ECM composition, gene expression of the key basement membrane components laminin (Lama4, Lama5), collagen (Col4a1, Col1a1) and fibronectin (Fn1) was investigated by RT-qPCR. We showed that the healthy male cortex expressed less Lama4, Lama5, Col4a1 but more Fn1 (all p < 0.05) than the healthy female cortex, which was associated with 9% softer properties (p = 0.044) in that region. At peak EAE, cortical softening was similar in both sexes compared to healthy tissue, with an 8% difference remaining between males and females during EAE (p < 0.001). Cortical Lama4, Lama5 and Col4a1 expression increased 2 to 3-fold in EAE in both sexes while Fn1 decreased only in males (all p < 0.05). No significant sex differences in stiffness were detected in other brain regions. In conclusion, sexual dimorphism in the ECM composition of cortical tissue in the mouse brain is reflected by in vivo stiffness measured with MRE and should be considered in future studies by sex-specific reference values.

Mucosal vaccination appears to be suitable to protect against SARS-CoV-2 infection. In this study, we tested an intranasal mucosal vaccine candidate to COVID-19 constituted of a cationic liposome containing a trimeric SARS-CoV-2 spike protein and CpG-ODNs, a Toll-like receptor 9 agonist, as adjuvant. In vitro and in vivo experiments indicated the absence of toxicity following the intranasal administration of this vaccine formulation. First, we found that subcutaneous or intranasal vaccination protected hACE-2 transgenic mice from infection with the wild-type (Wuhan) SARS-CoV-2 strain, as shown by weight lost and mortality indicators. However, when compared to the subcutaneous administration, the intranasal route was more effective in the pulmonary clearance of the virus and induced higher neutralizing antibodies and anti-S IgA titers. In addition, the intranasal vaccination afforded protection against gamma, delta and omicron virus variants of concern. Furthermore, the intranasal vaccine formulation was superior to intramuscular vaccination with a recombinant, replication-deficient chimpanzee adenovirus vector encoding the SARS-CoV-2 spike glycoprotein (Oxford/AstraZeneca) in terms of virus lung clearance and production of neutralizing antibodies in serum and bronchial alveolar lavage (BAL). Finally, the intranasal liposomal formulation boosted heterologous immunity induced by previous intramuscular vaccination with the Oxford/AstraZeneca vaccine that was more robust than homologous immunity.

Chronic Chagas Cardiomyopathy (CCC) results from infection with the protozoan parasite Trypanosoma cruzi and is a prevalent cause of heart disease in endemic countries. We previously found that cardiac fibrosis can vary widely in C3H/HeN mice chronically infected with T. cruzi JR strain, mirroring the spectrum of heart disease in humans. In this study, we examined functional cardiac abnormalities in this host:parasite combination to determine its potential as an experimental model for CCC. We utilized electrocardiography (ECG) to monitor T. cruzi-infected mice and determine whether ECG markers could be correlated with cardiac function abnormalities. We found that the C3H/HeN:JR combination frequently displayed early onset CCC indicators, such as sinus bradycardia and right bundle branch block, as well as prolonged PQ, PR, RR, ST and QT intervals in the acute stage. Our model exhibited high levels of cardiac inflammation and enhanced iNOS expression in the acute stage, but denervation did not appear to have a role in pathology. These results demonstrate the potential of the C3H/HeN:JR host:parasite combination as a model for CCC that could be used for screening new compounds targeted at cardiac remodeling and for examining the potential of anti-parasitic drugs to prevent or alleviate CCC development and progression.

Coxsackievirus B3 (CVB3) is one of the most common pathogens that cause myocarditis in humans. However, a sufficient therapeutic drug was not developed yet. Caboxamycin, a benzoxazole antibiotic, isolated from the culture broth of the marine strain Streptomyces sp., SC0774, displayed an antiviral effect in the CVB3-infected HeLa cells and CVB3-induced myocarditis mouse model. Caboxamycin significantly inhibited CVB3 VP1 production and cleavage of translation factor eIF4G1 from CVB3-infected HeLa cells at a 100 μg/ml concentration. Moreover, virus RNA amplification was dramatically reduced by caboxamycin treatment in HeLa cells. The caboxamycin cardiac protective effect was observed on the CVB3-mediated myocarditis mice model. The caboxamycin-treated mice survival was significantly increased compared to untreated mice (treated vs untreated, 100 vs 45 %). Heart histologic findings showed that myocardium damage and inflammation were significantly decreased by caboxamycin treatment. Caboxamycin directly inhibited caspase3 activity and cardiac myocytes apoptosis. These results suggested that caboxamycin strongly suppressed cardiac myocyte apoptosis and effectively inhibited the proliferation of CVB3 from in vitro and in vivo conditions. Furthermore, this study proposed that caboxamycin could potentially be applied in developing a new antiviral drug for CVB3-induced myocarditis.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

Ferroptosis is a unique variety of non-apoptotic cell death, driven by massive lipid oxidation in an iron-dependent manner. Since Ferroptosis was introduced as a concept in 2012, it was shown it's essential role in the pathogenesis in neurodegenerative diseases and an important role in therapy-resistant cancer cells. Thus, a detailed molecular understanding of both canonical and alternative ferroptosis pathways are required. There is a set of widely used chemical agents to modulate ferroptosis using different pathway targets: Erastin blocks cystine-glutamate antiporter, system xc-; ML210 directly inactivate GPX4; L-buthionine sulfoximine (BSO) inhibits γ-glutamylcysteine synthetase, an essential enzyme for glutathione synthesis de novo. Most studies were focused on lipidomic profiling of model systems undergoing death in a ferroptotic modality.

