Ranaviruses have been associated with rising numbers of mass die-offs in amphibian populations globally. With life-stages occupying different environments and presenting distinct physiologies, amphibian of different ages are likely to play an important role in pathogen persistence. To assess the potential role of post-metamorphic amphibians as a Ranavirus reservoir, we performed a bath-exposure study on wood frogs using environmentally relevant doses (~10³ and ~10⁴ PFU/mL) of wild-type (WT) and knockout Frog virus 3 (FV3), deficient for the vIF-2α immune-evasion gene, the effects of which have never been addressed in post-metamorphic anurans. We observed 42% infection prevalence and low mortality (10%) across the virus challenges, with half of the mortalities attributable to ranavirosis. Prevalence and viral loads followed a dose-dependent pattern. Notably, when exposed to the vIF-2α knockout (DvIF-2α) FV3, individuals exhibited significantly decreased growth and increased lethargy in comparison to WT FV3 treatments. Although 85% of individuals in the virus treatments exhibited stereotypic signs of ranavirosis throughout the experiment, at termination (40 days post exposure) most individuals were clear of signs of infection. Overall, this study provides evidence that even a single short time exposure to environmentally relevant doses of Ranavirus may cause sublethal infections in post-metamorphic amphibians, thus indicating their possible role as a reservoir for this pathogen.

Antioxidant, anti-inflammatory and chemo-preventive features have been reported for the carotenoid diatoxanthin. Diatoxanthin is only produced by a few groups of microalgae where it functions in photoprotection. Its large-scale production in microalgae is currently not feasible. In fact, rapid conversion into the inactive pigment diadinoxanthin is triggered when the cells are removed from the high-intensity light source, which will be the case during large-scale harvesting of microalgae biomass. Zeaxanthin epoxidase (ZEP) 2 and/or ZEP3 have been suggested to be responsible for the back-conversion of high-light accumulated diatoxanthin to diadinoxanthin in low light in diatoms. Using the CRISPR/Cas9 gene editing technology we knocked out the ZEP2 and ZEP3 genes in the already commercially used marine diatom Phaeodactylum tricornutum to investigate their role in the diadinoxanthin-diatoxanthin cycle, and to determine if one of the mutant strains could function as a diatoxanthin production line. Light shift experiments proved that ZEP3 encodes the enzyme converting diatoxanthin to diadinoxanthin in low light. Loss of ZEP3 caused the high-light accumulated diatoxanthin to be stable for several hours after the cultures had been returned to low light, suggesting that zep3 mutant strains could be suitable as commercial production lines of diatoxanthin.

We have previously reported that 60% sucrose diet-fed ChREBP knockout mice (KO) showed body weight loss resulting in lethality. We aimed to elucidate whether sucrose and fructose metabolism are impaired in KO. Wild type mice (WT) and KO were fed a diet containing 30% sucrose with/without 0.08% miglitol, an α-glucosidase inhibitor, and these effects on phenotypes were tested. Furthermore, we compared metabolic changes of oral and peritoneal fructose injection. Thirty percent sucrose diet feeding did not affect phenotypes in KO. However, miglitol induced lethality in 30% sucrose-fed KO. Thirty percent sucrose plus miglitol diet-fed KO showed increased cecal contents, increased fecal lactate contents, increased growth of lactobacillales and Bifidobacterium and decreased growth of clostridium cluster XIVa. ChREBP gene deletion suppressed the mRNA levels of sucrose and fructose related genes. Next, oral fructose injection did not affect plasma glucose levels and liver fructose contents; however, intestinal sucrose and fructose related mRNA levels were increased only in WT. In contrast, peritoneal fructose injection increased plasma glucose levels in both mice; however, the hepatic fructose content in KO was much higher owing to decreased hepatic Khk mRNA expression. Taken together, KO showed sucrose intolerance and fructose malabsorption owing to decreased gene expression.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

The tumor organoid (tumoroid) model in three-dimensional (3D) culture systems has been developed to reflect more closely the in vivo tumors than 2D-cultured tumor cells. Notably, extracellular vesicles (EVs) are efficiently collectible from the culture supernatant of gel-free tumoroids. Matrix metalloproteinase (MMP) 3 is a multi-functional factor playing crucial roles in tumor progression. However, roles of MMP3 within tumor growth and EVs have not unveiled. Here, we investigated the protumorigenic roles of MMP3 on integrities of tumoroids and EVs. We generated MMP3-knockout (KO) cells using the CRISPR/Cas9 system from rapidly metastatic LuM1 tumor cells. Moreover, we established fluorescent cell lines with palmitoylation signal-fused fluorescent proteins (tdTomato and enhanced GFP). Then we confirmed the exchange of EVs between cellular populations and tumoroids. LuM1-tumoroids released large EVs (300-1000 nm) and small EVs (50-200 nm) while the knockout of MMP3 resulted in the additional release of broken EVs from tumoroids. The loss of MMP3 leads to a significant reduction in tumoroid size and to the development of the necrotic area within tumoroids. MMP3 and CD9 (a category-1 EV marker tetraspanin protein) were significantly down-regulated in MMP3-KO cells and their EV fraction. These weakened phenotypes by MMP3 KO were markedly rescued by the addition of MMP3-rich EVs or conditioned medium (CM) collected from LuM1-tumoroids, which caused a dramatic rise in the expression of MMP3, CD9, and Ki-67 (a marker of proliferating cells) in the MMP3-null/CD9-low tumoroids. Notably, MMP3 enriched in tumoroids-derived EVs and CM deeply penetrated into recipient MMP3-KO tumoroids, resulting in a remarkable enlargement of solid tumoroids, while MMP3-null EVs did not. These data demonstrate that EVs can mediate molecular transfer of MMP3 resulting in increasing the proliferation and CD9+ tumorigenesis, indicating crucial roles of MMP3 in tumor progression.

Altered metabolism is a common feature of many cancers and in some cases is a consequence of mutation in metabolic genes, such as the ones involved in Krebs cycle. Isocitrate dehydrogenase (IDH) gene is mutated in many gliomas and other cancers. Physiologically IDH converts isocitrate to αketoglutarate (αKG), but when mutated, IDH reduces αKG to D2-hydroxyglutarate (D2-HG). D2-HG accumulates at high levels in IDH mutant cancers, and in the last decade, a massive effort has been done to develop small inhibitors targeting mutant IDH. In this review, we summarize current knowledge about the cellular and molecular consequences of IDH mutations, and the therapeutic approached developed to target IDH mutant tumours, with a focus on gliomas.

Aim: To establish, through molecular modelling, safe and clinically acceptable putative antagonists of E571K-mutated exportin-1 among the bioactive compounds in various parts of Juglans mandshurica. Methods: The bioactive compounds were subjected to compendium of druglikeness and lead-likeness filter workflows prior to docking of the resultant compounds into E571K exportin-1 active site using PyRx AutoDock vina to establish their binding affinity and interaction profile. The evolutionary algorithm of Osiris property explorer DataWarrior software as well as lead-likeness filter were employed for generation of novel non-promiscuous analogues of the lead compound with better putative selectivity and clinical acceptability as E571K Exportin-1 antagonists.Results: The findings of this study present taxifolin as the putatively effective and lead-like E571K Exportin-1 inhibitor with high potential of qualifying for clinical evaluation but is associated with high promiscuity tendency in high throughput screening. The evolutionary derivation of novel analogues of the compound, however, results in the generation of putatively non-promiscuous, non-toxic, and lead-like E571K Exportin-1 antagonists with high synthetic accessibility and clinical developability for evaluation in the strategy for treatment of drug-resistant KRAS-mutant lung adenocarcinoma condition.

Diffuse midline gliomas are among the deadliest human cancers and have had little progress in treatment in the last 50 years. Cell cultures of these tumors have been developed recently, but it is unknown the degree to which such cultures retain the characteristics of the source tumors. DNA methylation profiling offers a powerful tool to look at genome-wide epigenetic changes that are biologically meaningful and can help assess the similarity of cultured tumor cells to their in vivo progenitors. Paraffinized diagnostic tissue from three diffuse intrinsic pontine gliomas with H3 K27M mutations was compared with subsequent passages of neurosphere cell cultures from those tumors. Each cell line was passaged 3-4 times and analyzed with DNA methylation arrays and standard algorithms that provided comparison of diagnostic classification and cluster analysis. All samples tested maintained high classifier scores and clustered within the reference group of H3 K27M-mutant diffuse midline gliomas. There was a gain of 1q in all cell lines, with two cell lines initially manifesting the gain of 1q only during culture. In vitro cell cultures of H3 K27M-mutant gliomas maintain high degrees of similarity in DNA methylation profiles to their source tumor, confirming their fidelity even with some chromosomal changes.

Tyrosyl-DNA phosphodiesterase 1 (TDP1) is a human DNA repair protein. It is a member of the phospholipase D family based on the structure similarity. TDP1 is a key enzyme involved in repairing stalled topoisomerase 1 (TOP1)-DNA complexes. Previously we obtained with the CRISPR/Cas9 method HEK293A cells with the homozygous knockout of the Tdp1 gene and used knockout cells as a cellular model for studying the mechanisms of anticancer therapy. In this work we studied for the first time by transcriptomic analysis the effect of Tdp1 gene knockout on genes expression changes in human HEK293A cell line. We received original data that may indicate a role of TDP1 in other process besides repair of DNA-TOP1 complex. The differentially expressed genes (DEGs) analysis revealed that TDP1 could be involved in different processes such as cell adhesion and communication, spermatogenesis, mitochondrial function, neurodegeneration, cytokine response, and MAPK pathway signaling.

Phospholipid metabolism, including phosphatidylcholine (PC) biosynthesis, is crucial for various biological functions and is associated to longevity. Phosphatidylethanolamine N-methyltransferase (PEMT) is a protein that catalyzes the biosynthesis of PC, the levels of which change in various organs such as brain and kidney during aging. However, the role of PEMT for systemic PC supply is not fully understood. To address how PEMT affects aging-associated energy metabolism in tissues responsible for nutrient absorption, lipid storage and energy consumption, we employed NMR-based metabolomics to study liver, plasma, intestine (duodenum, jejunum, ileum), brown/white adipose tissues (BAT, WAT), and skeletal muscle of young (9–10 weeks) and old (96–104 weeks) wild-type (WT) and PEMT knockout (KO) mice. We found that the effect of PEMT-knockout was tissue-specific and age-dependent. Deficiency of PEMT affected the metabolome of all tissues examined, among which the metabolome of BAT from both young and aged KO mice was dramatically changed in comparison to WT mice, whereas the metabolome of jejunum was only slightly affected. As for aging, the absence of PEMT increased the divergence of metabolome during aging of liver, WAT, duodenum and ileum and decreased the impact on skeletal muscle. Overall, our results suggest that PEMT plays a previously unexplored critical role in both aging and energy metabolism.

Background: Methotrexate (MTX) displayed cytotoxic properties against some cancer cells. However, there is very limited data about the possible anti-tumoral potential of them in breast cancer (BC) cells. We aimed to determine the effects of MTX, which is widely used in clinical practice, on cell viability, Hypoxia-inducible factor (HIF) -1α, HIF-2α and prolyl 4-hydroxylase-transmembrane (P4H-TM) in BC cells (MCF-7) and health breast cell (HTERT-HME1) treated with MTX. Methods: Human healthy breast cells (HTERT-HME1) and BC cells (MCF-7) treated with MTX for 24 h, 48h, and 72 h, the effects of MTX on cell viability. Results: The cell viability and with half-maximal inhibitory concentration (IC50) values of of MTX treatment in healthy breast cells were determined to be higher than in MCF-7 cells. MTX showed higher cytotoxicity against MCF-7 cells. MTX significantly reduced cell viability values in HTERT-HME1 and MCF-7 cells. HIF-1α, HIF-2α, and P4H-TM levels was significantly higher in the MCF-7 group than the other groups. Morever, there was a moderate significant correlation between HIF-1α and HIF-2α levels and between HIF-1α and P4H-TM. Conclusions: MTX will show a further decrease in cell viability in long-term treatments of 48 and 72 hours, it is predicted that short-term use may be more appropriate. P4H-TM may be a novel regulator of hypoxia in BC cells. HIF-1α, a key protein responsible for the molecular mechanism of hypoxia in cells, is a key mediator between P4H-TM and hypoxia in MTX-treated cells. HIF-1α, HIF-2α, and P4H-TM values may be markers that can be used as a panel to differentiate BC from healthy women.

The current classification of acute myeloid leukemia (AML) relies largely on genomic alterations. AML with mutated Nucleophosmin1 (NPM1-mut) is the largest of the genetically defined groups, involving about 30% of adult AMLs and is currently recognized as a distinct entity in the actual AML classifications. NPM1-mut AML usually occurs in de novo AML and is associated predominantly with a normal karyotype and relatively favorable prognosis. However, NPM1-mut AMLs are genetically, transcriptionally, and phenotypically heterogeneous. Furthermore, NPM1-mut is a clinically heterogenous group. Recent studies have in part clarified the consistent heterogeneities of these AMLs and have strongly supported the need for an additional stratification aiming to improve the therapeutic response of the different subgroups of NPM1-mut AML patients.

Mutations in epidermal growth factor receptor (EGFR) occur in about 48% of Asian and 19% of Western patients with lung adenocarcinoma (LUAD), leading to its constitutive activation and subsequent uncontrolled cell proliferation. To counteract this, tyrosine kinase inhibitors (TKIs) have been developed, targeting EGFR activity. However, the emergence of metastases and resistance mutations often undermines the durability of the treatment response. Knowledge-based mechanistic models that replicate existing clinical trial outcomes, tailored to specific population characteristics, provide invaluable assistance in designing future clinical trials. These models are particularly effective in identifying optimal responders to specific treatments, thereby enhancing therapeutic efficacy. We have developed physiologically based pharmacokinetic (PBPK) models for gefitinib and osimertinib, representing two distinct generations of EGFR TKIs, to accurately simulate the drugs’ distribution within the primary tumor and metastatic sites following oral administration. These models were integrated with a pathophysiological mechanistic model of EGFR-mutant LUAD, enabling the representation of the effects of both gefitinib and osimertinib on EGFR activation-induced signaling pathways. This comprehensive model outputs detailed evolutions of the primary tumor and each metastatic site, facilitating the evaluation of patient progression in alignment with RECIST guidelines (version 1.1). Notably, the model encapsulates the heterogeneity within the tumor, through the representation of various subclones, each characterized by unique mutation profiles, thereby reflecting differential responses to treatment. Calibration of the model was achieved using publicly available data from the NEJ002 and FLAURA clinical trials. Rigorous visual predictive checks and statistical tests were employed to ensure the proper behavior of the model. The model adeptly replicated the time to progression observed in real clinical trials in EGFR-mutant LUAD patients receiving gefitinib or osimertinib as first-line therapy. In addition, the model was able to reproduce the results from a retrospective study comparing gefitinib and osimertinib, a study that was not used to inform the model. With a consistent virtual population as a reference, the combined model facilitated a comparative analysis of the efficacy of both treatments, thereby underscoring its utility in evaluating therapeutic strategies. The faithful replication of real-world data significantly enhances the credibility of our model, rendering it a vital investigational tool for deriving pertinent insights and informing treatment strategies, particularly in identifying optimal responders to various generations of EGFR TKIs. Following its consecutive prospective validations in the FLAURA2 and MARIPOSA trials, the model is poised to facilitate the generation of synthetic control arms in future clinical trials. This advancement promises a more nuanced analysis of covariate relationships, especially when comparing investigational treatments to established standards of care. Additionally, it potentially reduces the required patient cohort size in such trials, optimizing resource utilization.

