Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

An innovative superconducting mechanism was developed based on a patented discovery of room temperature superconductivity in several thorium (Th) salts or compounds. The rationale behind this discovery is through the experimental results about the unique electrical and magnetic properties of these Th salts. Accordingly, this new superconducting mechanism for these Th salts was obtained through the analyses of the compounds’ molecular configurations and the packings of their relevant crystal structures. Owing to the distinctive properties of the Th compounds in this discovery, we further established a different electron pairing scheme as opposed to the pairing of the Cooper pairs. Compared to the long distance electron pairing of the Cooper pairs, the new electron pairing in our mechanism is constructed by two closely correlated electrons that reside on the same atomic orbital of the Th cation as an electron lone pair. In this new superconducting mechanism, the Th cation is sitting on a relevant crystallographic lattice arrangement or a network of the relevant Th compounds. This network is constructed by many Th cations along certain crystallographic lattice arrangement where each Th cation contains one electron lone pair. This network allows the electron lone pairs on the Th cations to be delocalized over the network, “in pair”, and thus, reveals the electron lone pair in presence in a long distance fashion. The closely correlated electron lone pairs hop on this network and thus, construct the supercurrent over the network. This explanation about the superconductivity laid the basis for our superconducting mechanism. All these conclusions came from the previous studies about these compounds that illustrated their unusual features of a coexistence of high electrical conductivity and diamagnetism. These electrical and magnetic properties fall in line with that of superconductors but, surprisingly, these Th compounds have such properties at the ambient condition, meaning under room temperature and atmosphere pressure. We expect that this mechanism may be appropriate to be utilized to other superconducting cases, either conventional or unconventional, and therefore, can be adapted to describe the superconducting phenomenon for other superconductors.

The response of boreal vegetation to global warming has shown a weakening trend over the last three decades. However, in previous studies, models of vegetation activity responses to temperature change have often only considered changes in mean daily temperature (Tmean), with the diurnal temperature range (DTR) being neglected. The goal of this study is to evaluate the temporal trends of the relationships between two temperature factors (Tmean and DTR) and vegetation activity across the boreal regions on both annual and seasonal timescales, by simultaneously employing satellite and climate datasets. We found that the interannual partial correlation between growing season (GS) NDVI and Tmean (RNDVI−Tmean) showed a significant decreasing trend over the last 34 years. At the seasonal scale, RNDVI−Tmean shows a significant upward trend in the spring, while in the summer and autumn, RNDVI−Tmean exhibits a significant downward trend. The temporal trend characteristics of the partial correlation between NDVI and DTR (RNDVI−DTR), at both the GS and seasonal scales, are fully consistent with RNDVI−Tmean. The area with a significant decrease in GS RNDVI−Tmean and RNDVI−DTR accounted for approximately 44.40% and 41.21% of the boreal region with the 17-year moving window, respectively. In stark contrast, the area exhibiting a significant increasing trend in GS RNDVI−Tmean and RNDVI−DTR accounted for only approximately 14.65% and 13.59% of the boreal region with the 17-year moving window, respectively. With respect to the seasonal patterns of RNDVI−Tmean and RNDVI−DTR, the area with a significant upward trend in spring was greater than that with a significant downward trend. Nevertheless, more areas had a significant downward trend of RNDVI−Tmean and RNDVI−DTR in summer and autumn than had a significant upward trend. Overall, our research reveals a weakening trend in the impact of temperature on vegetation activity in the boreal regions, and contributes to a deeper understanding of the vegetation response to global warming.

Developing new energy is critical to China's green and low-carbon development. And the New Energy Demonstration City Policy (NEDCP) is a vital innovation policy that inspires the development of new energy. Is the NEDCP facilitating green and low-carbon development, if so, how? Employing unbalanced panel data from 2003 to 2017, the impact of NEDCP on green and low-carbon development was studied by using the "difference in difference" (DID) model. We find that this policy can take significantly role. After various robustness tests, our results are still valid. According to the heterogeneity analysis, non-resource and non-old industrial base cities have a greater positive impact from this policy. The mechanism analysis denotes that the positive policy effect works through upgrading the industrial structure and stimulating urban innovation. The substantial empirical evidence presented in this article supports the continued promotion and implementation of new energy demonstration cities.