Miscarriage due to blastocyst implantation failure occurs in up to two-thirds of all miscarriage cases in human. The calcium ion has been shown to be involved in many cellular signal transduction pathways as well as in the regulation of cell adhesion, which is necessary for the embryo implantation process. Exposure to endocrine-disrupting chemicals (EDs) during early gestation results in disruption of intrauterine implantation and uterine reception, leading to implantation failure. In this study, ovarian estrogen (E2), bisphenol A (BPA), or 4-tert-octylphenol (OP), with or without ICI 182,780 (ICI) were injected subcutaneously from gestation day 1 to gestation day 3 post-coitus. The expression levels of the calcium transport genes were assessed in maternal uteri and implantation sites. The number of implantation sites was significantly low in the OP group, and implantation sites were absent in the E2 and EDs+ICI groups. There were different calcium transient transport channel expression levels in uterus and implantation site samples. The levels of TRPV5 and TRPV6 gene expression were significantly increased by EDs with/without ICI treatment in uterus. Whereas, TRPV5 and TRPV6 gene expression were significantly lower in implantation sites samples. NCX1 and PMCA1 mRNA levels were significantly decreased by OP and BPA in the implantation site samples. Compared to vehicle treatment in uterus, both the MUC1 mRNA and protein levels were markedly high in all but the BPA group. Taken together, these results suggest that both BPA and OP can impair embryo implantation through alteration of calcium transport gene expressions and by affecting uterine receptivity.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The peroxiredoxin (PRDX) family, a new family of proteins with a pivotal antioxidative function, is ubiquitously synthesized and abundantly identified in various organisms. In contrast to the intracellular localization of other family members (PRDX1/2/3/5/6), PRDX4 is the only known secretory form and protects against oxidative damage by scavenging reactive oxygen species in both the intracellular (especially the endoplasmic reticulum) compartments and the extracellular space. Recently, we generated unique human PRDX4 (hPRDX4) transgenic (Tg) mice on a C57BL/6J background and investigated the critical and diverse protective roles of PRDX4 against diabetes mellitus, atherosclerosis, insulin resistance, and nonalcoholic fatty liver disease (NAFLD) as well as evaluated its role in the intestinal function in various animal models. Our published data have shown that PRDX4 helps prevent the progression of metabolic syndrome by reducing local and systemic oxidative stress and synergistically suppressing steatosis, inflammatory reactions, and/or apoptotic activity. These observations suggest that Tg mice may be a useful animal model for studying the relevance of oxidative stress on inflammation and the dysregulation of lipid/bile acid/glucose metabolism upon the progression of human metabolic syndrome, and that specific accelerators of PRDX4 may be useful as therapeutic agents for ameliorating various chronic inflammatory diseases.

Phosphorus deficiency highly interferes with plant growth and development. Plants respond to the persistent P deficiency by coordinating the expression of genes involved in the alleviation of the stress. Promoters of phosphate transporter genes are of great choice for the development of genetically modified plants with enhanced phosphate uptake abilities, which improve crop yields in phosphate-deficient soils. In our previous study, the sugarcane phosphate transporter PHT1;2 gene, showed a significantly high expression under salinity stress. In this study, the Erianthus arundinaceus EaPHT1;2 gene was isolated and characterized using various in-silico tools. The deduced 542 amino acid residues have 10 transmembrane domains, with a molecular weight and isoelectric point of 58.9 kDa and 9.80, respectively. They displayed 71–96% similarity with Arabidopsis thaliana, Zea mays, and Saccharum hybrid. To elucidate the function of the 5’ regulatory region, the 1.1kb promoter was isolated and validated in tobacco transgenics under Pi stress. The EaPHT1;2 promoter activity was detected using the β-glucuronidase (GUS) assay. While the EaPHT1;2 promoter showed 3 to 4.2-fold higher expression than the most widely used CaMV35S promoter. The 5’ deletion analysis with and without 5’UTR regions, revealed that a small size 374 bp fragment with the highest promoter activity among 5′ truncated fragments, which was 2.7 and 4.2 times higher than the well-used CaMV35S promoter under normal and Pi-deprivation conditions, respectively. The strong and short promoter of EaPHT1;2 with 374 bp showed significant expression in low Pi-stress conditions and it could be a valuable source for the development of stress-tolerant transgenic crops

Research on microglia in Down syndrome (DS) has shown that microglial activation, increased inflammatory gene expression, and oxidative stress occur at different ages in DS brains. However, most studies resulted in simplistic definitions of microglia as quiescent or active, ignoring potential intermediate states. However, a recent work on microglial cells in young DS brains indicated that those evolve through different intermediate activation phenotypes before reaching a full activated state. Here we used single nucleus RNA sequencing, to examine how trisomy affects microglial states in the Ts65Dn mouse model of DS. Despite no substantial changes in the proportion of glial populations, differential expression analysis revealed cell type-specific gene expression changes, most notably in astroglia, microglia, and oligodendroglia. Focusing on microglia, we identified differential expression of genes associated with different microglial states, including disease-associated microglia (DAMs), activated response microglia (ARMs), and human Alzheimer’s disease microglia (HAMs), in trisomic microglia. Furthermore, pseudotime analysis reveals a unique reactivity profile in Ts65Dn microglia, with fewer in a homeostatic state and more in an intermediate aberrantly reactive state than in euploid microglia. This comprehensive understanding of microglial transcriptional dynamics sheds light on potential pathogenetic mechanisms but also possible avenues for therapy for neurodevelopmental disorders.

A cell-surface ectonucleotidase CD39 mediates the conversion of extracellular ATP into immunosuppressive adenosine with another ectonucleotidase CD73. The elevated adenosine in the tumor microenvironment (TME) attenuates antitumor immunity, which promotes tumor cell immunologic escape and progression. Anti-CD39 monoclonal antibodies (mAbs), which suppress the enzymatic activity, can be applied to antitumor therapy. Therefore, an understanding of the relationship between the inhibitory activity and epitope of mAbs is important. We previously established an anti-mouse CD39 (mCD39) mAb, C₃₉Mab-1 using the Cell-Based Immunization and Screening (CBIS) method. In this study, we determined the critical epitope of C₃₉Mab-1 using flow cytometry. We performed the PA tag (12 amino acids)-substituted analysis (named PA scanning) and RIEDL tag (5 amino acids)-substituted analysis (named RIEDL scanning) to determine the critical epitope of C₃₉Mab-1 using flow cytometry. By the combination of PA scanning and RIEDL scanning, we identified the conformational epitope, spanning three segments of 275^th to 279^th, 282^nd to 291^st, and 306^th to 323^rd amino acids of mCD39. These analyses would contribute to the identification of the conformational epitope of membrane proteins.