The KRAS mutant population has been undruggable for 40 years. G12C inhibitors and immunotherapy are the beginning of success. It is necessary to summarize the successful experience of the existing treatment model and explore the direction of the next treatment. In this review, we discuss the latest developments in targeted therapy and immunotherapy for KRAS-mutation NSCLC, aiming to provide direction or enlightenment for future treatment strategies.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Methylmercury (MeHg) intoxication is a global health concern. Although MeHg neurotoxicity is well-recognized, less is known about MeHg's effects on metabolism. In this study, we evaluated MeHg intoxication (20mg/L in drinking water for 20 days) effects on liver and epididymal white fat (EWF) in young ApoE knockout (ko) and wild-type mice. The former is well-known to show spontaneous dyslipidemia. Hg levels in hair, liver, and EWF were measured to assess the degree of MeHg exposure. We also evaluated body weight gain, plasma triglycerides, total cholesterol levels, and liver injury by assessing steatosis score, AST, ALT, SOD, and TBAR levels. To evaluate EWF, we analyzed mean wet weight and adipocyte diameter, plasma leptin levels and metabolomics. Hg levels were markedly higher among intoxicated mice. ApoE ko mice showed higher Hg in the hair but lower levels in the liver and EWF than wild-type controls. Among wild-type mice, MeHg compromised weight gain and increased liver TBAR levels compared to non-challenged controls. Among non-intoxicated mice, ApoE deficiency significantly increased triglyceride, total cholesterol, and liver transaminases with reduced EWF wet weight, hepatic SOD, and plasma leptin levels. MeHg accumulation together with ApoE deficiency elevated total cholesterol, triglycerides, hepatic transaminases, and TBARS. We found distinct EWF metabolite activity in different scenarios of ApoE deficiency and MeHg intoxication, highlighting increased cardiovascular risk especially when both challenges occur. Further studies are required to elucidate the underlying mechanisms involved in these effects and the target nutritional interventions in most need to ameliorate them.

TP53 is a tumor suppressor gene that encodes a sequence-specific DNA-binding transcription factor activated by stressful stimuli and upregulates target genes involved in growth suppression, cell death, DNA repair, metabolism, among others. P53 is the most frequently mutated gene in tumors with mutations not only leading to loss-of-function (LOF), but also gain-of-function (GOF) which promotes tumor progression, and metastasis. The tumor-specific status of mutant p53 protein has suggested it is a promising target for cancer therapy. We summarize the current progress of targeting wild-type and mutant p53 for cancer therapy through biotherapeutic and biopharmaceutical methods for 1) boosting p53 activity in cancer, 2) p53-dependent and p53-independent strategies for targeting p53 pathway functional restoration in p53-mutated cancer, 3) targeting p53 in immunotherapy, and 4) combination therapies targeting p53, p53 checkpoints, or mutant p53 for cancer therapy.

Bacteria’s ability to withstand the detrimental effects of antimicrobials may take the form of resistance or tolerance with the minimum inhibitory concentration (MIC), the mutant prevention concentration (MPC), and the mutant selection window as salient concepts. Isolates exposed for 30 days to different concentrations of selected antibiotics, biocides, and heavy metals, singly and in combination, were additionally exposed to very high (15 × MIC) concentrations of ampicillin., and their tolerance was calculated the time to kill 99.9% of the isolate population (MDK99.9). These values were increased by 30 to 50% in test isolates compared to the untreated control. BAC 10-exposed isolates had the highest tolerance increase, and the tolerance appeared to originate from two sources, i.e., stochastic persistence and genetic-induced persistence, involving multiple genes using diverse mechanisms. The mutant selection window of the isolates to ampicillin, amoxicillin, and oxytetracycline also slightly increased compared to the control, indicating the amplification of persister cells during the 30-day exposure. These findings indicate that bacterial exposure to sub-inhibitory concentrations of environmental chemical stressors may not always result in the development of antimicrobial resistance but could initiate this process by selecting for persisters that could evolve into resistant isolates.

Patients with neurodegenerative diseases (NDDs) are rapidly increasing all over the world. Alzheimer’s disease (AD), Parkinson’s disease, Huntington’s disease (HD), frontotemporal lobar degeneration (FTLD) and many other diseases are classified as NDDs, however, no therapeutic drugs have been developed against NDDs yet. As common phenomenon, protein oligomers and aggregates (inclusion bodies) are formed in neurons, and they trigger neuronal cell death and/or axonal degeneration. We have investigated the mechanisms of NDDs, and discovered several chemicals and peptides have potential to cure NDDs. Here, we show phorbol 12-myristate 13-acetate (PMA) significantly inhibits aggregate formation and promotes neurite regeneration in human neuronal cell culture model of NDDs, FTLD and AD. We expressed R406W mutant tau protein found in FTLD patients in human neuroblastoma SH-SY5Y cells as FTLD cell culture model. These FTLD neuronal cells showed intracellular aggregate formation and impaired neurite growth. Addition of PMA to culture medium 60% suppressed aggregate formation. PMA also enhanced neurite growth to the normal level at nanomolar concentration. We cultured SH-SY5Y cells in the medium containing -amyloid (1-42) as AD cell culture model. In these cells, neurite growth was limited to less than 50% of controls by the treatment of -amyloid (1-42). Surprisingly, addition of PMA increased the number of cells with >10-fold neurite extension to seven times even in -amyloid (1-42) contained medium. Also, PMA increased the expression of several genes and proteins important for cell survival in both cell culture models. These results suggest PMA has unexpected potential for the drug development against NDDs.

UPF3B is a constituent of the classical nonsense-mediated mRNA decay (NMD) pathway that degrades both the aberrant transcripts and a set of physiological transcripts. In higher eukaryotes, UPF3B have significant biochemical functions in diverse cellular processes including NMD and translation. UPF3B plays a crucial role in neuronal development and differentiation. Next-generation sequencing technologies identified several loss-of-function mutations in the UPF3B gene that results in neuro-developmental disorders in humans. To uncover the mechanistic role of UPF3B in neuronal functions, we have generated the UPF3B-knockout mammalian cell line model system using CRISPR-Cas9 gene editing method. RNA-Sequencing Analysis of cellular transcriptome from UPF3B-KO cells identified specific genes involved in cell growth and neuronal functions. Altered expression of genes related to the axon guidance pathway delineated the UPF3B function to regulate the neuron-specific genes. Functional enrichment analysis identified the genes involved in the disorders related to mental health and intellectual disability. Our study has the potential to identify the direct players of intellectual disability and will have broader implications.

The article presents the results of the γ-ray and fast neutrons impact on various rice species, in order to obtain mutant forms resistant to salinity (NaCl) and drought factors (sorbite). They are going to be used as initial forms in synthetic selection when creating varieties, adapted to the stressful conditions of, both, soil and climate in the Kazakhstan Aral Sea. The average lethal doses (LD50) of γ-rays and fast neutrons, as well as, the average NaCl and sorbite lethal concentrations were established. A distinct dependence on the effect of ionizing radiation and stress factors on the number of induced resistant mutant forms has been related to the initial rice variety. The largest number of mutant forms was obtained from the local variety Syr Suluy, followed by Leader and Aikerim varieties. Out of all varieties, only 1% of the initially irradiated by γ-rays seeds survived, while after fast neutron irradiation – 4,3%. M1 mutant plants significantly differ from the initial forms in terms of morphological features – plant height, panicle length, and grain size. They are tolerant to lodging, and have short and highly sterile panicles, indicating that they are mutants.

Memory and emotion are highly vulnerable to psychiatric disorders like post-traumatic stress disorder (PTSD), which has been linked to serotonin (5-HT) metabolism disruptions. In fact, over 90% of the 5-HT precursor tryptophan (Trp) is metabolized via the Trp-kynurenine (KYN) meta-bolic pathway, producing a variety of bioactive molecules. The aadat (kat2) gene encodes mito-chondrial kynurenine aminotransferase (KAT) isotype 2, responsible for kynurenic acid (KYNA) production. Little is known about its role in behavior. In CRISPR/Cas9-induced aadat knockout (kat2−/−) mice, we examined the effects on emotion, memory, motor function, Trp and its metabolite levels, enzyme activities in the plasma and the urine of 8-week-old males compared to wild-type mice. Transgenic mice showed more depressive-like behaviors in the forced swim test, but not in the tail suspension, anxiety, or memory tests. They also had fewer center field and corner entries, shorter walking distances, and fewer jumping counts in the open field test. Plasma metabolite levels are generally consistent with those of urine: KYN, antioxidant KYNs, 5-hydroxyindolacetic acid, and indole-3-acetic acid levels are lower; enzyme activities in KATs, kynureninase, and monoamine oxidase/aldehyde dehydrogenase are lower, but kynurenine 3-monooxygenase is higher; and ox-idative stress and excitotoxicity indices are higher. Transgenic mice show depression-like behavior in a learned helplessness model, emotional indifference, and motor deficits, coupled with a decrease in KYNA, a shift of Trp metabolism toward the KYN-3-HK pathway, and a partial decrease in the gut microbial Trp-indole pathway metabolite. This is the first evidence that deleting the aadat gene causes depression-like behaviors that are unique to despair experience, which appears to be linked to excitatory neurotoxic and oxidative stresses. This may lead to the development of a double-hit preclinical model in experience-based depression, better understanding of these complex condi-tions, and more effective therapeutic strategies by elucidating the relationship between Trp me-tabolism and PTSD pathogenesis.

In bioprocess development, the host and the genetic construct for a new biomanufacturing process are selected in the early developmental stages. This decision, made at the screening scale with very limited information about the performance of the selected cell factory in larger reactors, has a major influence on the performance of the final process. To overcome this, scaledown approaches are essential to run screenings that show the real cell factory performance at industrial like conditions. We present a fully automated robotic facility with 24 parallel mini-bioreactors that is operated by a model based adaptive input design framework for the characterization of clone libraries under scale-down conditions. The cultivation operation strategies are computed and continuously refined based on a macro-kinetic growth model that is continuously re-fitted to the available experimental data. The added value of the approach is demonstrated with 24 parallel fed-batch cultivations in a mini-bioreactor system with eight different Escherichia coli strains in triplicate. The 24 fed-batches ran under the desired conditions generating sufficient information to define the fastest growing strain in an environment with varying glucose concentrations similar to industrial scale bioreactors.

Enzyme immobilization is known to enhance polypeptide resistance towards environmental changes, particularly in terms of their stability. The Y509E mutant of β-xylosidase from Geobacil-lus stearothermophilus (XynB2Y509E) (which also bears xylanase activity) has been immobilized in chitosan spheres through either entrapment or covalent bond formation methods. In the immo-bilization by entrapment, besides observing a total loss of xylanase activity, it was found that chitosan concentration affects the process efficiency. Additionally, the maturation time of the spheres and the alkaline pH used to precipitate the spheres affect the β-xylosidase activity of the enzyme. In covalent bond immobilization, it was found that the pH during the modification with glutaraldehyde, as well as the subsequent protein binding, were key factors in preserving the dual enzymatic activity. The activity expressed after immobilization by covalent bonding was 23% higher compared to the activity expressed following entrapment immobilization, with values of 122.3 and 99.4 U. g-1, respectively. Both biocatalysts showed increased thermal and pH stability, along with an improved storage capacity, as they retained 40% and 88% of their activi-ty after being stored at 4 C for two months. Moreover, XynB2Y509E immobilized by covalent binding also exhibited outstanding reusability, retaining a 92% of activity after ten cycles of re-use.

The endomembrane system in plant cells enables the cell to manage and coordinate a variety of membranous compartments so that they and their contents arrive at the right location. The secretory pathway takes part in this complex network and has its gateway at the Endoplasmic Reticulum. Therefore, alterations at the Endoplasmic reticulum level could condition how protein trafficking takes place or, at least, influence how such cargo leaves this organelle. With this work, we intended to assess how abnormalities at the Endoplasmic Reticulum would interfere with protein sorting and trafficking. Thus, we used a novel Arabidopsis mutant - leb-2 GFP-h -, presenting ER morphology alterations. Our results show that alterations in the leb-2 GFP-h mutant did not disrupt PSI A/B–mCherry transport to the vacuole but influences the expression of endogenous aspartic proteinases. Furthermore, the study of key-endomembrane genes expression revealed an upregulation of the SNAREs AtVAMP722 and AtVAMP723. As a whole, the leb-2 mutant seems not to interfere with vacuolar routes but may be implicated in secretion events.

The successive waves of the Covid-19 pandemic are driven by SARS-CoV-2 variants that reached critical detection levels in different parts of the world. But how evolved the Wuhan virus since its detection in December 2019 into the Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2) and Omicron (B.1.1.529) variants of concern? This is a story of mice and men, of up to 1,000,000 infected cells in one person, where each cell produces between 10⁵ and 10⁶ viral RNAs, of immune-compromised patients, the digestive tract and viral recombination.