Actuators are essential components for intelligent machines that can fulfill certain tasks in response to environmental stimuli. In recent years, actuators that can transform from a 2D ribbon shape to a 3D helical configuration under certain external stimuli have attracted significant attention due to the potential applications of the targeted helical structures in springs, propulsion generation, and artificial muscles. Inspired by the chiral opening of Bauhinia variegate‘s seedpods and the coiling of the Towel Gourd tendril with perversions, researchers have made significant breakthroughs in synthesizing state-of-the-art actuators capable of mimicking helical transformations. In this review, we give a brief overview of the shape evolution mechanisms of these two plant structures and then review recent progress in the fabrication of biomimetic helical actuators. These structures are categorized by the stimuli-responsive materials involved, including hydrogels, liquid crystal networks/elastomers, shape memory polymers, and multiwall carbon nanotubes. By providing this survey on important recent advances along with our perspectives, we hope to solicit new inspirations and insights on the development and fabrication of smart actuators, as well as the future development of interdisciplinary research at the interface of physics, engineering, and biology.

China is striving to leverage the power of science and technology to green its agriculture while increasing grain productivity. In this context, this study presents the green growth rate of agriculture from the DEA-based Green Total Factor Productivity (GTFP) indicator, together with the growth rate of grain yields, and applies it to the case of Jiangsu, a major grain-producing province with a well-developed economy. It is found that Jiangsu's agriculture has generally performed well in the implementation of the two major national strategies of green development and grain security, especially in the northern Jiangsu, which is a major grain-producing area. In contrast, the phased fluctuations of green growth in agriculture in Southern Jiangsu are more pronounced, with even negative green growth occurring during the green agriculture movement. Much of the volatility in agricultural green growth at the provincial, subregional, municipal level comes from the effects of the movement of the green technology frontier led by best practitioners. Accordingly, the possibility of improving the weak state of the catch-up effect on green growth is explored from the perspective of the Chinese government-led agricultural science and innovation system; it also traces the green agricultural initiatives in the main grain-marketing areas that have failed to deliver the expected green growth, and recommends a review of such policies and refinement of the GTFP Index tool for assessing sustainable green growth.

We have successfully synthesized a series of Bi doped BaFe2As2 high quality single crystals for the first time. The x-ray diffraction (XRD) patterns show an expansion of lattice parameter c with Bi doping, indicating a negative pressure effect. By investigating the resistivity, a Fermi liquid (FL) to non-Fermi liquid (NFL) crossover is observed from normal state to antiferromagnetic order state, accompanied by three superconducting transitions labeled as SC I, SC II and SC III which are supposed to be induced from three superconducting realms with various Bi concentration. Thus, the NFL behavior is proposed to be closely related with the presence of superconductivity. The magnetic susceptibility measurements further speculates that the SC I and SC III phases should be filamentary superconductivity while the SC II be a possible bulk superconductivity with TC 7 K.

As an implementation of inverse Radon transform, the Second-order Divided-difference Back Projection (SDBP) technique has been proposed in this paper, by which the accurate CT reconstruction can be theoretically realized. A computational model for CT reconstruction filter expressions has been derived on the basis of SDBP technique. The method reveals the correlation between the convolution kernel for data restoration and the filter expression. By substituting kernel functions into the computational model, the amplitude sequences of a variety of filters can be calculated. On the proposed filter construction method, the decomposition form of filters has been discovered, where a series of basic filters have been acquired. The properties of any filter depend on the decomposed basic filters. Basic filters can be used to compose filters in actual needs.

Adopting banana peel as raw material, the adsorption properties of banana peel hydrothermal carbon modified with KOH solution for lead ions in aqueous solution were studied. The surface structure and functional groups of the modified hydrothermal carbon were analyzed by XRD and SEM. The results showed that the banana peel hydrothermal carbon prepared from 0.5 mol/L KOH solution had large pores, and its adsorption capacity reached 42.92 mg/g at a pH value of 6; When the concentration of KOH solution is 0.5 mol/L, the solid liquid ratio is 2 g/L, the adsorption capacity reaches 21.39 mg/g, and the adsorption rate reaches 82.74%; When the concentration of lead solution increased to 100 mg/L, the adsorption capacity of modified hydrothermal carbon for lead ions decreased to 78.26%; The equilibrium adsorption time of lead ion in solution on phosphoric acid modified hydrothermal carbon from banana peel was 250 minutes, and the adsorption process met the quasi second order kinetic model and Freundlich isotherm equation, with an equilibrium adsorption rate of 88.62%. The adsorption of lead ions in solution by KOH modified hydrothermal carbon is mainly chemical physical adsorption.