Cyclin-dependent kinase-like 5 (CDKL5) deficiency disorder (CDD) is a rare neurodevelopmental disease caused by mutations in the X-linked CDKL5 gene. CDD is characterized by a broad spectrum of clinical manifestations, including early-onset refractory epileptic seizures, intellectual disability, hypotonia, visual disturbances, and autism-like features. The Cdkl5 knockout (KO) mouse recapitulates several features of CDD, including autistic-like behavior, impaired learning and memory, and motor stereotypies. These behavioral alterations are accompanied by diminished neuronal maturation and survival, reduced dendritic branching and spine maturation, and marked microglia activation. There is currently no cure or effective treatment to ameliorate the symptoms of the disease. Aerobic exercise is known to exert multiple beneficial effects in the brain, not only by increasing neurogenesis, but also by improving motor and cognitive tasks. To date, no studies have analyzed the effect of physical exercise on the phenotype of a CDD mouse model. In view of the positive effects of voluntary running on the brain of mouse models of various human neurodevelopmental disorders, we sought to determine whether voluntary daily running, sustained over a month, could improve brain development and behavioral defects in Cdkl5 KO mice. Our study showed that long-term voluntary running improved hyperlocomotion and impulsivity behaviors, and memory performance of Cdkl5 KO mice. This is correlated with increased hippocampal neurogenesis, neuronal survival, spine maturation, and inhibition of microglia activation. These behavioral and structural improvements were associated with increased BDNF levels. Given the positive effects of BDNF on brain development and function, the present findings support the positive benefits of exercise as an adjuvant therapy for CDD.

The vascular endothelium is key target for immune, and thrombotic responses that has to be controlled in successful xenotransplantation. Several genes were identified that if induced or overexpressed help to regulate the inflammatory response and preserve the transplanted organ function and metabolism. However, few studies addressed combined expression of such genes. The aim of this work was to evaluate in vivo the effects of the simultaneous expression of a three human genes in a mouse generated using the multi-cistronic F2A technology. Male 3-month-old mice that express human heme oxygenase 1 (hHO-1), ecto-5’-nucleotidase (hE5NT), and ecto-nucleoside triphosphate diphosphohydrolase 1 (hENTPD1) (Transgenic) were compared to wild-type FVB mice (Control). Background analysis include extracellular nucleotide catabolism enzymes profile on the aortic surface, blood nucleotide concentration and serum L-arginine metabolites. Furthermore, inflammatory stress induced by LPS in transgenic and control mice was used to characterize interleukin 6 (IL-6) and adhesion molecules endothelium permeabil-ity responses. Transgenic mice had significantly higher rates of extracellular adenosine triphosphate and adenosine monophosphate hydrolysis on the aortic surface in comparison to control. Increased levels of blood AMP and adenosine were also noticed in transgenics. Moreover, transgenic ani-mals demonstrated the decrease in serum monomethyl-L-arginine level and a higher L-arginine/ monomethyl-L-arginine ratio. Importantly, significantly decreased serum IL-6, and adhesion mol-ecule levels were observed in transgenic mice in comparison to control after LPS treatment. Fur-thermore, reduced endothelial permeability in the LPS-treated transgenic mice was noted as com-pared to LPS-treated control. The human enzymes (hHO-1, hE5NT, hENTPD1) simultaneously encoded in transgenic mice demonstrated benefits in sev-eral biochemical and functional aspects of endothelium. This is consistent in use of this approach in the context of xenotransplantation.

Non-alcoholic steatohepatitis (NASH), which is the most severe manifestation of non-alcoholic fatty liver disease (NAFLD), has been recognized as a major hepatocellular carcinoma (HCC) catalyst. However, the molecular mechanism of NAFLD-NASH-HCC sequence remains unclear and a specific and effective treatment for NASH has not yet been established. The progress in this field depends on the availability of reliable preclinical models which show the steady progress to NASH, liver cirrhosis, and HCC. However, most of NASH mouse models that have been described to date develop NASH generally for more than 24 weeks and there is an uncertainty of HCC development. To overcome such shortcomings of experimental NASH studies, we established a novel NASH-HCC mouse model with very high reproducibility, generality, and convenience. We treated male C57BL/6J mice with a newly developed choline-deficient and methionine-restricted high-fat diet (CDMRHFD) for 60 weeks. Treatment of CDMRHFD for 3 weeks revealed marked steatosis, lobular inflammation, and fibrosis, histologically diagnosed as NASH. Liver cirrhosis was observed in all mice with 36-week treatment. Liver nodule emerged at 12 weeks of the treatment, and diameter >2 mm liver tumors developed in all mice at 24 weeks of the treatment. In conclusion, our rapidly progressive and highly reproducible NASH-liver cirrhosis-HCC model is helpful for preclinical development and research on the pathogenesis of human NAFLD-NASH-HCC. Our mouse model would be useful for the development of novel chemistry for NASH-HCC-targeted therapies or HCC prevention strategies.

Two putative boar pheromones (Androstenone and Androstenol) were discovered in endangered mouse deer during captive breeding program. This study further examined the molecular characteristics, pheromone synthesis pathway, and the functional role of these pheromones in reproduction of mouse deer. CYP17A1 and CYB5 genes were cloned and expressed in HEK-293, COS-7 cell lines and gonads of mouse deer to investigate CYP17A1 gene’s andien-β-synthase activity towards synthesis of sex pheromones in mouse deer. An enzyme immunoassay was also developed and standardized to measure the fecal androstenone during reproductive cycles of mouse deer. Results showed that mouse deer’s CYP17A1 gene possesses andien-β-synthase activity and could transform pregnenolone into 5,16-androstadien-3β-ol. The expression of CYP17A1 gene upregulated in the testis and ovary, compared to other tissues in mouse deer. Significantly elevated pheromones and estrogens were recorded prior to delivery and postpartum estrus / mating in mouse deer. Further, there were weak correlations between fecal pheromones and estrogens/ androgens in mouse deer during breeding season. The findings suggest that the boar pheromones might play a direct role in the reproductive activities of mouse deer which might be used for breeding of mouse deer elsewhere.