Mucosal vaccines can target specific mucosal surfaces, such as the respiratory, genital, or intestinal mucosa. Conventional systemic immunization, such as intramuscular injections, do not provide mucosal immunity, including IgA, nor do they prevent pathogens from entering the mucous membranes. Nasal immunization protects mucosal membranes, but nasal antigen presentation appears to entail adjuvant to stimulate immunogenicity. Current treatments for mucosal diseases such as inflammatory bowel disease (IBD) and allergic dermatitis only aimed to temporarily relieve symptoms. Moreover, these treatments not only have drug resistance or side effects, but the disease can recur, leading to switching to other treatments. Therefore, there is a need to develop safe and effective treatments that provide better long-term outcomes to reduce the risk of recurrence. Regulatory T (Treg) cells have been used to suppress inflammation. To find advances in mucosal treatment, we investigated the therapeutic effects of intranasal pep27 mutant immunization. Here, a new method of Treg induction through intranasal immunization without adjuvant has been developed to potentially overcome allergies and mucosal inflammation of the lung-gut axis in animal models. The implementation of the pep27 mutant for these therapies should be preceded by studies of Treg resilience through clinical translational studies of dietary changes.

Presynaptic Ca²⁺-influx through voltage-gated Ca²⁺ channels (VGCC) is a key signal for synaptic vesicle release. Synaptic neurexins can partially determine the strength of transmission by regulating VGCCs. However, it is unknown whether neurexins modulate Ca²⁺-influx via all VGCC subtypes similarly. Here, we performed live cell imaging of synaptic boutons from primary hippocampal neurons with a Ca²⁺-indicator. We used the expression of inactive and active Cre recombinase to compare control to conditional knockout neurons lacking either all or selected neurexin variants. We found that reduced total presynaptic Ca²⁺-transients caused by the deletion of all neurexins were primarily due to the reduced contribution of P/Q-type VGCCs. The deletion of neurexin1α alone also reduced the total presynaptic Ca²⁺-influx but increased Ca²⁺-influx via N-type VGCCs. Moreover, we tested whether the decrease of Ca²⁺-influx induced by activation of cannabinoid receptor 1 (CB1-receptor) is modulated by neurexins. Unlike earlier observations emphasizing a role for β-neurexins, we found that the decrease of presynaptic Ca²⁺-transients induced by CB1-receptor activation depended more strongly on the presence of α-neurexins in hippocampal neurons. Together, our results suggest that neurexins have unique roles in the modulation of presynaptic Ca²⁺-influx through VGCC subtypes and that different neurexin variants may affect specific VGCCs.

Purpose: Inducible Slc4a11 KO leads to corneal edema by disruption of the pump and barrier functions of the corneal endothelium (CE). The loss of Slc4a11 NH3-activated mitochondrial uncoupling leads to mitochondrial membrane potential hyperpolarization-induced oxidative stress. The goal of this study is to investigate the link between oxidative stress and failure of pump and barrier functions and test different approaches to revert the process. Methods: Mice homozygous for Slc4a11 Flox and Estrogen receptor –Cre Recombinase fusion protein alleles at 8 weeks of age were fed Tamoxifen (Tm) enriched chow (0.4 g/Kg) for 2 weeks, and controls were fed normal chow. During the initial 14 days, Slc4a11 expression, corneal thickness (CT), stromal [lactate], Na+-K+ ATPase activity, mitochondrial superoxide levels, expression of lactate transporters, and activity of key kinases were assessed. In addition, barrier function was assessed by fluorescein permeability, ZO-1 tight junction integrity, and cortical cytoskeleton F-actin morphology. Results: Tm induced a rapid decay in Slc4a11 expression that was 84% complete at 7 days and 96% at 14 days of treatment. Superoxide levels increased significantly by day 7; CT and fluorescein permeability by day 14. Tight junction ZO-1 distribution and cortical cytoskeleton were disrupted at day 14 concomitant with decreased expression of Cldn1 yet an increase in tyrosine phosphorylation. Stromal lactate increased by 60%, Na+-K+ATPase activity decreased by 40%, and expression of lactate transporters MCT2 and MCT4 significantly decreased, but MCT1 was unchanged at 14 days. Src kinase was activated but not Rock, PKCα, JNK, or P38Mapk. Mitochondrial antioxidant Visomitin (SkQ1, mitochondrial targeted antioxidant) or Src kinase inhibitor eCF506 significantly slowed the increase in CT, with concomitant decreased stromal lactate retention, improved barrier function, reduced Src activation and Cldn1 phosphorylation, and rescued MCT2 and MCT4 expression. Conclusions: Slc4a11 KO-induced CE oxidative stress triggered increased Src kinase activity that results in perturbation of pump components and barrier function of the CE.

Juvenile myelomonocytic leukemia (JMML) is a deadly pediatric leukemia driven by RAS pathway mutations, of which >35% are gain-of-function in PTPN11. Although DNA hypermethylation portends severe clinical phenotypes, the landscape of histone modifications and chromatin profiles in JMML patient cells have not been explored. Using global mass cytometry, Epigenetic Time of Flight (EpiTOF), we analyzed hematopoietic stem and progenitor cells (HSPCs) from five JMML patients with PTPN11 mutations. These data revealed statistically significant changes in histone methylation, phosphorylation and acetylation marks that were unique to JMML HSPCs when compared with healthy controls. Consistent with these data, assay for transposase-accessible chromatin with sequencing (ATAC-seq) analysis revealed significant alterations of chromatin profiles at loci encoding post translational modification enzymes, strongly suggesting their mis-regulated expression. Collectively, this study reveals histone modification pathways as an additional epigenetic abnormality in JMML patient HSPCs, thereby uncovering a new family of potential druggable targets for the treatment of JMML.

EGFR tyrosine kinase inhibitors (TKIs) are the preferred initial treatment for non-small cell lung cancer (NSCLC) patients harboring EGFR mutations. However, remission is transient, and no further effective treatment options are available for EGFR-TKI-advanced EGFR-mutant NSCLCs. Immunotherapy with immune checkpoint inhibitors (ICIs) induces sustained cancer remission in a subset of NSCLCs. However, ICI therapy exhibits limited activity in most EGFR-mutant NSCLCs. Mechanistically, the strong oncogenic EGFR signaling in EGFR-mutant NSCLCs contributes to the non-inflamed tumor immune microenvironment (TIME), characterized by a limited number of CD8+ T cell infiltration, a high number of regulatory CD4+ T cells and a high number of inactivated infiltrated T cells. Besides, EGFR-mutant NSCLC patients are generally non-smokers with low levels of PD-L1 expression and tumor mutation burden. However, current understanding only partially explains why a small population of EGFR-mutant NSCLCs durably respond to ICI therapy, resulting in many researchers actively working in this field. This review reviews the hope seen from pre-clinical studies and clinical trials which may be adopted to improve the outcome of ICI therapy in EGFR-mutant NSCLCs. Besides, the underlying mechanisms leading to the inferior clinical outcome of ICI therapy in EGFR-mutant NSCLCs are discussed.

Next generation sequencing (NGS) from SARS-CoV-2-positive swabs collected during the last months of 2022 revealed a large deletion between ORF7b and ORF8 (426 nt) in six patients infected with the BA.5.1 Omicron variant. This extensive genome loss removed a large part of these two genes, maintaining in frame the first 22 aminoacids of ORF7b and the last 3 aminoacids of ORF8. Interestingly, the deleted region was flanked by 2 small repeats, likely involved in the formation of a hairpin structure. Similar rearrangements, comparable in size and location to the deletion, were also identified in 15 sequences in the NCBI database. In this group, 7 out of 15 cases from the USA and Switzerland presented both the BA.5.1 variant and the same 426 nuclotides deletion. It is noteworthy that 3 out of 6 cases were detected in patients with immunodeficiency and is conceivable that this clinical condition could promote the replication and selection of these mutations.

To reveal rare phenotypes in bacterial populations conventional microbiology tools should be advanced to generate rapid, quantitative, accurate and high-throughput data. The main drawbacks of widely used traditional methods for antibiotic studies include low sampling rate and averaging data for population measurements. To overcome these limitations microfluidic-microscopy systems have great promise to produce quantitative single-cell data with high sampling rates. Using Mycobacterium smegmatis cells we applied both conventional assays and a microfluidic-microscopy method to reveal antibiotic-tolerance mechanisms of wild type and the msm2570::Tnmutant cells. Our results revealed that the enhanced antibiotic tolerance mechanism of the msm2570::Tn mutant was due to the low number of lysed cells during the antibiotic exposure compared with wild-type cells. This is the first study that characterized the antibiotic-tolerance phenotype of the msm2570::Tn mutant that has a transposon insertion in the msm2570 gene encoding a putative xanthine/uracil permease, which enrolls in uptake of nitrogen compound during nitrogen limitation. The experimental results indicate that the msm2570::Tn mutant can be further interrogated to reveal antibiotic killing mechanisms, in particularly, antibiotics those targets cell wall integrity.

microRNAs can cause male infertility by impacting sperm quality and impaired spermatogenesis. Since the miR-125 family plays an important role in regulating embryo development, but the function of miR-125b-2 in male reproduction remains unknown. In this study, we prepared a model of miR-125b knockout (KO) mice. Among the KO mice, the progeny test showed that litter sizes decreased significantly and the rate of non-parous females increased significantly (p<0.05). At the same time, the testosterone concentration increased significantly (p<0.01), with the remarkable decrease for estradiol (p<0.05). Moreover, sperm count decreased obviously (p<0.05) and the percentage of abnormal sperms increased significantly (p<0.01). Testicular transcriptome sequencing demonstrated that there were 173 up-regulated genes, including Papolb (PAP), and 151 down-regulated genes in KO mice compared with wild type (WT). KEGG and GO analysis showed many of these genes were involved in sperm mitochondrial metabolism and other cellular biological processes. Meanwhile, the sperm mitochondria DNA (mtDNA) copy number was increased significantly (p<0.01) in KO mice, but the integrity of mtDNA and nuclear DNA (nDNA) had no change. In the top 10 up-regulated genes, as a testis specific expressing gene, PAP can affect the process of spermatogenesis. Western blotting and Luciferase Assay validated that PAP was the target of miR-125b-5p. Intriguingly, we also found that both miR-125b and PAP were only highly expressed in germ cells (GC) instead of Leydig cells (LC) and Sertoli cells (SC), and miR-125b-5p could target PAP to regulate TM3 cell secretion of testosterone (p<0.05). Our study firstly demonstrated that miR-125b-2 could regulate testosterone secretion by directly targeting PAP and increase sperm mtDNA copy number to affect semen quality. The study indicated that miR-125b-2 had a positive influence on the reproductive performance of animal and could be a potential therapeutic target for male infertility.

Metal, primarily Fe and Zn, deficiencies affect over half of the world's population. Human diets with prevalent cereal products cause micronutrient malnutrition. Biofortification is one of the most effective approaches to alleviate malnutrition. Spring wheat genetically stable (M7) mutant lines developed with 100 and 200 Gy gamma treatments to broaden genetic variation and search for new resources were analyzed for nutritionally important minerals (Ca, Mg, K, Fe, and Zn), their bioavailability, and grain protein content (GPC). The variation was 172.3–883.0 mg/kg for Ca, 472.9–1088 mg/kg for Mg, 3128.6–5487.5 mg/kg for K, 40.9–89.0 mg/kg for Fe, and 22.2–89.6 mg/kg for Zn. In mutant lines, among the investigated minerals, the highest increases in concentrations were observed in Fe, Zn, and Ca when compared to the parent. Some mutant lines, mostly in the 100 Gy-derived germplasm, had two to three times higher Fe, Zn, and Ca concentrations, lower phytic acid concentration (1.4–2.1 times), and 6.5–7% higher GPC compare to the parent. Variation was detected for the Ca:Phy, Mg :Phy, Phy:K, Phy:Fe, and Phy:Zn molar ratios, (1.27–10.41, 5.05–18.68, 1.66–4.87, 1.40–5.32 and 1.78–11.78, respectively). The results showed how the genetic variation could be generated through radiation and be useful to develop biofortification by micronutrient varieties with their appropriate bioavailability to overcome malnutrition.

Monitored infection and vaccination rates during past past Corona waves are used to infer a posteriori two key parameter of the SIRV-epidemic model, namely the real time variation of the (i) ratio of recovery to infection rate and (ii) ratio of vaccination to infection rate. We demonstrate that using the classical SIR model the ratio between recovery and infection rates tends to overestimate the true ratio, that is of relevance in predicting the dynamics of an epidemics in the presence of vaccinations.

Identification of recurrent driver mutations in genes encoding tyrosine kinases has resulted in the development of molecularly targeted strategies designed to improve the outcomes for patients diagnosed with acute myeloid leukemia (AML). The receptor tyrosine kinase FLT3, is the most commonly mutated gene in AML, with internal tandem duplications within the juxtamembrane domain (FLT3-ITD) or missense mutations in the tyrosine kinase domain (FLT3-TKD), present in 30%-35% of AML patients at diagnosis. An established driver mutation and marker of poor prognosis, the FLT3 tyrosine kinase has emerged as an attractive therapeutic target, and thus has encouraged the development of FLT3 tyrosine kinase inhibitors (TKIs). However, the therapeutic benefit of FLT3 inhibition, particularly as monotherapy, frequently results in the development of treatment resistance and disease relapse. Commonly, FLT3 inhibitor resistance is induced by the emergence of secondary lesions in the FLT3 gene, particularly in the second tyrosine kinase domain at residue Asp835 (D835) to form a ‘dual mutation’ (ITD-D835). Individual FLT3-ITD and FLT3-TKD mutations influence independent signaling cascades however, currently little is known which divergent signaling pathways are controlled by each of these FLT3 specific mutations, particularly in the context of patients harboring dual ITD-D835 mutations. This review provides a comprehensive analysis of the known discrete and cooperative signaling pathways regulated by each of the FLT3 specific mutations, as well as the therapeutic approaches that hold the most promise for development of more durable and personalized therapeutic approaches targeting mutant FLT3, to improve the treatment of AML.