A single fracture is the basic unit of fracture medium, and the roughness of fracture wall surface is an important factor influencing hydraulic characteristics of the flow in bedrock fracture. However, effects of the shape and density of roughness elements (various bulges/pits on rough fracture wall surfaces) on water flow in a single rough fracture have not been thoroughly discovered. Thus the water flow in single fracture with different shapes and densities of roughness elements was simulated by using Fluent software in this study. The results show that in wider fractures the flow rate mainly depends on fracture aperture, while in narrow and close fracture medium the surface roughness of fracture wall is the main factor of head loss of seepage; there is a negative power exponential relation between the hydraulic gradient index and the average fracture aperture, i.e. with the increase of fracture aperture, the relative roughness of fracture and the influence weight of hydraulic gradient both decrease; and in symmetrical-uncoupled fractures there is a super-cubic relation between the discharge per unit width and average aperture. Above results would help to deepen the understanding of rough fracture seepage.

Silicon carbide single crystal (SiC) has been widely used in the field of power devices, while it is difficult to fabricate ultra-flat surface by traditional manufacturing technologies due to its difficult-to-machine property. This paper investigates the interaction process during femtosecond laser ablation of crystalline silicon carbide based on the two-temperature model simulation and experimental study. The findings reveal that parameters such as laser pulse energy, scanning interval, and defocus amount exert significant influence on ablation depth, roughness, and surface morphology. The femtosecond laser proves effective in removing surface defects from cut SiC substrates, albeit resulting in increased surface roughness. However, subsequent polishing treatment of the laser-ablated silicon carbide surface can mitigate this roughness, underscoring the feasibility of laser surface ablation for silicon carbide single crystals.

Using banana peel as raw material, the adsorption properties of hydrothermal carbon pre-10 pared from banana peel modified with different concentrations of phosphoric acid solution for lead 11 ions in aqueous solution were studied. The surface structure and functional groups of the modified 12 hydrothermal carbon were analyzed by XRD and SEM. The results show that the surface of the 13 modified banana peel hydrothermal carbon prepared at 240℃ and 2mol/L phosphoric acid solution 14 has large pores. The adsorption capacity is larger when pH value is 6.When the concentration of 15 phosphoric acid solution was 2mol/L, the solid-liquid ratio was 2g/L, the adsorption capacity was 16 40.64mg/g, and the removal rate was 82.74%.When the initial concentration of lead solution in-17 creased to 100mg/L, the adsorption capacity of modified hydrothermal carbon for lead ion increased 18 to 76.81mg/g, and the removal rate decreased to 76.81%.The equilibrium adsorption time of banana 19 peel phosphoric acid modified hydrothermal carbon for lead ions in solution is 300min. The adsorp-20 tion process satisfies the pseudo-second-order kinetic model and Langmuir isotherm equation. The 21 reaction temperature is 313K, and the equilibrium adsorption capacity can reach 101.19mg/g. The 22 adsorption of Pb ions in aqueous solution by phosphoric acid modified hydrothermal carbon is 23 dominated by single layer chemisorption. The artificial neural network has a fitting correlation of 24 0.99, and the adsorption process includes physical adsorption, electrostatic attraction, ion exchange, 25 and surface complexation.

Glass has emerged as a highly versatile substrate for various sensor and MEMS packaging applications, including electromechanical, thermal, optical, biomedical, and RF devices, due to its exceptional properties such as high geometrical tolerances, outstanding heat and chemical resistance, excellent high-frequency electrical properties, and the ability to be hermetically sealed. In these applications, Through-Glass-Via (TGV) plays a vital role in manufacturing and packaging by creating electrical interconnections through glass substrates. This paper provides a comprehensive summary of the research progress in TGV fabrication along with their integrations, including through-via formation and metallization. The paper also reviews the significant qualification and reliability achievements obtained by the scientific community for TGV. Additionally, the paper summarizes the application of TGV technology in various sensors.

Studies on the detection of layers with elevated black carbon aerosol (BC) concentrations and the formation conditions of these layers help understand the vertical distribution of BC concentrations, which will provide a basis for the assessment of climate effects and early BC pollution warnings. By using the Weather Research and Forecasting with Chemistry (WRF-Chem) numerical model, we performed a numerical simulation analysis on the authenticity of strong elevated BC concentration layers that were detected by an aircraft in the mixing layer over Harbin, China, which is a high-emission area, on a clear sunny afternoon in the early heating period of 2016. We then discuss possible problems and solutions when non-vertical paths are used to detect the vertical distribution of BC concentrations. Finally, we discuss the favorable conditions for the formation of elevated BC concentration layers by weak vertical flow. The results show that the horizontal variability of BC concentration in the mixing layer in the observation area in Harbin was sufficiently large during the measurement. This produced a false elevated layer, as detected by the aircraft during one round of spiral flight in the mixing layer. The root mean square of the horizontal distribution of BC concentration did not change with height in the mixing layer during the daytime, but it decreased with the thickness of the mixing layer and was higher in the mixing layer than in the free atmosphere. Therefore, the thinner the mixing layer, in which the vertical distribution of the BC concentration is detected in an inclined path, the stronger interference of the horizontal variability on the detected results. When a spiral flight detection path is used, the aircraft should fly at least two rounds in the mixing layer. In the daytime, due to strong turbulence in the mixing layer, weak vertical uplift is not favorable for the occurrence of elevated BC concentration layers in the mixing layer. In the nighttime, if weak vertical uplift is well matched with the BC concentration or its vertical gradient, elevated BC concentration layers can be formed in the atmosphere. Compared with upper layers far from the ground, nighttime elevated layers are easier to form in lower layers near the ground because high BC concentrations or large vertical gradients are more likely to occur in the lower layers. Both cases facilitate the occurrence of large vertical upward transport rates of BC.