Ketogenic diet (KD) is getting in the focus as auxiliary cancer therapy, since it provides sufficient energy supply for healthy cells, while impairing energy production in tumor cells underlying the Warburg effect. Thereby, it can assist in inhibiting tumor growth and simultaneously counteract cachexia, which is frequently observed in cancer patients under chemotherapy. In order to provide molecular evidence for the proposed synergistic inhibition of tumor growth, we applied untargeted quantitative metabolome analysis on a breast cancer xenograft mouse model. Healthy mice and such bearing breast cancer xenografts and receiving chemotherapy were compared after treatment with control diet and KD. Metabolomic profiling was performed on plasma samples, applying high-performance liquid chromatography coupled to tandem mass spectrometry. Statistical analysis revealed metabolic fingerprints comprising numerous significantly regulated features in the group of mice bearing breast cancer. This fingerprint disappeared after treatment with KD, resulting in recovery to the metabolic status observed in healthy mice receiving control diet. Moreover, amino acid metabolism as well as fatty acid transport were found to be affected by both, the tumor and the applied KD. Our results provide clear evidence of a significant molecular effect of KD in the context of tumor growth inhibition.

Background/Goals: The gut hormone PYY secreted from intestinal L-cells has been implicated in the mechanisms of satiation via Y2-receptor (Y2R) signaling in the brain and periphery and is a major candidate for mediating the beneficial effects of bariatric surgery on appetite and body weight. Methods: Here we assessed the role of Y2R signaling in the response to low- and high-fat diets and its role in the effects of Roux-en-Y gastric bypass (RYGB) surgery on body weight, body composition, food intake, energy expenditure and glucose handling, in global Y2R-deficient (Y2RKO) and wildtype mice made obese on high-fat diet. Results: Both male and female Y2RKO mice responded normally to low- and high-fat diet in terms of body weight, body composition, fasting levels of glucose and insulin, as well as glucose and insulin tolerance for up to 30 weeks of age. Contrary to expectations, obese Y2RKO mice also responded similarly to RYGB compared to WT mice for up to 20 weeks after surgery, with initial hypophagia, sustained body weight loss, and significant improvements in fasting insulin, glucose tolerance, HOMA-IR, and liver weight compared to sham-operated mice. Furthermore, non-surgical Y2RKO mice weight-matched to RYGB showed the same improvements in glycemic control as Y2RKO mice with RYGB that were similar to WT mice. Conclusions: PYY signaling through Y2R is not required for the normal appetite-suppressing and body weight-lowering effects of RYGB in this global knockout mouse model. Potential compensatory adaptations of PYY signaling through other receptor subtypes or other gut satiety hormones such as GLP-1 remain to be investigated.

C-C motif chemokine receptor 1 (CCR1/CD191) is a member of G-protein-coupled receptors, and is expressed on myeloid cells, such as neutrophils and macrophages. Because the CCR1 signaling promotes tumor expansion in the tumor microenvironment (TME), the modification of TME is an effective strategy for cancer therapy. Although CCR1 is an attractive target for solid tumors and hematological malignancies, anti-CCR1 therapeutic agents have not been approved. Here, we established a novel anti-mouse CCR1 (mCCR1) monoclonal antibody (mAb), C₁Mab-6 (rat IgG_2b, kappa), using the Cell-Based Immunization and Screening (CIBS) method. Flow cytometry and Western blot analyses showed that C₁Mab-6 recognizes mCCR1 specifically. The dissociation constant of C₁Mab-6 for mCCR1-overexpressed Chinese hamster ovary-K1 was determined as 3.9×10^-9 M, indicating that C₁Mab-6 possesses a high affinity to mCCR1. These results suggest that C₁Mab-6 could be a useful tool for targeting CCR1 in preclinical mouse models.

The differentiation of ESCs into cardiomyocytes in vitro is an excellent and reliable model system for studying normal cardiomyocyte development in mammals, modeling cardiac diseases, and for use in drug screening. Mouse ESC differentiation still provides relevant biological information about cardiac development. However, the current methods for efficiently differentiating ESCs into cardiomyocytes are limiting. Here, we describe a “WNT Switch” method to efficiently commit mouse ESCs into cardiomyocytes using the small molecule WNT signaling modulators CHIR99021 and XAV939 in vitro. This method significantly improves the yield of beating cardiomyocytes, reduces number of treatments, and is less laborious.

Atherogenic lipoproteins may impair vascular reactivity, leading to tissue damage in various organs, including the eye. This study aimed to investigate whether ophthalmic artery reactivity is affected in mice lacking the apolipoprotein E gene (ApoE-/-), a model for hypercholesterolemia and atherosclerosis. Twelve-month-old male ApoE-/- mice and age-matched wild-type controls were used to assess vascular reactivity using videomicroscopy. Moreover, vascular mechanics, lipid content, levels of reactive oxygen species (ROS), expression of pro-oxidant redox enzymes and of the lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) were determined in vascular tissue. Unlike the aorta, the ophthalmic artery of ApoE-/- mice developed no signs of endothelial dysfunction and no signs of excessive lipid deposition. Remarkably, levels of ROS, nicotinamide adenine dinucleotide phosphate oxidase 1 (NOX1), NOX2, NOX4, and of LOX-1 were increased in the aorta but not in the ophthalmic artery of ApoE-/- mice. Our findings suggest that ApoE-/- mice develop endothelial dysfunction in the aorta by increased oxidative stress via involvement of LOX-1, NOX1 and NOX2, whereas NOX4 may participate in media remodeling. In contrast, the ophthalmic artery appears to be resistant to chronic apolipoprotein E deficiency. Lack of LOX-1 expression/overexpression in response to increased ox-LDL levels may be a possible mechanism of action.

The CC chemokine receptor 3 (CCR3) is a receptor for CC chemokines, including CCL5/RANTES, CCL7/MCP-3, and CCL11/eotaxin. CCR3 is expressed on the surface of eosinophils, basophils, a subset of Th2 lymphocytes, mast cells, and airway epithelial cells. CCR3 and its ligands are involved in airway hyperresponsiveness in allergic asthma, ocular allergy, and cancers. Therefore, CCR3 is an attractive target for those therapies. Previously, anti-mouse CCR3 (mCCR3) monoclonal antibodies (mAbs), C3Mab-3 (rat IgG2a, kappa), and C3Mab-4 (rat IgG2a, kappa) were developed using the Cell-Based Immunization and Screening (CBIS) method. In this study, the binding epitope of these mAbs was investigated using flow cytometry. The CCR3 extracellular domain-substituted mutant analysis showed that C3Mab-3, C3Mab-4, and a commercially available mAb (J073E5) recognized the N-terminal region (amino acids 1–38) of mCCR3. Next, the alanine scanning was conducted in the N-terminal region. The results revealed that Ala2, Phe3, Asn4, and Thr5 of mCCR3 are involved in C3Mab-3 binding, whereas Ala2, Phe3, and Thr5 are essential to C3Mab-4 binding, and Ala2 and Phe3 are crucial to J073E5 binding. These results reveal the involvement of the N-terminus of mCCR3 in the recognition of C3Mab-3, C3Mab-4, and J073E5.