Aim: Complementary effects of dabigatran etexilate (DE), exercise training (ET) and combination (DE+ET) on the development and composition of the atherosclerotic lesions in diabetic apoE knockout (apoE-/-) mice. Methods: In 48 male apoE-/- diabetic mice, streptozotocin (STZ) was induced for 5 consecutive days. Mice received figh-fat diet (HFD) for 8 weeks and were randomized into 4 groups (1.Control/CG, 2.DEG: HFD with DE, 3.ETG: ET on treadmill, 4.DE+ETG: Combination DE and ET treatment). At the end of 8th week, all mice were euthanatized and morphometry of the aortic lesions at the level of aortic valve was obtained. Collagen, elastin, TNF-a, MCP-1, matrix-metalloproteinases (MMP-2,-3,-9), and TIMP-1 concentration within plaques at aortic valve were determined. Results: All active groups had significantly smaller aorta stenosis (DEG:7.9±2.2%, ETG:17.3±5.3%, DE+ETG:7.1±2.7%) compared to CG (23.3±5.5% p&lt;0.05), reduced the relative intra-plaque concentrations of macrophages, MCP-1, MMP-3 and MMP-9, and considerably increased collagen, elastin and TIMP-1 (p&lt;0.05). Group 4 showed the most pronounced results (p&lt;0.05). Both DEG and DE+ETG significantly reduced MMP-2 and TNF-a concentrations compared to ETG and CG (p&lt;0.010). Conclusion: DE and ET treatment in diabetic apoE-/- mice showed complementary amelioration of atherosclerotic lesions development and stability, mediated by the anti-inflammatory modulation of both DE and ET.

Background: Obesity and its attendant conditions have become major health problems worldwide and is currently ranked as the fifth most common leading cause of death globally. Complex environmental and genetic factors are the cause of the current obesity epidemic. Diet, lifestyle, chemical exposures, and other confounding factors are difficult to manage in humans. The mice model is helpful in researching genetics BW gain because genetic and environmental risk factors can be controlled in mice. Studies in mouse strains with various genetic backgrounds and established genetic structures provide unparalleled opportunities to find and analyze trait-related genomic loci. In this study, we used the Collaborative Cross (CC), a large panel of recombinant inbred mouse strains, to present a predictive study using CC mice SMAD4 knockout profiles to understand and effectively identify predisposition to body weight gain. Materials and Methods: Male C57Bl / 6J Smad4+/- mice were mated with female mice from 10 different CC lines to create F1 mice (Smad4+/- x CC). Body weight (BW) was measured weekly until week 16, then monthly until the end (week 48). The heritability H2 of the assessed traits was estimated and presented. Comparative analysis of various machine learning algorithms for predicting the BW changes and genotype of mice was conducted. Results and conclusions: Our data showed that the body weight records of F1 mice with different CC lines differed between wildtype and mutant Smad4 mice during the experiment. Genetic background affects weight gain and some lines gained more weight in the presence of Smad4 knockout, while others gained less, but in general, the mutation caused overweight mice, except for a few lines. In both control and mutant groups, female %BW had a higher heritability H2 value than males. Additionally, both sexes with wildtype genotypes showed higher heritability values than the mutant group. Logistic Regression provides the most accurate mouse genotype predictions using machine learning. We plan to validate the proposed method on more CC lines and mice per line to expand machine learning for BW prediction.

APC mutation is the main driver mechanism of CRC development and leads to constitutively activated WNT signaling, overpopulation of ALDH+ stem cells (SCs), and incomplete differentiation. We previously reported that retinoic acid (RA) receptors are selectively expressed in ALDH+ SCs, which provides a way to target cancer SCs with retinoids to induce differentiation. Hypotheses: A functional link exists between WNT and RA pathways, and APC mutation generates a WNT:RA imbalance that decreases retinoid-induced differentiation and increases ALDH+ SCs. Accordingly, to restore parity in WNT:RA signaling, we induced wt-APC expression in APC-mutant CRC cells and assessed the ability of all-trans-retinoic acid (ATRA) to induce differentiation. Notably, ATRA substantially increased expression of the WNT-target gene, CYP26A1, and inducing wt-APC reduced this expression by 50%. Thus, RA and WNT pathways crosstalk to modulate CYP26A1 metabolism of retinoids. We found that inducing wt-APC augments ATRA-induced cell differentiation by: i) decreasing cell proliferation; ii) suppressing ALDH1A1 expression; iii) decreasing ALDH+ SCs; iv) increasing neuroendocrine cell differentiation. Furthermore, NanoString profiling/bioinformatics identified a novel CYP26A1-based network that links WNT and RA signaling. Moreover, CYP26A1 inhibitors sensitized CRC cells to the anti-proliferative effect of drugs that downregulate WNT signaling. Notably. in wt-APC-CRCs, decreased CYP26A1 improves patient survival. These findings have strong potential for clinical translation.

Rapeseed (Brassica napus L.) is one of the most oil crop, and its commercial value is contingent upon its agronomic characteristics and oil quality. In this study, 73,226 single nucleotide polymorphisms (SNPs) across 95 rapeseed mutant lines derived from gamma rays and their original cultivar (‘Tamra’) obtained from genotyping-by-sequencing (GBS) was investigated gene ontology (GO) analysis and genome-wide association study (GWAS). GWAS was conducted on agronomic (plant height, ear length, thousand seed weight and seed yield) and oil (fatty acid and crude fat) traits. GO analysis showed that many genes displaying SNPs were involved in cellular processes, intracellular anatomical structures and organic cyclic compound binding. A total of 149 significant SNPs were associated with the agronomic traits (76 SNPs) and oil traits (73 SNPs). Bna.A05p02350D (SFGH) and Bna.C02p22490D (MDN1) were selected as novel candid genes for thousand seed weight. In addition, Bna.C03p14350D (EXO70) and Bna.A09p05630D (PI4Kα1) were selected as novel candidate genes for the erucic acid and crude fat content, respectively. These findings could facilitate the identification of optimal genotypes for breeding new cultivars, and association studies represent an economically efficient tool for mutant screening and the selection of elite rapeseed-breeding lines.

Abstract: Oleuropein, the major compound of olive leaves, has been reported to exert numerous pharmacological properties, including anti-inflammatory, antidiabetic and anticancer. The purpose of this study is to evaluate, for the first time, the effect of oleuropein-rich leaf extracts (ORLE) in already-developed colon tumours colon tumours arising in an Apc (adenomatous polyposis coli) mutated PIRC rats (F344/NTac-Apcam1137). Here, we were able to investigate in parallel the anti-cancer effect of ORLE, both in vivo and in vitro, and its anti-inflammatory effect on macrophages, which represents a critical and abundant population in most solid tumours microenvironment. We found that in vivo ORLE treatment promoted apoptosis and attenuated iNOS activity both in colon tumours as in peritoneal macrophages of PIRC rats. We confirmed in vitro using primary RAW264.7 cells: ORLE reduced iNOS activity in parallel with COX-2 and pro-inflammatory cytokines, such as IL-1, IL-6 and TGF-. These findings suggest that ORLE possess a strong anti-inflammatory activity, which could be crucial for dampening the pro-tumourigenic activity elicited by a chronic inflammatory state generated by either tumour cells or tumour-associated macrophages.

Diffuse intrinsic pontine glioma (DIPG) is an aggressive pediatric brainstem tumor with a 5-year survival of <1%. Up to 80% of DIPG tumors contain a specific K27M mutation in one of two genes encoding histone H3 (H3K27M). Furthermore, p53 mutations found in >70-80% of H3K27M DIPG, and mutant p53 status is associated with a decreased response to radiation treatment and worse overall prognosis. Recent evidence indicates that H3K27M mutation disrupts tri-methylation at H3K27 leading to aberrant gene expression. Jumonji family histone demethylases collaborates with H3K27 mutation in DIPG by erasing H3K27 trimethylation and thus contributing to derepression of genes involved in tumorigenesis. Since the first line treatment for pediatric DIPG is fractionated radiation, we investigated the effects of Jumonji demethylase inhibition with GSK-J4, and mutant p53 targeting/oxidative stress induction with APR-246, on radio-sensitization of human H3K27M DIPG cells. Both APR-246 and GSK-J4 displayed growth inhibitory effects as single agents in H3K27M DIPG cells. Furthermore, both of these agents elicited mild radiosensitizing effects in human DIPG cells (sensitizer enhancement ratios (SERs) of 1.12 and 1.35, respectively; p<0.05). Strikingly, a combination of APR-246 and GSK-J4 displayed a significant enhancement of radiosensitization, with SER of 1.50 (p<0.05) at sub-micro-molar concentrations of the drugs (0.5 μM). The molecular mechanism of the observed radiosensitization appears to involve DNA damage repair deficiency triggered by APR-246/GSK-J4, leading to the induction of apoptotic cell death. Thus, a therapeutic approach of combined targeting of mutant p53, oxidative stress induction, and Jumonji demethylase inhibition with radiation in DIPG warrants further investigation.

POGZ (Pogo transposable element derived with ZNF domain) is known to function as a regulator of gene expression. While variations in the POGZ gene have been associated with intellectual disabilities and developmental delays in humans, the exact pathophysiological mechanisms re-main unclear. To shed light on this, we created two lines of conditional knockout mice for Pogz, one specific to excitatory neurons (Emx1-Pogz mice) and the other to inhibitory neurons (Gad2-Pogz mice) in the brain. Emx1-Pogz mice showed a decrease in body weight, similar to total Pogz knockout mice. Although the two lines did not display significant morphological ab-normalities in the telencephalon, impaired POGZ function affected the electrophysiological prop-erties of both excitatory and inhibitory neurons differently. These findings suggest that these mouse lines could be useful tools for clarifying the precise pathophysiological mechanisms of neurodevelopmental disorders associated with POGZ gene abnormalities.

Evaluating mutation testing behavior can help decide whether refactoring successfully maintains the expected initial test results. Moreover, manually performing this analytical work is both time-consuming and prone to errors. This paper extends an approach to assess test code behavior and proposes a tool called MeteoR. This tool comprises an IDE plugin to detect issues that may arise during test code refactoring, reducing the effort required to perform evaluations. A preliminary assessment was conducted to validate the tool and ensure the proposed test code refactoring approach is adequate. By analyzing not only the mutation score but also the generated mutants in the pre- and post-refactoring process, results show that the approach is capable of checking whether the behavior of the mutants remains unchanged throughout the refactoring process. This proposal represents one more step toward the practice of test code refactoring. It can improve overall software quality, allowing developers and testers to safely refactor the test code in a scalable and automated way.

Huntington’s disease (HD) is a late-onset; progressive, dominantly inherited neurological disorder marked by an abnormal expansion of polyglutamine (poly Q) repeats in Huntingtin (HTT) protein. The pathological effects of mutant Huntingtin (mHTT) are not restricted to the nervous system but systemic abnormalities including immune dysregulation have been evidenced in clinical and experimental settings of HD. Indeed, mutant huntingtin (mHTT) is ubiquitously expressed and could induce cellular toxicity by directly acting on immune cells. However, it is still unclear if selective expression ofmHTT exon1 in neurons could induce immune responses and hemocyte function. In the present study, we intended to monitor perturbations in the hemocytes population and their physiological functions in Drosophila, caused by pan-neuronal expression of mHTT protein. We found that pan-neuronal expression of mHtt significantly alters crystal cells and plasmatocyte count in larvae and adults with disease progression. Interestingly, plasmatocytes isolated from diseased conditions exhibit a gradual decline in phagocytic activity ex vivo at progressive stages of the disease as compared to age-matched control groups. We also observed an increased production of reactive oxygen species (ROS) in plasmatocytes at advanced stages of the disease. In addition, diseased flies displayed elevated reactive oxygen species (ROS) in circulating plasmatocytes at the larval stage and in sessile plasmatocytes of hematopoietic pockets at of disease. All the parameters were monitored progressively, targeting the circulation at larvae stage and hematopoietic pockets in adults at different disease stages, and many alterations were documented in the early stage itself. These findings strongly implicate that neuronal expression of mHtt alone is sufficient to induce non-cell-autonomous immune dysregulation in vivo. Based on these findings, we propose that further insight into the mechanisms through which neuronal expression of mHtt might be inflicting the innate immune responses would facilitate therapeutic inventions aimed at amelioration of HD pathology and improving the quality of life of the patients.

Cytokinesis is accomplished in higher plants by the phragmoplast, creating and conducting the cell plate, to separate daughter nuclei by a new cell wall. The microtubule-severing enzyme p60-katanin plays an important role in the centrifugal expansion and timely disappearance of phragmoplast microtubules. Consequently, aberrant structure and delayed expansion rate of the phragmoplast occur in p60-katanin mutants. Here, the consequences of p60-katanin malfunction in cell plate/daughter wall formation were investigated by transmission electron microscopy (TEM), while deviations in the chemical composition of cell plate/new cell wall were identified by immunolabeling and confocal microscopy, in root cells of the fra2 Arabidopsis thaliana mutant. It was found that, apart from defective phragmoplast microtubule organization, cell plates/new cell walls appeared also faulty in structure, being unevenly thick and perforated by large gaps. In addition, demethylesterified homogalacturonans were prematurely present in fra2 cell plates, while callose content was significantly lower than in the wild-type. Furthermore, KNOLLE syntaxin disappeared from newly formed cell walls in fra2 earlier than in the wild-type. Taken together, these observations indicate that delayed cytokinesis, due to faulty phragmoplast organization and expansion, results in a loss of synchronization between cell plate growth and its chemical maturation.

Huntington's disease (HD) is a progressive and fatal neurodegenerative disease caused by CAG repeat expansion in the coding region of huntingtin (HTT) protein. The accumulation of mutant HTT (mHTT) contributes to neurotoxicity by causing autophagy defects and oxidative stress that ultimately lead to neuronal death. Interestingly, epidemiologic studies have demonstrated that the prevalence of type-2 diabetes, a metabolic disease mainly caused by defective insulin signaling, is higher in patients with HD than in healthy controls. Although the precise mechanisms of mHTT-mediated toxicity remain unclear, the blockade of brain insulin signaling may initiate or exacerbate mHTT-induced neurodegeneration. In this study, we used an in vitro HD model to investigate whether neuronal insulin signaling is involved in mHTT-mediated neurotoxicity. Our results demonstrated that mHTT overexpression significantly impairs insulin signaling and causes apoptosis in neuronal cells. However, treatment with liraglutide, a GLP-1 analogue, markedly restores insulin sensitivity and enhances cell viability. This neuroprotective effect may be attributed to the contribution of the upregulated expression of genes associated with endogenous antioxidant pathways to oxidative stress reduction. In addition, liraglutide stimulates autophagy through AMPK activation, which attenuates the accumulation of HTT aggregates within neuronal cells. Our findings collectively suggest that liraglutide can rescue impaired insulin signaling caused by mHTT and that GLP-1 may potentially reduce mHTT-induced neurotoxicity in the pathogenesis of HD.