Reducing the hardness of hard water is of great concern nowadays due to some adverse effects on water pipes, boilers and soap consumption. Using the method of biomineralization to precipitate calcium and magnesium ions to become carbonate minerals was one of the most important innovations for reducing the hardness of hard water. The present study sought to explore the physical and chemical conditions of carbonates bio-precipitation and the potential use of Bacillus licheniformis SRB2 strain (GenBank: KM884945.1) isolated from sludge sample of Moshui River (Shandong University of Science and Technology, Qingdao, China) in reducing the hardness of hard waters by the induction of carbonate minerals. In this study, B. licheniformis SRB2 strain was identified based on the morphological, biochemical and 16S rDNA gene sequence homology analysis. The carbonate minerals induced by B. licheniformis bacteria in the liquid culture medium with 3% NaCl and Mg/Ca molar ratio of 0, 6, 8, 10 and 12 were investigated. The culture medium was inoculated with the bacterial liquid seed was set as the experimental group and the other culture medium was inoculated with the same volume of distilled water was set as the control group. The mineral phases, micromorphologies, and crystal structures were analyzed using X-ray powder diffraction, scanning electron microscope, energy dispersive X-ray detector, high resolution transmission electron microscopy and selected area electron diffraction. The bacterial concentrations and pH values of the solution were measured by a spectrophotometer and a pH meter, respectively. The urease secreted by B. licheniformis SRB2 was found to greatly increase the pH values of the liquid medium, which favored the formation of calcium carbonate.As a result, Mg²⁺ and Ca²⁺ ion concentrations decreased greatly due to the biomineralization of calcium carbonate and nesquehonite minerals in the presence of B. licheniformis SRB2 bacterium. There were only few calcium carbonates and no nesquehonite minerals in the control groups. It was also found that the minerals of nesquehonite induced by B. licheniformis SRB2 had a phenomenon of preferred orientation. What was more, even though Mg²⁺ ions inhibited the precipitation of Ca²⁺ ions, but under the action of B. licheniformis SRB2 bacteria, the inhibition effect was significantly declined. The bio-precipitation of calcium carbonate and nesquehonite minerals may represent a new method of pretreatment for the hardness reduction of hard water. The accomplished study is of certain interest for interpretation of the carbonates biomineralization in natural environment, and maybe also has a certain application value in the former processing of hard water

This paper is based on the concept of absolute airspace and its local absolute stationary reference system proposed by the author, on the premise of abandoning space concept and the relativity principle of relativity theory, It is proposed that general relativity and special relativity can be unified into Simple and practical a space-time transformation theory which fully includes other basic physical principles of relativity. And the unified and simple expression of the time transformation effect is proved and deduced. By comparing with the theoretical derivation and checking calculation of Hafele-Keating experiment in an ideal state, It is proved that the expression of time transformation effect proposed in this paper is completely correct. Compared with the theory of relativity, the calculation is simpler and more accurate. The paper also puts forward two checking prediction of physical cases about the time transformation effect, which are left for the capable competent unit or individual to verify in practice.

The paper suggests that the physical priciple of special relativity's space-time transformation effect is wrong, Uniform linear motion without acceleration does not exist objectively, nor does its same reference frames. Therefore, it is inferred that the space-time transformation effect of special relativity is caused by the acceleration of moving objects, special relativity is only a part of general relativity, not a theoretical system that exists independently from general relativity. The corresponding mathematical demonstration and calculation verification are carried out, and the result proves that the inference of the paper is correct. At the same time, it further explains that the concept of absolute airspace is correct. Special relativity has serious errors in the concept of space, the principle of relativity and the physical principle of space-time transformation effect. Therefore, it is necessary to make a series of revisions to the theory of relativity and to reinterpret some related physical problems.