Background: Pre-treatment with lipopolysaccharide (LPS) protected the kidney against a later lethal ischemia. To reveal the mechanisms of renal cross-tolerance and septic acute kidney injury we investigated the effects of LPS on miRNA expression in the kidney. Methods: Male NMRI mice were injected with 40 and 10 mg/kg LPS ip. and sacrificed at 1.5 and 6 hours (early preconditioning, EP) and at 24 and 48 hours (late preconditioning, LP). The miRNA profile was established using miRCURY LNA™ microarray and confirmed with qPCR. Results: Plasma urea concentration peaked at 24 hours after LPS and decreased thereafter. Renal TNF-α and IL-6 mRNA were extremely elevated at all time-points. miRNome changes were mild at 1.5 hours, most miRNAs were altered at 6 and 24 hours and declined by 48 hours. Not all miRNAs could be assayed or validated by qPCR. In EP miR-762 was newly identified and validated and was the most elevated miRNA with both methods. In LP miR-21a-5p was the most influenced miRNA followed by miR-451a, miR-144-3p and miR-146a-5p. MiR-21a-3p increased significantly in both EP and LP. Conclusion: miR-762 might attenuate the LPS-induced immune response during EP and the miR-144/451 cluster is involved in LPS-induced renal preconditioning.

Most human genetic disease arises from point mutations. These genetic diseases can theoretically be corrected by gene therapy but clinic practice is still far from mature. Nearly half of the pathogenic single-nucleotide polymorphisms (SNPs) are caused by G:C>A:T or T:A>C:G base changes. The best current methods to repair these changes are by base editing without footprint using recently developed CRISPR-Cas9 technology by David Liu’s lab. These base editing methods have been confirmed with precision and efficiency in cultured mammalian cells, but it is barely confirmed and the efficiency is still very low. Animal models are important in dissecting pathogenic mechanism for human genetic diseases and efficacy testing of base correction in vivo. Cytidine base editor BE4 is a newly developed version of cytidine base editing system that converts cytidine (C) to uridine (U) in cultured mammalian cells but has not been proven in vivo. In this study, we have tested this system in cells to inactivate GFP gene and in mice by introducing single-base substitution that leads to a stop codon in tyrosinase gene. High percentage albino coat-colored mice were obtained from black coat-colored donor zygotes after pronuclei microinjection. Sequencing results showed that expected base changes were obtained with high precision and efficiency (56.25%). There are no off-targeting events identified in predicted off-target sites. Results confirm BE4 system can work in vivo with high precision and efficacy, and has great potentials in clinic to repair human genetic mutations.

Our study investigated the innate immune response to Toxoplasma gondii infection by assessing microglial phenotypic changes and sickness behavior as inflammatory response markers post-ocular tachyzoite instillation. Disease progression in Swiss albino mice was compared with documented outcomes in BALB/c mice using identical ocular route and parasite burden (2x105 tachyzoites), with saline as control. Contrary to expectations, Swiss albino mice displayed rapid, lethal disease progression, marked by pronounced sickness behaviors and mortality within 11-12 days post-infection, while survivors showed no apparent signs of infection. Comparative analysis revealed T. gondii-infected BALB/c mice exhibited reduced avoidance of feline odors, while in-fected Swiss albino mice showed enhanced avoidance responses. There was a significant increase in microglial cells in the dentate gyrus molecular layer of infected Swiss albino mice compared to BALB/c mice and their respective controls. Hierarchical cluster and discriminant analyses iden-tified three microglial morphological clusters, differentially affected by T. gondii infection across strains. BALB/c mice exhibited increased microglial branching and complexity, while Swiss al-bino mice showed reduced shrunk microglial arbors, diminishing morphological complexity. These findings highlight strain-specific differences in disease progression and inflammatory reg-ulation, indicating lineage-specific mechanisms in inflammatory responses, tolerance, and re-sistance. These elements are critical in devising control measures for toxoplasmosis.

USP21, a member of the ubiquitin protease family, plays a vital role in various biological functions. However, the effects of USP21 dysfunction have yet to be fully understood. Here, we generated Usp21 knockout (KO) mice and conducted microarray to identify genes that Usp21 regulates. Its results raised several genes based on their biological characteristics, and RT-qPCR confirmed their expression. KO mice exhibited significant elevations in the expression of the genes Fabp7 and Nlrc5, which play a role in lipid metabolisms, compared to wild-type mice. Blood tests showed no impairment of liver function but did reveal elevated levels of total cholesterol and free fatty acids in KO mice compared to wild-type mice. These data suggest that Usp21 may play roles in lipid metabolism associated with Fabp7 and Nlrc5. To clarify the involvement of USP21 in human hypercholesterolemia, we examined single nucleotide polymorphisms (SNPs) around USP21 in non-hypercholesterolemic and hypercholesterolemic outpatients. We found that the rs11421 SNP downstream of USP21 was associated with hypercholesterolemia. These data suggest that USP21 plays a role in mice and human lipid metabolism and that its polymorphism may be a diagnostic marker for human hypercholesterolemia.

Caseinolytic peptidase P (CLPP) plays a central role in mitochondrial unfolded protein response (mtUPR) by promoting the breakdown of misfolded proteins and setting in motion a cascade of reactions to re-establish protein homeostasis. Global germline deletion of Clpp in mice results in female infertility and accelerated follicular depletion. Telomeres, on the other hand, are tandem repeats of 5’-TTAGGG-3’ sequences found at the ends of the chromosomes. Telomeres are essential for maintaining chromosome stability during somatic cell division and their shortening is associated with cellular senescence and aging. In this study, we asked whether the infertility and ovarian aging phenotype caused by global germline deletion of Clpp is associated with somatic aging, and tested telomere length in tissues of young and aging mice. We found that impaired mtUPR caused by the lack of CLPP is associated with accelerated telomere shortening in both oocytes and somatic cells of aging mice. In addition, expression of several genes that maintain telomere integrity were decreased, and double strand DNA breaks were increased in telomeric regions. Our results highlight how impaired mtUPR can affect telomere integrity and demonstrate a link between loss of mitochondrial protein hemostasis, infertility, and somatic aging.