Proteinuria is known to be associated with all-cause and cardiovascular mortality, and nephrotic syndrome is defined by the level of proteinuria and hypoalbuminemia. With advances in medicine, new causative genes for genetic kidney diseases are being discovered increasingly frequently. We reviewed articles on proteinuria/nephrotic syndrome, focal segmental glomerulosclerosis, membranous nephropathy, diabetic kidney disease/nephropathy, hypertension/nephrosclerosis, Alport syndrome, and rare diseases, which have been studied in mouse models. Significant progress has been made in understanding the genetics and pathophysiology of kidney diseases thanks to advances in science, but research in this area is ongoing. In the future, genetic analyses of patients with proteinuric kidney disease/nephrotic syndrome may ultimately lead to personalized treatment options.

The introduction of three single nucleotide mutations into the genome of the virulent RVFV ZH548 strain allows the rescue of a fully attenuated virus in mice (ZH548-rA2). These mutations are located in the viral genes encoding the RdRp and the non-structural protein NSs. This paper shows the results obtained after subcutaneous inoculation of ZH548-rA2 in adult sheep and subsequent challenge with the parental virus (ZH548-rC1). Inoculation with ZH548-rA2 virus caused no detectable clinical or pathological effect in sheep, whereas inoculation of the parental rC1 virus caused lesions compatible with viral infection characterized by the presence of scattered hepatic necrosis. Viral infection was confirmed by immunohistochemistry, with hepatocytes within the necrotic foci appearing as the main cells immunolabelled against viral antigen. Furthermore, inoculation of sheep with rA2 virus prevented the liver damage expected after rC1 virus inoculation, suggesting a protective efficacy in sheep which correlated with the induction of both humoral and cell mediated immune responses.

The global health emergency caused by multi-drug resistant bacteria has led to the search for and development of new antimicrobial agents. Phage therapy is an abandoned antimicrobial therapy that has been resumed in recent years. In this study, we mutated a lysogenic phage from Acinetobacter baumannii into a lytic phage (Ab105-2phiΔCI) showing antimicrobial activity against A.baumannii clinical strains (such as Ab177_GEIH-2000 which showed MICs to meropenem and imipenem of 32 µg/ml and 16 µg/ml, respectively as well as belonging to GEIH-REIPI Spanish Multicenter A. baumannii Study II 2000/2010, Umbrella Genbank Bioproject PRJNA422585). We then enhanced the time kill curves (in vitro) and in Galleria mellonella survival assays (in vivo) antimicrobial activity of the new lytic phage by combining it with carbapenem antibiotics (meropenem and imipenem). We observed in vitro, an antimicrobial synergistic effect (from 4 log to 7 log CFU/ml) with meropenem plus lytic phage in all combinations analysed (0.1, 1 and 10 MOI of Ab105-2phiΔCI mutant as well as 1/4 and 1/8 MIC of meropenem). Moreover, we had a decrease in bacterial growth of 8 log CFU/ml for the combination of imipenem at 1/4 MIC plus lytic phage (Ab105-2phiΔCI mutant) and of 4 log CFU/ml for the combination of imipenem at 1/8 MIC plus lytic phage (Ab105-2phiΔCI mutant) in both MOI 1 and 10. These results were confirmed in in vivo (G. mellonella) obtaining a higher effectiveness in the combination of imipenem and Ab105-2phiΔCI mutant (P<0.05 by Log Rank-Matel Cox test). This approach could help to reduce the emergence of phage resistant bacteria and restore sensitivity to the antibiotics when used to combat multiresistant strains of Acinetobacter baumannii.

Background: Genome-wide association studies have identified the chromosome 9p21 locus as one of the most important genetic risk factors for cardiovascular disease. However, the mechanism by which this locus promotes disease remains unclear due to difficulty identifying the causal genes and lack of a suitable animal model. Methods and Results: A total of 180 coronary artery autopsy specimens were analyzed histopathologically. The genotype of 9p21 (rs1333049) was not associated with any coronary risk factors nor the vulnerable plaque phenotype, but carriers of 9p21 risk allele did demonstrate more lesional calcification. To extend these studies into an animal model, mice with a targeted deletion of the orthologous 70-kb non-coding interval on chromosome 4 (chr4^D70kb/D70kb) were bred onto ApoE^-/- and fed with high fat diet. Targeted deletion of the 9p21 risk interval increased susceptibility to atherosclerotic plaque progression, but did not affect plaque rupture in the tandem stenosis model. Coronary risk factors such as body weight, blood pressure, lipid, and glucose levels did not differ between genotypes. Von Kossa staining revealed that chr4^D70kb/D70kb, ApoE^-/- developed more calcification in the plaque compared with chr4^+/+, ApoE^-/- mice, and that this this change was accompanied by increased aortic mRNA expression of Runx2, a key osteogenic transcription factor. Primarily cultured smooth muscle cells from chr4^D70kb/D70kb were hyperproliferative, and showed a calcification-prone phenotype after exposure to high-phosphate medium. Treatment with Palbociclib, a selective inhibitor of cyclin-dependent kinase 4/6, reduced mRNA expression of osteogenic genes in smooth muscle cells. Conclusion: Results from human and mouse studies indicate that the 9p21 non coding risk interval is associated with larger atherosclerotic plaque burden, but not with plaque rupture. 9p21 may promote lesion expansion by inducing the proliferation of de-differentiated and osteogenic smooth muscle cells.

The severity of coronavirus disease 2019 (COVID-19), caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), greatly varies from patient to patient. In the present study, we explored and compared mutation profiles of SARS-CoV-2 isolated from mildly affected and severely affected COVID-19 patients in order to explore any relationship between mutation profile and disease severity. Genomic sequences of SARS-CoV-2 were downloaded from GISAID database. With the help of Genome Detective Coronavirus Typing Tool, genomic sequences were aligned with the Wuhan seafood market pneumonia virus reference sequence and all the mutations were identified. Distribution of mutant variants was then compared between mildly and severely affected groups. Among the numerous mutations detected, 14,408C>T and 23,403A>G mutations resulting in RNA-dependent RNA polymerase (RdRp) P323L and spike protein D614G mutations, respectively, were found predominantly in severely affected group (>82%) compared with mildly affected group (<46%, p<0.001). The 241C>T mutation in the non-coding region of the genome was also found predominantly in severely affected group. The 3,037C>T, a silent mutation, also appeared in relatively high frequency in severely affected group. We concluded that RdRp P323L and spike protein D614G mutations predominate in severely affected COVID-19 patients. Further studies will be required to explore whether these mutations have any impact on the severity of COVID-19.

One of the ways to regulate the sensitivity of human cells to the influenza virus is to knock out genes of the innate immune response. Promising targets for the knockout are genes of the interferon-inducible transmembrane protein (IFITM) family, in particular the IFITM3 gene, whose product limits the entry of a virus into the cell by blocking the fusion of the viral and endosomal membranes. In this study, by means of genome-editing system CRISPR/Cas9, monoclonal cell lines with an IFITM3 knockout were obtained based on WI-38 VA13 cells (human origin). It was found that such cell lines are more sensitive to infection by influenza A viruses of various subtypes. Nonetheless, this feature is not accompanied by an increased titer of newly formed viral particles in a culture medium.

The phenolics concentrations of rapeseed are important because they are antinutritional com-pound or directly positive related to antioxidant actives. In this study, single nucleotide poly-morphisms (SNPs) identified from genotyping-by-sequencing (GBS), and genome-wide associa-tion study of phenolic contents were investigated in 95 rapeseed mutant lines derived from gamma rays and their original cultivar. A total of 3,196,318 SNPs were detected, identifying a set of 70,208 union SNPs used to perform association studies. Six phenolics and glucosinolate (pro-goitrin) were identified, sinapine was the major phenolic compound (91.2–99.2%) in all geno-types. The association study was conducted for six phenolic compounds, progoitrin, total sinap-ine content (TSC), total phenolic content (TPC) and seed yield. The association study identified 241 SNPs that were significantly associated with six phenolic compounds, progoitrin, TSC and TPC. Based on the detected SNP markers, BnaA06g31740D, a gene associated progoitrin, BnaC-nng39930D, a gene associated trans-sinapine 1, BnaA07g31720D, a gene associated trans-sinapine 2, BnaC03g31950D and BnaA06g09180D, a gene associated TSC, and BnaAnng27700D, a gene associ-ated TPC, were selected as candidate genes. The SNP makers associated major phenolic com-pounds identified and could be used as targets for breeding programs aimed at improving anti-oxidant contents and reducing antinutritional components.

Activating mutations in the Epidermal Growth Factor Receptor gene occur as early cancer-driving clonal events in a subset of patients with non-small cell lung cancer (NSCLC) and result in increased sensitivity to EGFR-tyrosine-kinase-inhibitors (EGFR-TKIs). Despite very frequent and often prolonged clinical response to EGFR-TKIs, virtually all advanced EGFR-mutated (EGFRM+) NSCLCs inevitably acquire resistance mechanisms and progress at some point during treatment. Additionally, 20-30% of patients do not respond or respond for a very short time (< 3 months) because of intrinsic resistance. While several mechanisms of acquired EGFR-TKI-resistance have been determined analyzing tumor specimens obtained at disease progression, the factors causing intrinsic TKI-resistance are less understood. However, recent comprehensive molecular-pathological profiling of advanced EGFRM+ NSCLC at baseline has illustrated the co-existence of multiple genetic, phenotypic, and functional mechanisms that may contribute to tumor progression and cause intrinsic TKI-resistance. Several of these mechanisms have been further corroborated by preclinical experiments. Intrinsic resistance can be caused by mechanisms inherent EGFR or by EGFR-independent processes, including genetic, phenotypic or functional tumor changes. This comprehensive review describes the identified mechanisms connected with intrinsic EGFR-TKI-resistance and differences and similarities with acquired resistance and among clinically implemented EGFR-TKIs of different generations. Additionally, the review highlights the need for extensive pre-treatment molecular profiling of advanced NSCLC for identifying inherently TKI-resistant cases and designing potential combinatorial targeted strategies to treat them.

The article presents research results of the γ-ray and fast neutrons impact on various rice species, in order to obtain mutant forms resistant to salinity (NaCl) and drought factors (sorbitol. They are going to be used as initial forms in synthetic selection when creating varieties, adapted to the stressful conditions of, both, soil and climate in the Kazakhstan Aral Sea. The average lethal doses (LD50) of γ-rays and fast neutrons, as well as the average NaCl and sorbitol lethal concentrations were established. Such environment is best suited for clear manifestation of the mutagenic effect of ionizing radiation and the resistance of rice plants to salinity and drought. A distinct dependence in the effect of ionizing radiation and stress factors on the number of induced resistant mutant forms has been related to the initial rice sort. The largest number of mutant forms was obtained from the local variety Syr Suluy, followed by Leader and AyKerim varieties. From all varieties, the number of mutants obtained from exposure to γ-rays was 43 pieces out of 4500 grains, and from the impact of fast neutrons - 115 pieces out of 2700 grains. M1 mutant plants significantly differ from the initial forms in terms of morphological features – plant height, panicle length, grain size Most plants are characterized by short growth and even dwarfism (˂80 cm). They are lodging tolerant, have short and highly sterile panicles, indicating that they are mutants and resistant to salinity, drought, or both.

Wounding is a serious environmental stress in plants. Oxylipins such as jasmonic acid play an important role in defense against wounding. Mechanisms to adapt to wounding have been investigated in vascular plants; however, those mechanisms in nonvascular plants remain elusive. To examine the response to wounding in Physcomitrella patens, a model moss, a proteomic analysis of wounded P. patens was conducted. Proteomic analysis showed that wounding increased the abundance of proteins related to protein synthesis, amino acid metabolism, protein folding, photosystem, glycolysis, and energy synthesis. 12-Oxo-phytodienoic acid (OPDA) was induced by wounding and inhibited growth. Therefore, OPDA is considered a signaling molecule in this plant. Proteomic analysis of a P. patens mutant in which the PpAOS1 and PpAOS2 genes, which are involved in OPDA biosynthesis, are disrupted showed accumulation of proteins involved in protein synthesis in response to wounding in a similar way to the wild-type plant. In contrast, the fold-changes of the proteins in the wild-type plant were significantly different from those in the aos mutant. This study suggests that PpAOS gene expression enhances photosynthesis and effective energy utilization in response to wounding in P. patens.

Typhonium flagelliforme is an Indonesian herbal plant used and applied traditionally to treat cancer diseases. Gamma rays have irradiated rodent tuber mutant plant at six doses gray to in-crease the chemical compounds of anticancer activity. The effect of isolated compounds from ro-dent tuber mutant plants has never been studied and published yet. Our study unveiled the poten-tial of stigmasterol as a remarkable cytotoxic agent and the significant contribution of NMR spectroscopy, IR, Mass spectra, QTOF MS towards the isolation and identification of this anti-cancer agent. Stigmasterol was isolated from T. flagelliforme mutant plant. Stigmasterol was more effective against MCF-7 cells with an IC50 value of 0.1623 µM than Cisplatin with IC50 value 13.2 µM. It is the most potential and active fraction in the human breast cancer cell line. The mo-lecular docking study analyzed the chemical profile of stigmasterol to confirm the receptor in agonist binding sites. The prediction of the toxicity of stigmasterol compounds using in silico and analysis of its interaction with the receptor can act as a competitive regulator with a high-affinity binding site on FXR. Stigmasterol has potential as a candidate for an anticancer drug that pro-moting further clinical action.

Toxic advanced glycation end-products (TAGE), formed by glyceraldehyde (GA) as an intermediate in the non-enzymatic reaction with intracellular proteins, are highly cytotoxic and have been implicated in the pathogenesis of various diseases. However, the mechanisms underlying the degradation and removal of TAGE remain largely unknown. In the present study, we identified the checkpoint kinase-1 (CHK1) mutant, d270KD, which was rapidly degraded intracellularly by GA, and showed that its degradation was mainly mediated by the ubiquitin-proteasome pathway. The high-molecular-weight complexes formed by the GA stimulation of d270KD were abundant in the RIPA-insoluble fraction, which also contained high levels of TAGE. The knockdown of p62/SQSTM1 reduced the amount of high-molecular-weight complexes in the RIPA-insoluble fraction, indicating its involvement in the formation of TAGE aggregates. The present results suggest that the ubiquitin-proteasome pathway and p62 play a role in the degradation and aggregation of intracellular TAGE formed by GA. This study provides new insights into the mechanisms underlying TAGE metabolism and may lead to the development of novel therapeutic strategies for diseases associated with TAGE accumulation.