Gossypol is a complex plant polyphenol reported to be cytotoxic and anti-inflammatory, but little was known about its effect on gene expression in macrophages. The objective was to explore gossypol’s toxicity and its effect on gene expression involved in inflammatory responses, glucose transport and insulin signaling pathway in mouse macrophages. Mouse RAW264.7 macrophages were treated with multiple concentrations of gossypol for 2-24 h. Gossypol toxicity was estimated by MTT assay and soluble protein content. qPCR analyzed the expression of anti-inflammatory tristetraprolin family (TTP/ZFP36), proinflammatory cytokine, glucose transporter (GLUT) and insulin signaling genes. Cell viability was greatly reduced by gossypol, accompanied with dra-matic reduction of soluble protein content in the cells. Gossypol treatment resulted in an increase of TTP mRNA level 6-20 fold and increased ZFP36L1, ZFP36L2 and ZFP36L3 mRNA levels by 26-69 fold. Gossypol increased proinflammatory cytokine TNF, COX2, GM-CSF, INFγ and IL12b mRNA levels up to 39-458 fold. Gossypol treatment upregulated mRNA levels of GLUT1, GLUT3 and GLUT4 genes as well as INSR, AKT1, PIK3R1 and LEPR but not APP genes. This study demonstrated that gossypol induced macrophage death and reduced soluble protein content that was accom-panied with massive stimulation of anti-inflammatory TTP family and proinflammatory cytokine gene expression as well as elevation of gene expression involved in glucose transport and insulin signaling pathway in mouse macrophages.

Pregnancy is a dynamic state with multiple metabolic changes occurring including insulin resistance. Gestational diabetes mellitus (GDM), a form of diabetes that appears during pregnancy, develops if metabolic aberrations occur, in particular, in normal pregnancy-induced insulin resistance. Multi-omics is a powerful approach for uncovering the mechanisms driving metabolic change in different physiologic and pathologic states. A recent study demonstrated that the gestational gut microbiome mediates pregnancy metabolic adaptations through effects on gut indoleamine-2,3 dioxygenase 1 activity and the production of kynurenine. Using the dataset generated from this highly controlled study, we performed a comprehensive analysis of the pregnancy-specific physiological and metabolic profiles, 16S rRNA microbiome, and plasma untargeted LC-MS metabolome data. To facilitate the utilization of these analysis results by other researchers, we developed MOMMI-MP, a database that provides an easy-to-use platform to browse and search differential abundant microbial taxa and metabolites, and to examine metabolic pathways. The datasets consist of data collected from 3 genetically diverse strains of mice (C57BL/6J, CD1, and NIH-Swiss) over 6 time points during the gestational (days 0, 10, 15, and 19 during gestation) and postpartum (days 3 and 20 after delivery) states, totaling 180 samples for each strain. The computational results are presented in various tables and plots, and organized in MOMMI-MP to empower exploratory analyses by other researchers. In conclusion, MOMMI-MP is a resource to facilitate the investigation of novel mechanisms governing metabolic changes during pregnancy.

The fatty acid elongase ELOngation of Very-Long-chain fatty acids protein 2 (ELOVL2) controls the elongation of polyunsaturated fatty acids (PUFA) producing precursors for omega-3, do-cosahexaenoic acid (DHA), and omega-6, docosapentaenoic acid (DPAn6) in-vivo. Expectedly, Elovl2-ablation drastically reduced the DHA and DPAn6 in liver mitochondrial membranes. Unexpectedly, however, total PUFAs levels decreased further than could be explained by Elovl2 ablation. The lipid peroxidation process was not involved in PUFAs reduction since malondial-dehyde-lysine (MDAL) and other oxidative stress biomarkers were not enhanced. The content of mitochondrial respiratory chain proteins remained unchanged. Still, membrane remodeling was associated with high voltage-dependent anion channel (VDAC) and adenine nucleotide trans-locase 2 (ANT2), a possible reflection of the increased demand on phospholipid transport to the mitochondria. Mitochondrial function was impaired despite preserved content of the respiratory chain proteins and the absence of oxidative damage. Oligomycin-insensitive oxygen consumption increased, and coefficients of respiratory control were reduced by 50%. The mitochondria became very sensitive to fatty acid-induced uncoupling and permeabilization, where ANT2 is involved. Mitochondrial volume and number of peroxisomes increased as revealed by transmission elec-tron microscopy. In conclusion, the results imply that endogenous DHA production is vital for the normal function of mouse liver mitochondria and could be relevant not only for mice but also for human metabolism.

Heat shock proteins (Hsps) are highly conserved molecules that are constitutively expressed and upregulated in response to physiological stress conditions. These immunogenic chaperones can have essential functions in fungi, particularly in dimorphic pathogens. Histoplasma capsulatum and Paracoccidioides species are dimorphic fungi that are the causative agents of histoplasmosis and paracoccidioidomycosis, respectively, which are systemic mycoses with significant rates of morbidity and mortality. Current treatment consists of long-term antifungal agents, and there is an urgent need for new therapeutic approaches with higher efficacy, lower toxicity, better biodistribution and improved selectivity. We engineered an immunoglobulin G1 (IgG1) isotype chimeric mouse-human monoclonal antibody, titled ch-MAb 4E12, from the parental IgG2a MAb 4E12, a monoclonal antibody to H. capsulatum Hsp60 that is protective in experimental histoplasmosis and paracoccidioidomycosis models elicited by H. capsulatum var. capsulatum and Paracoccidioides lutzii, respectively. The ch-MAb 4E12 increased phagolysosomal fusion and enhanced the yeasts uptake by PMA differentiated human THP1 macrophage cells in vitro. At low concentrations, the chimeric antibody significantly reduced the pulmonary and splenic fungal burden compared to an irrelevant antibody or no treatment. These results are the first to show that a chimeric mouse-human antibody can modify infection caused by dimorphic fungi.