Base excision repair (BER) is the predominant pathway to remove most forms of hydrolytic, oxidative and alkylative DNA damage. The precise functioning of BER is achieving by the regulation of each step by regulatory/accessory proteins, with the most important of which being poly(ADP-ribose) polymerase 1 (PARP1). The PARP1 regulatory functions extend to many cellular processes including regulation of mRNA stability and decay. PARP1 can therefore affect BER both at the level of the BER proteins and at the level of their mRNAs. Systematic data on how the PARP1 content affects the activities of key BER proteins and the levels of their mRNAs in human cells are extremely limited. In this study the CRISPR/Cas9 based technique has been used to knocked out the PARP1 gene in the human HEK 293FT line. The obtained cell clones with putative PARP1 deletion were characterized by several approaches including: PCR analysis of deletions in genomic DNA, Sanger sequencing of genomic DNA, qPCR analysis of PARP1 mRNA, western-blot analysis of whole-cell-extract proteins with anti-PARP1 antibodies, and the PAR synthesis in the whole-cell-extracts. qPCR analysis of mRNAs coding the BER related proteins: PARP2, uracil DNA glycosylase 2, AP endonuclease 1, DNA polymerase β, DNA ligase III and XRCC1 did not reveal crucial influence of PARP1 knockout. The corresponding catalytic activities in the whole-cell extracts (WCEs) evaluated in parallel did not differ significantly between mutant and parental cell lines. No considerable influence of poly(ADP-ribose) synthesis on the activity of the above WCE enzymes was revealed.

The molecular entity that catalyzes ferredoxin (Fd)-dependent cyclic electron flow around photosystem I (PSI) (Fd-CEF) remains unknown. To elucidate the in vivo molecular mechanism of Fd-CEF, the evaluation of Fd reduction‒oxidation kinetics is a good indicator of Fd-CEF activity. Recent research showed that the expression of Fd-CEF activity requires the oxidation of plastoquinone, and furthermore, chloroplast NAD(P)H dehydrogenase does not catalyze Fd-CEF in Arabidopsis thaliana. In the present research, the effect of reduced Fd on Fd-CEF activity was analyzed by comparing wild-type and pgr5-deficient mutants (pgr5hope1). PGR5 has been proposed to be the mediator of Fd-CEF, and pgr5hope1 showed the same CO2 assimilation rate and the same reduction‒oxidation level of PQ as WT, but P700 oxidation with Fd was highly reduced, unlike WT. As expected, the activity of Fd-CEF was enhanced in pgr5hope1 compared to the wild type, and its activity was also enhanced with the oxidation of PQ by the increase in the CO2 assimilation rate. The present in vivo research clearly shows that the expression of Fd-CEF activity requires reduced Fd in addition to oxidized PQ, and PGR5 does not catalyze Fd-CEF.

Purpose Isocitrate dehydrogenase (IDH) mutation has become one of the most important prognostic biomarkers in glioma management, indicating better treatment response and prognosis. IDH mutations confer neomorphic activity leading to the conversion of alpha-ketoglutarate (α-KG) to 2-hydroxyglutarate (2HG). The purpose of this study was to investigate the clinical potential of proton MR spectroscopy (1H-MRS) in identifying IDH-mutant gliomas by detecting characteristic resonances of 2HG and its complex interplay with other clinically relevant metabolites. Materials and Methods Thirty-two patients with suspected infiltrative glioma underwent single-voxel (SVS, n=17) and/or single-slice multivoxel (1H-MRSI, n=15) proton MR spectroscopy (1H-MRS) sequence with an optimized echo-time (97ms) on 3T-MRI. Spectroscopy data were analyzed using linear combination (LC) model. Cramer-Rao lower bound (CRLB) values of <40% were considered acceptable for detecting 2HG and <20% for other metabolites. Immunohistochemical analyses for determining IDH mutational status were subsequently performed from resected tumor specimens, and findings were compared with the results from spectral data. Mann-Whitney and Chi-squared tests were performed to ascertain differences in metabolite levels between IDH-mutant and IDH-wild-type gliomas. Receiver operating characteristics (ROC) curve analyses were also performed. Results Data from eight cases were excluded due to poor spectral quality or non-tumor-related etiology, and final data analyses were performed from 24 cases. Of these cases, 9/12 (75%) were correctly identified as IDH-mutant or IDH-wildtype gliomas by SVS and 10/12 (83%) by 1H-MRSI with an overall concordance rate of 79% (19/24). The sensitivity, specificity, positive predictive value, and negative predictive values were 80%, 77%, 86%, and 70%, respectively. The metabolite 2HG was found to be significant in predicting IDH-mutant gliomas by Chi-squared test (p<0.01). The IDH-mutant gliomas also showed significantly higher NAA/Cr ratio (1.20 ± 0.09 versus 0.75 ± 0.12 p= 0.016) and lower Glx/Cr ratio (0.86±0.078 versus 1.88±0.66; p=0.029) than those with IDH wild-type gliomas. The areas under the ROC curves for NAA/Cr and Glx/Cr were 0.808 and 0.786, respectively. Conclusion 1H-MRS may be useful in detecting IDH mutational status in gliomas by detecting 2HG and characteristic patterns of other metabolite ratios (NAA/Cr and Glx/Cr). This has significant clinical implications for prognostication and response assessment to novel targeted therapies in gliomas.

The majority of EGFR mutations (85–90%) are exon 19 deletions and L858R point mutation of exon 21, characterized by high sensitivity to EGFR-tyrosine kinase inhibitors (TKIs). Less is known about uncommon mutations (10-15% of EGFR mutations). Predominant mutation types in this category include exon 18 point mutations, exon 21 L861X, exon 20 insertions and exon 20 S768I. This group presents a heterogeneous prevalence, partly due to the different testing methods and to the presence of compound mutation, which in some cases leads to shorter overall survival and different sensitivity to different TKIs than simple mutations. EGFR-TKI sensitivity may also vary depending on the specific mutation and the tertiary structure of the protein. The best strategy remains uncertain and the data of TKIs efficacy are founded of few prospective and some retrospective series. Newer investigational agents are still under study and there are no other approved specific treatment targeting uncommon EGFR mutations. Defining the best treatment option for this patient population remain un unmet medical need. The objective of this review is to evaluate existing data on outcomes, epidemiology and clinical characteristics of lung cancer patients with rare EGFR mutations, with a focus on intracranial activity and response to immunotherapy.

LONP1 is the principal AAA+ unfoldase and bulk protease in the mitochondrial matrix, so its deletion causes embryonic lethality. The AAA+ unfoldase CLPX and the peptidase CLPP also act in the matrix, conspicuously during stress periods, but their substrates are poorly defined. Mammalian CLPP deletion triggers infertility, deafness, growth retardation, and cGAS-STING activated cytosolic innate immunity. CLPX mutations impair heme biosynthesis and heavy metal homeostasis. CLPP and CLPX are conserved from bacteria to human, despite their secondary role for proteolysis. Based on recent proteomic-metabolomic evidence from knockout mice and patient cells, we propose that CLPP acts on phase-separated ribonucleoprotein granules, and CLPX on multi-enzyme condensates, near the inner mitochondrial membrane, as first-aid system. Trimming within assemblies, CLPP rescues stalled processes in mitoribosomes, in mitochondrial RNA granules and nucleoids, and in D-foci-mediated degradation of toxic double-stranded mtRNA / mtDNA. Unfolding multi-enzyme condensates, CLPX maximizes PLP-dependent delta-transamination, and rescues malformed nascent peptides. Overall, their actions occur in granules with multivalent or hydrophobic interactions, separated from the aqueous phase. Thus, the role of CLPXP in the matrix is compartment-selective, like peptidases MPP at precursor import pores, m-AAA and i-AAA at either IMM face, PARL within the IMM, and OMA1/HTRA2 in the intermembrane space.

Resistance to Pyrimethamine, an antimalarial medicine has been reported to be due to mutations in Dihydrofolate reductase-thymidylate synthase (DHFR-TS). Phytochemicals, particularly from plants that been used in ethnomedicine, have been reported to have privileged structures that might bind strongly to the mutants of DHFR-TS. The aim of this study is to identify phytochemicals of Acalypha wilkesiana, Cymbopogon citratus, Azadirachta indica, and Morinda lucida with high binding affinities for the Plasmodium falciparum DHFR-TS. The three-dimensional structures of the phytochemicals, wide type and mutant forms of DHTR-TS were obtained from PubChem and Protein Databank (PDB) respectively. They were appropriately prepared and molecular docking simulations was implemented to predict binding affinities of the phytochemicals to the wildtype and mutant forms of DHTR-TS. Druglikeness assessment was implemented to triage the top binding phytochemicals and molecular dynamics simulations was done to establish the stability of the interaction of the top-ranked phytochemical with one of the mutants of DHFR-TS. Nineteen phytochemicals showed higher binding affinities to both the wild type and mutant forms DHFR-TS than Pyrimethamine. Molecular dynamics revealed that the receptor-ligand binding of luteolin, the top-ranked, drug like phytochemicals, to the quadruple mutant was stable.

2-(4-Benzyloxy-3-methoxyphenyl)-5-(carbethoxyethylene)-7-methoxy-benzofuran (BMBF), a benzofuran derivative, is an intermediate found in the process of total synthesis of ailanthoidol. Benzofuran derivatives are a class of compounds that possess various biological and pharmacological activities. The present study explored the anti-metastasis effects in hepatocellular carcinoma (HCC). Our preliminary findings indicate that BMBF suppresses the proliferation and changes the morphology of Huh7, an HCC cell line with a mutated p53 gene (Y220C). According to scratching motility assay, noncytotoxic concentrations of BMBF significantly inhibited the motility and migration in Huh7 cells. BMBF upregulated the expression of E-cadherin and downregulated the expression of vimentin, Slug, and MMP9, which are associated with epithelial-mesenchymal-transition (EMT) and metastasis in Huh7 cells. BMBF decreased the expression of integrin α7 and deactivated its downstream signal FAK/AKT and inhibited p53 protein levels. Cell transfection with p53 siRNA resulted in prevention of cell invasion because of the reduced expression of integrin α7, Slug, and MMP-9 in Huh7 cells. BMBF had anti-metastatic effects in PLC/PRF/5, an HCC cell line with R249S, a mutated p53 gene. Our findings indicate that BMBF has anti-metastatic effects in that it downregulates p53 and mediates the suppression of integrin α7, EMT, and MMP-9 in HCC cells with mutated p53 gene.

Omega-3 polyunsaturated fatty acids (ω3-PUFAs), including docosahexaenoic acid (DHA), have been shown to exert anticancer effects by inducing apoptotic cell death. However, the mechanism for DHA-induced cell death in lung cancer is not fully understood. Here, we show that DHA induces apoptosis in two human EGFR mutant non-small cell lung cancer (NSCLC) cell lines, and that DHA-induced cell death is accompanied by SIRT6 activation and attenuated Hedgehog (Hh) signaling. Knockdown of SIRT6 using siRNAs inhibited DHA-induced apoptosis, whereas SIRT6 overexpression increased apoptotic cell death. DHA-induced SIRT6 activation was associated with downregulation of Hh signaling, and knockdown of SIRT6 resulted in augmentation of Hh signaling. Pretreatment of NSCLC cells with a Smoothened agonist prevented DHA-induced decreases in the levels of Hh signaling proteins and increases in cleaved PARP levels. Moreover, endogenous production of ω3-PUFAs in PC9 cells via fat-1 expression resulted in elevated SIRT6 levels and reduced levels of Hh signaling molecules, including Gli, following DHA treatment. Overall, these results implicate that ω3-PUFAs induce apoptosis by downregulating Hh signaling via SIRT6 activation in human EGFR mutant NSCLC cells. These findings suggest that ω3-PUFAs potentially represent an effective therapy for the chemoprevention and treatment of NSCLC.

Monitored differential infection rates of past Corona waves are used to infer, a posteriori, the real time variation of the ratio of recovery to infection rate as key parameter of the SIR-epidemic model. From monitored Corona waves in five different countries it is found that this ratio exhibits a linear increase at early times below the first maximum of the differential infection rate before the ratios approach a nearly constant value close to unity at the time of the first maximum with small amplitude oscillations at later times. The observed time dependencies at early times and at times near the first maximum agree favorably well with the behavior of the calculated ratio for the Gaussian temporal evolution of the rate of new infections, although the predicted linear increase of the Gauss ratio at late times is not observed.

Epichloë species form bioprotective endophytic symbioses with many cool-season grasses, including agriculturally important forage grasses. Despite its importance, relatively little is known about the molecular details of the interaction and the regulatory genes involved. VelA is a key global regulator in fungal secondary metabolism and development. In previous studies, we showed the requirement of velA for E. festucae to form a mutualistic interaction with Lolium perenne. We showed that VelA regulates the expression of genes encoding proteins involved in membrane transport, fungal cell wall biosynthesis, host cell wall degradation and secondary metabolism, along with several small-secreted proteins in Epichloë festucae. Here, by a comparative transcriptomics analysis on perennial ryegrass seedlings and mature plants, which are endophyte free or infected with wild type (mutualistic interaction) or mutant ∆velA E. festucae (antagonistic or incompatible interaction), regulatory effects of the endophytic interaction on perennial ryegrass development was studied. We show that ∆velA mutant associations influence the expression of genes involved in primary metabolism, secondary metabolism and response to biotic and abiotic stresses compared to wild type associations, providing an insight into processes defining mutualistic versus antagonistic interactions.

The paper focuses on the application of a multilevel, integrative and territorial approach to the protection of cultural heritage through planning instruments in Serbia. It points out the problems of the sectoral approach and discusses international recommendations that can be integrated into the planning methodology. The case study is the area of Djerdap National Park, which has an already established international and national importance. The research suggests that the cultural heritage in the area, with the exception of the Roman limes, is still recognized at the level of individual localities. The study emphasizes the importance of aligning all levels of governance to safeguard the whole spatial entity rather than focusing solely on its particular areas. The interna-tional and national importance of the planning area contributes to the strengthening of awareness of heritage and its institutional protection. However, the vitality of the area, which is key to its sustainable development, comes from the local level. Planning documents contribute to the inte-gration of local values and local communities into development programs and projects.

Glycosidic linkage analysis was conducted on the unfractionated polysaccharides in the alcohol-insoluble residues (AIRs) prepared from six red seaweeds (Gracilariopsis sp., Prionitis sp., Mastocarpus papillatus, Callophyllis sp., Mazzaella splendens, and Palmaria palmata) using GC-MS/FID analysis of partially methylated alditol acetates (PMAAs). The cell walls of P. palmata primarily contained mixed-linkage xylans and small amounts of sulfated galactans and cellulose. In contrast, the unfractionated polysaccharides of the other five species were rich in galactans displaying diverse 3,6-anhydro-galactose and galactose linkages with varied sulfation patterns. Different levels of cellulose were also observed. This glycosidic linkage method offers advantages for cellulose analysis over traditional monosaccharide analysis that is known for underrepresenting glucose in crystalline cellulose. Relative linkage compositions calculated from GC-MS and GC-FID measurements showed that anhydro sugar linkages generated more response in the latter detection method. This improved linkage workflow presents a useful tool for studying polysaccharide structural variations across red seaweed species. Furthermore, for the first time, relative linkage compositions from GC-MS and GC-FID measurements, along with normalized FID and total ion current (TIC) chromatograms without peak assignments, were analyzed using principal component analysis (PCA) as a proof-of-concept demonstration of the technique's potential to differentiate various red seaweed species.

Background: Educating college students about the importance of good sleep habits could lead to the adoption of healthier sleep routines, including sufficient sleep duration and sleep quality. The current pre-post study examines the impact of completing a sleep education program called “Sleep 101” on (1) sleep hygiene practices, (2) sleep quality, and (3) weekday and weekend sleep behaviors among college students. “Sleep 101” is an interactive online course developed to educate college students about the importance of sleep by addressing basic sleep physiology, the impact of sleep on mood, academic and physical performance, the interactions between sleep and various substances, and common sleep disorders. Methods: 338 college students were recruited from a midsized public university in the US and invited to participate in “Sleep 101”, of which 25 participants completed the baseline and post-intervention questionnaire. The Sleep Hygiene Index (SHI) was utilized to evaluate sleep hygiene practices, while standard questions were employed to assess weekday and weekend sleep behaviors and overall sleep quality. Results: Those who completed the study demonstrated a significant increase in weekday sleep duration and were less likely to engage in negative prior bedtime activities. In addition, 40% of those who completed baseline and post-intervention assessments noticed improvements in their sleep quality. Conclusion: These findings suggest that a brief online program is beneficial in improving sleep behaviors among college and could be a scalable approach to addressing current sleep issues and preventing future sleep problems in college students.

The profile of secondary metabolites occurring in apple cuticular layer is not only characteristic for particular apple cultivar, but also dynamically reflects various external factors in growing environment. In this study, the possibility to authenticate apple samples based on analysis of their cuticular layer extracts was investigated. Ultra-high-performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC-HRMS/MS) was employed for obtaining metabolomic fingerprints. In total, 274 authentic apple samples, four cultivars harvested within the seasons 2020 to 2022 in the Czech Republic and Poland were analysed. The generated complex data processed by univariate and multivariate statistical methods enabled to build classification models for discrimination of apple cultivars as well as their geographical origin. The models showed very good performance in differentiation of Czech and Polish samples for three of four cultivars: ‘Gala’, ‘Golden Delicious’ and ‘Idared’, moreover, the validity of the models was verified over harvest seasons. The diagnostic markers, besides metabolites of triterpene biosynthetic pathway, mainly represented wax esters. ‘Jonagold’, which is known to be susceptible to mutations, was the only cultivar for which the unambiguous classification of geographical origin was not possible.

Strawberry root rot caused by Neopestalotiopsis clavispora is one of the main diseases of strawberry and significantly impacts the yield and quality of strawberry fruit. There are now no effective control techniques available except for fungicide sprays, which may directly impact consumers. Biological control is becoming an alternative method for the control of plant diseases to replace or decrease the application of traditional synthetic chemical fungicides. Trichoderma is widely used as a biological agent for controlling strawberry root rot. In order to provide resources for screening the highly effective biocontrol fungus for controlling strawberry root rot caused by Neopestalotiopsis clavispora, the biocontrol mechanism,the control effects of Trichoderma asperellum CMT10 against strawberry root rot and growth-promoting effects on strawberry seedlings were investigated by plate culture, microscopy observation and root drenching methods.The results showed that CMT10 had obvious competitive, antibiotic and hyperparasitism effects on Neopestalotiopsis clavispora CMGF3. The CMT10 could quickly occupy nutritional space, and the inhibition rates of CMT10 against CMGF3 in confrontation culture on 7 d was 65.49%. The inhibition rates of volatile metabolite and fermentation metabolite produced by CMT10 against CMGF3 were 79.67% and 69.84%, respectively. The mycelium of strain CMT10 can act as hyperparasites by making contacting, winding and penetrating hyphae of CMGF3. Pot experiment showed that the biocontrol efficacy of CMT10 on strawberry root rot caused by Neopestalotiopsis clavispora was 63.00%. CMT10 had obvious promotion effect on strawberry growth, the plant height, root length, total fresh weight, root fresh weight, stem fresh weight and root dry weight, with the promotion rates were 20.09%, 22.39%, 87.11%, 101.58%, 79.82% and 72.33%, respectively. Overall, this study showed the ability of Trichoderma asperellum CMT10 to control strawberry root rot and their potential to develop as novel biocontrol agents to replace chemical fungicides for eco-friendly, sustainable agriculture.

Apis mellifera, especially weak ones, are highly vulnerable to Carpoglyphus lactis mites, which can rapidly infest and consume stored pollen, leading to weakened colonies and potentially colony collapse. This study aimed to ascertain and investigate the prevalence of this mite in honeybee colonies across 9 provinces in the Republic of Korea (ROK). A total of 615 honeybee colonies were collected, from 66 apiaries during the spring and 58 apiaries during the summer of 2023. A 1,242 bp segment of the the Cytochrome c oxidase subunit 1 (COI) gene was amplified using the polymerase chain reaction method. The detection levels of C. lactis in the honeybees were compared between winter and summer. Based on the COI sequence analysis, the nucleotide sequence similarity of C. lactis mites isolated in the ROK with those from China (NC048990.1) was found to be 99.5%, and with those from the United Kingdom (KY922482.1) was 99.3%. This study is the first report of C. lactis in Korean apiaries. The findings in this study demonstrate a significantly higher detection rate in winter, which is 4.1 times greater than that in summer (p &lt; 0.001). Furthermore, the results underscore the usefulness of molecular diagnostic techniques for detecting C. lactis mites.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

The properties of the annual, semiannual and triennial oscillations (AO, SAO and TO) in the middle atmosphere have been investigated using the TIMED/SABER temperature data. The Lomb-Scargle and wavelet spectra were used to determine the dominant oscillations in the background temperature field. The AO is prominent at the mid-latitudes. The AO amplitudes present an asymmetry between the two Hemispheres, being larger in the mesosphere than in the stratosphere. The SAO dominates the tropical regions, with three amplitude maxima at altitudes of 45, 75, and 85 km. The SAOs in the upper mesosphere (75 km) are out of phase with those in the mesopause (85 km) in the tropical regions, which can generate an enhancement of 11 K at each equinox, contributing to the lower mesospheric inversion layer. The TO is significant in the tropical region, with amplitude being maximum at 35, 45 and 85 km. Result shows that there may be potential interaction by the TO with SAO at 85km at the equator. The relation between ENSO and TO has also been discussed. The ENSO signal may modulate the amplitude of the TO, mainly in the lower stratosphere. The real origin of the TO may lie in the wave-mean-flow interaction.

This paper is focused on typical rural settlements in the Stara Planina Mountain area in Serbia. They are distinguished by their authenticity, identity and character, and they have still not been destroyed by inappropriate development as is the case in some other mountain areas in Serbia, where the effects of urbanization, globalization and homogenization are obvious. Consequently, there is a need to prevent these effects in mountain areas where there is a threat of disbalance between development and the inherited natural and cultural values. The paper starts from several important concepts that relate contemporary approaches to cultural heritage preservation, place morphology and planning future development. The concept definitions from recent documents from related fields are used. These concepts are then applied to the area of Stara Planina Mountain and its rural settlements. The necessity for an integrative approach to planning this area with significant natural and anthropogenic potential is pointed out, including its integration into international programs of sustainable development.

The research reported on this paper was aimed at improving the overall efficiency of a PDO certified artisanal cheese production process. Being a PDO certified foodstuff by the EU, it is considered to have properties and qualities determined by the geographical environment in which is made, with its production taking place in a specific and determined geographical location, in this case the Serra da Estrela region. In that sense, the authors conducted a mapping according to a systemic perspective of the processes involved in the context of manufacturing and distribution of certified Serra da Estrela cheese. Numerous methods were used throughout the process, such as a systemic design analysis, and techniques derived from ethnographic methods, which led to the collection of data in the field and consequently provided the immersion of the researcher in genuine work situations. Critical points were identified and emphasized in the systemic map with the purpose of encouraging initiatives to address and overcome the gaps and inefficiencies detected. The systemic design analysis triggered the development of design work. Observations following an ethnographic approach identified ergonomic risks in cheese making during the process of cutting excess chips, fostering the emergence of musculoskeletal disorders at the wrist. A tool that fits best to the task at hand was developed. A prototype of the new tool enabled collecting feedback from use in the work context, in order to inform product development. The domains of agricultural production and microbiology, considering the specific microorganisms developed trough the ripening process of the cheese, turned out to be aspects of high importance for the issue under focus, contributing to a broader understanding of the ripening process and its risks, simultaneously improving the efficiency and success of cheese production. If it were not for the systemic analysis, which served as a link between the boundaries of distinct domains such as the risk of microorganism contamination, ergonomics, energy efficiency, legislation and regulation policies, transportation challenges and economic viability, approached throughout the research. Simultaneously creating bridges between them, the various problems might not have been detected in the first place, as they are usually addressed in specialized disciplines, predetermined by the restrictions of each specific area of knowledge. As a consequence of the development of this research, which was based on an analysis that sought to establish possible connections between various disciplines and tried to constantly maintain a holistic perspective, making new connections and observing the issues from a new angle, apart from the already established methodologies. All this allowed to lay out the seeds for the development of a plan to tackle the critical points identified by the systemic analysis reported in this paper.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

The wetlands in northeastern Bangladesh are home to some of the most prolific and valuable ecosystems on the planet, offering a wide range of benefits to both the local and wider communities. A limited number of research on this topic have been carried out in various wetlands in coastal hilsa, but none have been located in the northeastern region of Bangladesh. Thus, the goal of this study was to better understand the most commercially relevant species (anadromous hilsa) in northeastern Bangladesh as well as to assess the wetland ecosystem services more thoroughly with the contribution of their fish genetic resources. In addition to laboratory studies, fieldwork was done in the fishing settlements along the Surma River, Hakaluki Haor, and Tanguar Haor. The study classified 77 fish species into 21 subcategories of ecosystem services, of which 56% were not threatened, 17% were vulnerable, and 10% were highly endangered. The species Hilsa was found to be the most economically significant, accounting for 1% of the GDP overall. The study determined if the hilsa stock of the examined wetlands maintains a single or several subpopulations in comparison to other parts of the country when they migrate from saline water to northeastern Bangladesh (freshwater). But when compared to other groups, the FST score was between 0.000 to 0.017, indicating that the populations are identical and that there is genetic material sharing between them. Additionally, these statistics imply that the Sylhet haor and adjacent river systems contain a single stock of Hilsa fish. Nevertheless, a number of stresses and risks, including overexploitation, illicit and destructive fishing, siltation, and natural disasters like flash floods, have been linked to changes in the supply of hilsa and other ecosystem services. This study also emphasizes the necessity of policy attention and research to address the concerns.

In this paper, we introduce a specialized, fully automated experimental arrangement designed for assessing the effectiveness of augmented and virtual reality technologies in healthcare setting and explore its design principles focusing on depth sensor characterization. The main goal of this project is to establish a robust benchtop platform for the quantitative evaluation of extended reality technologies in a controlled environment, emphasizing the practical assessment of augmented reality head-mounted devices. We outline a design concept and considerations for an experimental configuration aimed at creating a realistic testing environment. This apparatus comprises an observation platform mounted on a three-degree-of-freedom motorized system and a test phantom stage. Focusing on real-case scenarios, we utilized a range of sensors, including readily available range-sensing cameras and commercial augmented reality headsets, such as the Intel RealSense L515 LiDAR camera, mounted on the motion control system. The setup enabled automated data collection and facilitates controlled assessments and validation of various facets of augmented reality technologies, including object, hand, and head tracking, as well as static and dynamic image registration. This paper describes the system architecture, the process of automated data collection, and presents several evaluation studies conducted with this setup, providing insights into the quality and temporal noise associated with static or moving objects or observers in augmented reality applications.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

To secure logic circuits against the illegal copying the insertion of the so-called key bit inputs using XOR/XNOR gates has been proposed in . The inserted gates modify (lock) the behavior of the original circuit and only the correct choice of the secret key bits guarantees the equivalent behaviour of the locked circuit to the original circuit. To break this kind of security, i.e. to find the secret key bits, there was a SAT solver based attack proposed in . The aim of this work is to experimentally verify this attack on several locked circuits with various number of primary inputs and outputs and with various number of gates. Except for the random placement of the key gates we evaluate also the positioning with chaining elimination. The obtained and presented results show that we were able to unlock 10 of 11 circuits within few minutes on a common PC.

Intermetallic compounds are increasingly being expected to utilize in tribological environments, but to date the works are hindered by insufficient ductility at low and medium temperature. This paper presents a novel multiphase intermetallic alloy with the chemical composition of Mo-40Ni-13Si (at.%). Microstructure characterization reveals that a certain amount of ductile Mo phases formed during the solidification process of ternary Mo-Ni-Si alloy melt, which is undoubtedly beneficial to the ductility improvement of intermetallic alloy. Tribological properties of the designed alloy, including wear resistance, friction coefficient and metallic tribological compatibility, were evaluated under dry sliding wear test conditions at room temperature. Results suggested that the multiphase alloy possesses an excellent property for room-temperature wear applications, which is attributed to the unique microstructural features and thereby good combination in hardness and ductility. The corresponding wear mechanism is also reported by observing the worn surface, subsurface and wear debris of alloy, which to be found is soft abrasive wear.