Multidrug resistance protein 4 (MRP4) is an energy-dependent membrane transporter that is responsible for cellular efflux of a broad range of xenobiotics and physiological substrates. In this trial, we aimed to investigate the co-effects of aging and MRP4 deficiency using gene expression microarray and morphological and electrophysiological analyses of the mouse retina. Mrp4-knockout (null) mice and wild-type (WT) mice were reared in the same condition to 8–12 wk (young) or 45–55 wk (aged). Microarray analysis identified 186 differently expressed genes from the retinas of aged Mrp4-null mice as compared to that from aged WT mice, and subsequence gene ontology and KEGG pathway analyses showed that differently expressed genes were related to lens, eye development, vision, and transcellular barrier function that are involved in metabolic pathways or viral infection pathways. No significant change in thickness was observed for each retinal layer among young/aged WT mice and young/aged Mrp4-null mice. Moreover, immunohistochemical analyses of retinal cell type did not exhibit an overt change in the cellular morphology or distribution among the 4 age/genotype groups, and the electroretinogram responses showed no significant differences in the amplitude or the latency between aged WT mice and aged Mrp4-null mice. Aging would be an insufficient stress to cause some damage to the retina in the presence of MRP4 deficiency.

Background: Brain oxidative lipid damage and inflammation are common in neurodegenerative diseases such as Alzheimer’s disease (AD). Paraoxonase-1 and 3 (PON1 and PON3) protein expression have been described in tissues with no PON1 and PON3 gene expression. In the present study, we aimed to examine differences in PON1 and PON3 protein expression in the brain of a mouse model of AD. Methods: We used peroxidase-based and fluorescence-based immunohistochemistry in 5 brain regions (olfactory bulb, forebrain, posterior midbrain, hindbrain and cerebellum) of transgenic (Tg2576) mice with the Swedish mutation (KM670/671NL) responsible for a familial form of AD and corresponding wild-type mice. Results: We found intense PON1 and PON3 positive staining in star-shaped cells surrounding Aβ plaques in all Tg2576 mouse brain regions studied. Although we could not co-localize PON1 and PON3 with astrocytes, brain star-shaped cells, we found some co-localization of PON3 with microglia. Conclusions: These results suggest that 1) PON1 and PON3 cross the blood-brain barrier in discoidal HDLs and are transferred to specific brain cell types, and 2) PON1 and PON3 play an important role in preventing oxidative stress and lipid peroxidation in particular cell types, likely astrocytes and microglia, in AD pathology, and potentially in other neurodegenerative diseases

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

The C-X-C motif chemokine receptor-1 (CXCR1) is a rhodopsin-like G-protein-coupled receptor, expressed on the cell surface of immune cells and tumors. CXCR1 interacts with some C-X-C chemokines, such as CXCL6, CXCL7, and CXCL8/interleukin-8, which are produced by various cells. Since CXCR1 is involved in several diseases including tumors and diabetes mellitus, drugs targeting CXCR1 has been developed. Therefore, the development of sensitive monoclonal antibodies (mAbs) for CXCR1 has been desired for the diagnosis and treatment. This study established a novel anti-mouse CXCR1 (mCXCR1) mAb; Cx₁Mab-1 (rat IgG₁, kappa), using the Cell-Based Immunization and Screening (CBIS) method. Cx₁Mab-1 reacted with mCXCR1-overexpressed Chinese hamster ovary-K1 (CHO/mCXCR1) and mCXCR1-overexpressed LN229 glioblastoma (LN229/mCXCR1) in flow cytometry. Cx₁Mab-1 demonstrated a high binding affinity for CHO/mCXCR1 and LN229/mCXCR1 with a dissociation constant of 2.6×10^-9 M and 2.1×10^-8 M, respectively. Furthermore, Cx₁Mab-1 could detect mCXCR1 by western blot analysis. These results indicated that Cx₁Mab-1 is useful for detecting mCXCR1, and provides a possibility for targeting mCXCR1-expressing cells in vivo experiments.

C-X-C motif chemokine receptor 3 (CXCR3, CD183) is a G-protein-coupled receptor for CXCL9, CXCL10, and CXCL11. CXCR3 signaling induces chemotaxis of immune cells to inflammation sites and promotes inflammation in inflammatory diseases. Various mouse models to mimic the pathogenesis of each disease have been developed to understand mechanisms and evaluate therapeutics for these diseases. Although CXCR3 is an attractive target to suppress inflammation, anti-CXCR3 therapeutic agents have not been approved. In this study, we established a novel anti-mouse CXCR3 (mCXCR3) monoclonal antibody, Cx₃Mab-4 (rat IgG₁, kappa), using the Cell-Based Immunization and Screening method. Flow cytometric analysis demonstrated that Cx₃Mab-4 bound to mCXCR3-overexpressed Chinese hamster ovary-K1 (CHO/mCXCR3) cells, but did not react to parental CHO-K1 cells. The dissociation constant of Cx₃Mab-4 was determined as 1.3 × 10^-9 M, indicating that Cx₃Mab-4 possesses a high affinity to mCXCR3-expressing cells. Cx₃Mab-4 could be useful for targeting CXCR3-expressing cells in preclinical mouse models.

Macrophages play a pivotal role in the process of healing burns. One of the major risks in the course of burns healing, in the absence of regenerating epidermis, is infections which greatly contribute to morbidity and mortality in such patients. Therefore, it is widely agreed that accelerating recruitment of macrophages into burns may contribute to faster regeneration of the epidermis and thus, decreasing the risk of infections. This review describes a unique method for rapid recruitment of macrophages into burns and activation of these macrophages to mediate accelerated regrowth of the epidermis and healing of burns. The method is based on application of bio-degradable “alpha-gal” nanoparticles to burns. These nanoparticles present multiple alpha-gal epitopes (Gal alpha1-3Gal beta1-4GlcNAc-R) which bind the abundant natural anti-Gal antibody that constitutes ~1% of immunoglobulins in humans. Anti-Gal/alpha-gal nanoparticles interaction activates the complement system, resulting in localized production of the complement cleavage-peptides C5a and C3a that are highly effective chemotactic factors for monocytes derived macrophages. The macrophages recruited into the alpha-gal nanoparticles treated burns are activated following interaction between the Fc portion of anti-Gal coating the nanoparticles and the multiple Fc receptors on macrophages cell membranes. The activated macrophages secrete a variety of cytokines/growth factors that accelerate the regrowth of the epidermis and regeneration of the injured skin, thereby cutting the healing time by half. Studies on healing of thermal injuries in the skin of anti-Gal producing mice, demonstrated a much faster recruitment of macrophages into burns treated with alpha-gal nanoparticles than in control burns treated with saline and healing of the burns within 6 days, whereas healing of control burns takes ~12 days. alpha-Gal nanoparticles are non-toxic, and do not cause chronic granulomas or keloids. These findings suggest that alpha-gal nanoparticles treatment may harness anti-Gal for inducing similar accelerated burn healing effects also in humans.

The Carbonic Anidrase isoform IX (hCA IX) is one of the main player in extracellular tumor pH regulation and it is known to be overexpressed in breast cancer as well as in many common tu-mors. hCA IX has shown to contribute to the growth and survival of tumor cells and its expres-sion is correlated to metastasis and resistance to therapies making it an interesting biomarker for diagnosis and potential image-guided therapy. The aim of this work is the development of an MRI Imaging probe able to target the extracellular non catalytic PG domain of CAIX. A new specific nano probe has been designed by conjugating a peptidic interactor of PG domain on the surface of a liposome loaded with Gd-based contrast agents. Mouse Mammary Adenocarcinoma Cell Line (TS/A ) has been chosen as in vitro breast cancer model to test the efficacy of the de-veloped probe. MRI results display a high selectivity towards hCA IX marker and a good sensi-tivity of the Imaging probe. These findings make this approach promising for future develop-ment of in vivo diagnostic protocols aimed at visualizing this enzyme expression.

Edaravone is a mitochondrially targeted drug with a suggested capability to modify the course of diverse neurological diseases. Nevertheless, edaravone has not been tested yet in the context of spinocerebellar ataxia 1 (SCA1), an incurable neurodegenerative disease characterized mainly by cerebellar disorder with a strong contribution of inflammation and mitochondrial dysfunction. This study aimed to address this gap, exploring the potential of edaravone to slow down SCA1 progression in a mouse knock-in SCA1 model. SCA1154Q/2Q and healthy SCA12Q/2Q mice were getting either edaravone or saline daily for more than 13 weeks. The functional impairments were assessed via a wide spectrum of behavioral assays reflecting motor and cognitive deficits and behavioral abnormalities. Moreover, we used high-resolution respirometry to explore mitochondrial function, and immunohistochemical and biochemical tools to assess the magnitude of neurodegeneration, inflammation and neuroplasticity. Data were analyzed using (hierarchical) Bayesian regression models combined with the methods of multivariate statistics. Our analysis pointed out various previously documented neurological and behavioral deficits of SCA1 mice. However, we did not detect any plausible therapeutic effect of edaravone on either behavioral dysfunctions or other disease hallmarks in SCA1 mice. Thus, our results did not provide support for the therapeutic potential of edaravone in SCA1.

Amyotrophic Lateral Sclerosis (ALS) is an irreversible neurodegenerative disease with no known cure. Recent studies suggest a strong metabolic component in ALS pathogenesis and have shown an inverse relationship between leptin levels and ALS progression, although the effects of leptin as a treatment have not yet been studied. Therefore, we aim to examine whether the acute treatment with leptin has beneficial effects on brain pathology and cognitive function in the transgenic TDP43A315T line of ALS. Mice were treated intranasally (IN) with 0.03mg/kg of leptin or vehicle (VH) daily for 7 days. Data showed a progressive decline in body weight and motor coordination in TDP43A315T mice. Moreover, Lep-treated TDP43A315T mice showed an earlier disease onset, along with an improvement in motor performance. Altered levels of some of the adipokines and metabolic proteins studied were found in TDP43A315T mice, which were differently expressed among Lep-treated and VH-treated animals. Furthermore, some correlations were found among the serum levels of this proteins in WT and TDP43A315T mice. As far as we know, this is the first pilot study to provide evidence of the therapeutic effect of leptin treatment in a mice model of ALS, although further studies are needed to expound on the underlying mechanisms.

Nicotine is a pharmacologically active component of tobacco which adversely affects the male reproductive system and fertility and Icariin (ICA) is the main active ingredient of Epimedium herba which has been used to treat several male reproductive problems. This study was aimed at investigating the protective or ameliorative effect of ICA against reproductive toxicity induced by intraperitoneal injection of nicotine in mice. Forty male mice were randomly divided into 4 groups: control, nicotine (0.75 mg/kg intraperitoneally), icariin (ICA, 75 mg/kg), and icariin plus nicotine (ICA + nicotine) group. After 35 days of treatment, the mice were weighed, sacrificed, and their reproductive organs were collected and examined for further studies. In the nicotine-treated group, epididymal sperm density and serum testosterone concentrations significantly decreased relative to the control group. Nicotine also caused oxidative damage as shown by significant reduction in the activities of antioxidant enzymes and an elevation in Malondialdehyde (MDA) levels. Icariin on the other hand, improved the reduction in sperm characteristics, hormone levels, and activities of antioxidant enzymes alterations observed in the nicotine treated mice. These findings indicate that the nicotine-induced reproductive toxicity and oxidative damages on male reproductive tissues can be effectively attenuated by icariin.

Melanin is extensively distributed in organisms and believed to be synthetized by tyrosinase (TYR), leading to aberrant coloring and skin conditions when over-produced. Loquat (Eriobotrya japonica (Thunb.) Lindl.) flowers contain large amounts of bioactive substances currently few studied on their suppressive capabilities to melanin synthesis. Its isolate product (LFP) was obtained by ethanol solution extraction and resin purification, of which the inhibitory mechanism on TYR activity was elaborated by enzyme kinetics and multi-spectroscopy determinations and the impact on related proteins’ expression in mouse melanoma B16 cells was analyzed with Western blotting. HPLC-MS analysis indicated that LFP was identified into 137 compounds, with 12 including flavonoids (quercetin, isorhamnoin, p-coumaric acid, etc.), cinnamic acid and its derivatives as well as benzene and its derivatives owning TYR inhibitory activities. LFP inhibited TYR activity in a concentration-dependent manner with its IC50 value being 2.8 mg/mL and an anti-competitive mechanism involved altering the enzyme's conformation. LFP reduced the expression of TYR, TRP1, and TRP2 in melanoma B16 cells, hence inhibiting the synthesis of melanin. Considered collectively, LFP would be a viable option for treating hyperpigmentation caused by tyrosinase, providing a theoretical basis for the value-added utilization of loquat flower resource in beauty and aging related functional products.