With the integrated development of the Internet, wireless sensor technology, cloud computing, and mobile Internet, there has been a lot of attention given to research about and applications of the Internet of Things. A Wireless Sensor Network (WSN) is one of the important information technologies in the Internet of Things; it integrates multi-technology to detect and gather information in a network environment by mutual cooperation, using a variety of methods to process and analyze data, implement awareness, and perform tests. This paper mainly researches the localization algorithm of sensor nodes in a wireless sensor network. Firstly, a multi-granularity region partition is proposed to divide the location region. In the range-based method, the RSSI (Received Signal Strength indicator, RSSI) is used to estimate distance. The optimal RSSI value is computed by the Gaussian fitting method. Furthermore, a Voronoi diagram is characterized by the use of dividing region. Rach anchor node is regarded as the center of each region; the whole position region is divided into several regions and the sub-region of neighboring nodes is combined into triangles while the unknown node is locked in the ultimate area. Secondly, the multi-granularity regional division and Lagrange multiplier method are used to calculate the final coordinates. Because nodes are influenced by many factors in the practical application, two kinds of positioning methods are designed: the unknown node is in the positioning unit or not. When the unknown node is on the side of the positioning unit, we use the method of vector similarity. Moreover, we use the centroid algorithm to calculate the ultimate coordinates of unknown node. When the unknown node is not on the side of the positioning unit, we establish a Lagrange equation containing the constraint condition to calculate the first coordinates. Furthermore, we use the Taylor expansion formula to correct the coordinates of the unknown node. In addition, this localization method has been validated by establishing the real environment.

The electroencephalogram (EEG) is a record of brain activity. Brain Computer Interface (BCI) technology formed by the EEG signal has become one of the hotspots at present. How to extract the feature signal of EEG is the most basic research of BCI technology. In this paper, A new method of recognizing fatigue, conscious, concentrated state of human brain is proposed by the combination of discrete wavelet transform and the neural network based on EEG signal. First of all, the law signal is preprocessed by the wavelet denoising method because the law EEG signal contains a large number of high frequency noise, which is decomposed into multi-layer high frequency signal and low frequency signal. thus, δ wave, θ wave, α wave, β wave are obtained by the wavelet transform. And then, frequency band energy of the different wave is regards as the feature signal of EEG. In the experiment, the feature signal is classified by radial basic function (RBF) and annealed chaotic competitive learning network (ACCLN). RBF and ACCLN networks are trained with 500 sets of sample data and are tested by 100 sets of samples in different mental states. The experimental results show that the average accuracy of RBF network under three conditions are 88.75%, 88.25%, 88.5%, respectively, and the correct rate of ACCLN network is 97%, 98%, 98%, respectively.

Early discharge after childbirth has led to a rise in neonatal readmission, becoming a major concern in recent decades. Our research aimed to identify the risk factors and incidence of neonatal readmission, as well as explore preventive measures. Our study at the Clinical Hospital of Pediatrics in Ploiești, Romania included 108 neonates admitted during the neonatal period. This accounted for 2.06% of all admissions (5226). The most prevalent cases were malnutrition (25%), fever (20.3%) and bronchiolitis (17.5%). Diarrhea and infectious gastroenteritis were also observed (14.8%), along with acute rhinoconjunctivitis (9.2%) and late onset sepsis (3.7%). No deaths were recorded. The most significant characteristics identified were number of children (p&lt;0.001) and age at maternity discharge (p&lt;0.001). By following the prevention rules, malnutrition, feeding errors, and infections can be avoided. This includes practicing proper hand hygiene for both mothers and medical staff, as well as educating and demonstrating to mothers the benefits of breastfeeding. In addition, all newborns discharged from the maternity ward should benefit from follow-up at 7-10 days of life. Our results confirm the effectiveness of a multidisciplinary team and endorse promoting breastfeeding. Implementing quality control measures and regularly evaluating the surveillance program will help improve its effectiveness.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Two interesting compounds such as quaternary ammonium lignin(QAL) and 2-ethylhexyl phosphoric acid mono-2-ethylhexyl ester (P507) were synthesized as ionic liquids(QP-ILs) for the extraction of metal ions. The extraction behavior of Co(II) and Ni(II) from chloride solution was compared between QP-ILs and P507. The results showed that the extraction rates of Co(II) and Ni(II) in the two solutions varied with the extraction conditions, but QP-ILs has stronger extractability for cobalt than P507, while Ni is on the contrary. Under the same conditions, the Co/Ni separation performance(βCo/Ni) in QP-ILs is superior to that in p507. At pH4.0, 55℃, concentration of 20%, extraction time of 10 minutes, the βCo/Ni of QP-ILs reached to 2703, while that of P507 was only 164. In conclusion, QP-ILs was more efficient than P507 for separating Co from mixed solutions.

Brain aging causes a wide variety of changes at molecular and cellular levels, leading to the decline of cognitive functions and increased vulnerability to neurodegenerative disorders. The research aimed at understanding the aging of the brain has made much progress in recent decades. Technological innovations such as single-cell RNA-sequencing (scRNA-seq), proteomic analyses, and spatial transcriptomic analyses have facilitated the research on the dynamic changes occurring within neurons, glia, and other cells along with their impacts on intercellular communication during aging. In this review, we introduce recent trends of how neurons and glia change during aging and discuss the impact of the brain microenvironment such as the blood-brain barrier (BBB).

In this paper, we study the semilinear pseudo-parabolic equations $\displaystyle u_{t} - \triangle_{\mathbb{B}}u - \triangle_{\mathbb{B}}u_{t} = \left|u\right|^{p-1}u$ on a manifold with conical singularity, where $\triangle _{\mathbb{B}}$ is Fuchsian type Laplace operator investigated with totally characteristic degeneracy on the boundary $x_{1} = 0$. Firstly, we discuss the invariant sets and the vacuum isolating behavior of solutions with the help of a family of potential wells. Then, we derive a threshold result of existence and nonexistence of global weak solution: for the low initial energy $J(u_{0})<d$, the solution is global in time with $I(u_{0}) >0$ or $\displaystyle\Vert \nabla_{\mathbb{B}}u_{0}\Vert_{L_{2}^{\frac{n}{2}}(\mathbb{B})} = 0$ and blows up in finite time with $I(u_{0}) < 0$; for the critical initial energy $J(u_{0}) = d$, the solution is global in time with $I(u_{0}) \geq0$ and blows up in finite time with $I(u_{0}) < 0$. The decay estimate of the energy functional for the global solution and the estimates of the lifespan of local solution are also given.

Multimodal remote sensing data classification can enhance the model’s ability to distinguish land features through multimodal data fusion. In this context, how to help models understand the relationship between multimodal data and target tasks is the focus of researchers. Inspired by human feedback learning mechanisms, causal reasoning mechanisms, and knowledge induction mechanisms, this paper integrates causal learning, reinforcement learning, and meta learning into a unified remote sensing data classification framework and proposed the causal meta-reinforcement learning (CMRL). First, based on feedback learning mechanisms, we have overcome the limitations of traditional implicit optimization of fusion features and customized a reinforcement learning environment for multimodal remote sensing data classification tasks. Through feedback interactive learning between agents and the environment, we help them understand the complex relationships between multimodal data and labels, thereby achieving full mining of multimodal complementary information. Second, based on the causal inference mechanism we designed causal distribution prediction action, classification reward, and causal intervention reward, capturing pure causal factors in multimodal data and cutting off false statistical associations between non-causal factors and class labels. Finally, based on the knowledge induction mechanism, we designed a bi-layer optimization mechanism based on meta-learning. By constructing a meta training task and meta validation task simulation model in the generalization scenario of unseen data, we helped the model induce cross-task shared knowledge, thereby improving its generalization ability for unseen multimodal data. The experimental results on multiple sets of multimodal datasets show that the proposed method achieved state-of-the-art performance in multimodal remote sensing data classification tasks.

Moso bamboo is famous for fast growing and biomass accumulation, as well as high annual output for timber and bamboo shoots. These high outputs require high nutrient inputs to maintain and improve stand productivity. Soil nitrogen (N), phosphorus (P) and potassium (K) are important micronutrients for plant growth and productivity. Due to high variability of soils, analysing spatial patterns of soil N, P and K stocks is necessary for scientific nutrient management in Moso bamboo forests. In this study, soils were sampled from 138 locations across Yong’an City and ordinary kriging was applied for spatial interpolation of soil N, P and K stocks. Soil N stock showed a strong spatial dependence while soil N and P stocks presented a moderate spatial dependence, indicating soil N was mainly controlled by intrinsic factors while soil N and P stocks were controlled by both intrinsic and extrinsic factors. Different spatial patterns were observed for soil N, P and K stocks across the whole study area, indicating that fertilizations with different ratios of N:P:K should be applied for different sites to maintain and improve stand productivity. The total soil N, P and K stocks within 0-60 cm were 0.624, 0.020 and 0.583 Tg, respectively.

With the increasing concern of environment, the energy-efficiency scheduling of manufacturing industry is becoming urgent and popular. In turning processes, both spindle speed and processing time can affect the final energy consumption and thus the spindle speed and scheduling scheme need to be optimized simultaneously. Since the turning workshop can be regarded as the flexible flow shop, this paper formulates a mixed integer linear programming model for energy-efficient scheduling of flexible flow shop. Accordingly, a new decoding method is developed by considering of the optimization of spindle speed and scheduling scheme simultaneously, and an estimation of distribution algorithm adopting the new decoding method is proposed to solve large-size problems. The parameters of this algorithm are determined by statistical technique with a simplified practical case. In order to validate the proposed method, a case from practical factories is studied, in which the makespan can be shortened by 25.22%, and the consumed energy can be saved by 5.48%. These results demonstrate the effectiveness of the proposed mathematical model and algorithm.

Development of K-Ras independence may explain failure of targeted therapy for pancreatic cancer (PC). In this paper active N as well as K-Ras was shown in all human cell lines tested. In a cell line dependent on mutant K-Ras, it was shown that depleting K-Ras reduced total Ras activity, while cell lines described as independent had no significant decline in total Ras activity. Knockdown of N-Ras showed it had an important role in controlling the relative level of oxidative metabolism but only K-Ras depletion caused a decrease in G2 cyclins, proteasome inhibition reversed this and other targets of APC/c were also decreased by K-Ras depletion. K-Ras depletion did not cause an increase in ubiquitinated G2 cyclins but instead caused exit from G2 phase to slow relative to completion of S-phase, suggesting mutant K-Ras may inhibit APC/c prior to anaphase but stabilizes G2 cyclins independently of this. We propose that during tumorigenesis, cancer cells expressing wild type N-Ras protein are selected because the protein protects cancer cells from the deleterious effects of cell cycle independent induction of cyclins by mutant K-Ras. Mutation independence results when N-Ras activity becomes adequate to drive cell division even in cells where K-Ras is inhibited. Keywords: Pancreatic Ductal Adenocarcinoma, K-Ras, N-Ras, G2 cyclins.

Lignocellulosic biomass, an abundant and renewable resource, serves as a crucial raw material for the production of biofuels, biochemicals, and various value-added products. This paper aims to develop and optimize a mild alkaline treatment of sawdust assisted by ultrasound, along with enzymatic hydrolysis of the pretreated material. The sonochemical pretreatment with alkali emerged as the optimal approach to enhance the susceptibility of cellulose to subsequent enzymatic hydrolysis, thereby increasing the yield of reducing sugars. A comparative study was performed using various ultrasonic applicators (horn and bath) and conventional assisted alkaline pretreatment. The ultrasonic assisted pretreatment revealed a higher delignification as 68% (horn) and 57% (bath) comparing with conventional pretreatment. Processes were optimized using a statistical analysis based on a 23 factorial design. The ratio between sawdust and alkanine solution (RSL = 0.5–1.5 g/100 mL), US amplitude (A = 20–60%), and working temperature (t = 30–50 °C) were selected as process factors. The optimal operating conditions to maximize the reducing sugar yield (138.15 mg GE /gsubstrate) were found as following: solid/liquid ratio RSL,opt = 1.25 g/100 mL, US amplitude Aopt = 60%, and and pretreatment temperature topt = 50 °C. The overall outcomes clearly confirmed the intensification of delignification by ultrasound assisted alkaline pretreatment

At 12:28 UTC (8:28 PM, local time) on 15 January 2023, a shallow, moderate earthquake with a magnitude (Mw) of 4.7 and a depth of one (1) kilometer shook the northern part of Leyte Island in the central part of the Philippines. The ground shaking was felt at PHIVOLCS Earthquake Intensity Scale (PEIS) VI, (very strong) equivalent to Modified Mercalli Intensity (MMI) VI in areas along the strike of the Leyte segment of the Philippine Fault. Even though this earthquake is classified as moderate in size, significant geologic, structural, and socio-economic impacts were documented. Most of the earthquake impacts that include surface rupture, liquefaction, and mass movements are limited near the epicentral area. The earthquake produced an 8-km-long surface rupture, the first documented rupture generated by a magnitude &lt;6 along the Philippine Fault, and is unusual in other surface rupturing earthquakes worldwide. It injured 18 persons and damaged 434 residential buildings and 26 public infrastructures which amounts to about 500 thousand US dollars. Structural damages were caused by surface rupture and/or poor engineering construction practices. Analysis of the seismic waveform and recorded peak ground acceleration (PGA) suggests that the subsurface geology influenced the ground motion amplification in an area near the epicenter. Based on the hypocenter, focal mechanism solution, aftershock distribution, and actual field observation, the causative fault for this event is the northern end of the Philippine Fault – Leyte segment. Moderate in size, this earthquake emphasizes the need and importance of documenting moderate-sized earthquakes as a tool and guide for medium and long-term earthquake risk assessment and resiliency.

Background: The bacterium Capnocytophaga spp. is a part of the oral microbiome of dogs, which has zoonotic potential. This study aimed to assess factors that influence the prevalence of Capnocytophaga cynodegmi and Capnocytophaga canimorsus in Wrocaw’s dog population. Methods: Molecular detection (PCR) involved 105 swabs, examining parameters such as oral cavity condition, underlying health issues, recent antibiotics, age, medications, material collection, and dog chews. Results: The study highlighted significant associations between the presence of Capnocytophaga cynodegmi and oral cavity condition, material collection method, and use of dog’s chews. Conclusions: Correlations obtained in this study between the oral health of Wroclaw's dog population and the presence of Capnocytophaga cynodegmi suggest its significance in the oral microbiome of dogs. Limitations, including the small sample size, highlight the need for more research to comprehensively understand additional factors that affect the prevalence of Capnocytophaga spp. in dogs