The thesis proposes a argument that a mass point moving in a horizontal circle on the Earth's surface can generate a radial centrifugal force of the Earth's center of mass, thus realizing an unconventional anti-gravity path. And through the theoretical analysis of the difference in the distribution of gravitational acceleration at different latitudes caused by the rotation of the earth, and the centrifugal force of a mass point moving in a horizontal circle on the earth's surface is analyzed, the validity of the argument is demonstrated. At the same time, the paper puts forward two possible basic principles, and makes theoretical analysis and demonstration. Conceive of the concrete experimental verification of principle two is proposed. Four technical schemes for antigravity ascent are proposed and basic analysis is made. On the premise of not fully considering the practical technical ability, it is theoretically proved that three of them have realistic operability and development potential. In theory, this paper opens up a different way of anti-gravity for human beings, which will bring new ideas and prospects for human beings to get rid of the bondage of gravity.

In this paper, the Hafele‐Keating experiment and the geostationary orbit satellite of related physics problems of are analyzed and discussed in detail. If researchers read the paper and think about it, It will be found that the Hafele‐Keating experiment and the geostationary satellite problem prove that some of the core ideas and theories of relativity are seriously wrong. Isnʹt that a very serious problem in physics? Canʹt this cause the academic circles to pay great attention to it? Isnʹt this worthy of in‐depth analysis and research? The core of the paper is to point out that there are problems with the space concept and the reference system theory of classical physics and relativity, And that would bring up a whole host of physics problems. It takes a concerted effort from the academic community, Do furtherin‐depth analysis and research. Strive forthe further discovery and perfection of physics theory.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

The recyclable paper based on photochromic materials not only reduces the pollution in the paper manufacture process, but also reduces the pollution caused by the use of ink, which receives wide attention. In this paper, a serial of PMoA-PWA/ZnO/PVP hybrid films which had different ratio of PMoA/PWA was prepared by the ultrasonic composite method. The results indicated that the hybrid film prepared when the ratio of PMoA to PWA was 3 had the best photochromic performance. In this system, ZnO was the photosensitizer while PMoA/PWA was the chromophore. The photochromic mechanism of PMoA-PWA/ZnO/PVP hybrid film was based on the photogenerated electron transfer mechanism. ZnO generated photoelectron under the excitation of visible light, then PMoA and PWA obtained the photoelectron and produced photoreduction reaction to generate heteropolyblue. The visible light photochromic paper was prepared by loaded PMoA-PWA/ZnO/PVP hybrid film (A3) on A4 paper. Application test showed that the prepared paper had extremely stable, excellent and reversible visible light photochromic properties, whether it was printing patterns or words and could replace the ordinary paper to realize the reuse of paper.

Supplementary lighting is commonly used in high-quality seedling production. In this study, grafted tomato seedlings were grown for 10 days in a glasshouse with a 16-hour daily supplementary lighting at 100 μmol·m⁻²·s⁻¹ PPFD from either high pressure sodium (HPS), metal halide (MH), far-red (FR), white LEDs (W), or mixed LEDs (W₁R₂B₁) to determine which light sources improve the seedling quality. The control did not have any supplementary light. The physiological parameters and the expression of genes related to photosynthesis were analyzed. The results show that the root length, biomass, number of leaves, chlorophyll (SPAD), dry weight to height ratio (WHR) of the scion, and specific leaf weight (SLW) were the greatest for grafted seedlings grown in W₁R₂B₁. The level of root ball formation was the greatest for seedlings grown in W₁R₂B₁, followed by those grown in W, HPS, and MH. Seedlings grown in FR did not fare very well, as they were very thin and weak. Moreover, the expression of two photosynthetic genes (PsaA and PsbA) was significantly increased by W₁R₂B₁ and W, which suggests that the plastid or nuclear genes might be regulated. The overall results suggest that W₁R₂B₁ was the most suitable light source to enhance the quality of grafted tomato seedlings. The results of this study could be used as a reference for seedling production in glasshouses, and provide new insights in the research of lights affecting the development of plants.

In this study, we design a new refractive index sensor based on a metal–insulator–metal waveguide coupled with a notched ring and vertical rectangular resonators. We use the finite element method to study the propagation characteristics of the sensor. According to the calculation results, the transmission spectrum exhibits a typical Fano resonance shape. The phenomenon of Fano resonance is caused by the coupling between the wide spectrum and narrow spectrum. In the design, the wide spectrum signal is generated by the vertical rectangular resonator, while the narrow spectrum signal is generated by the notched ring resonator. In addition, we varied the structural parameters of the resonators and filled the structure with media of different refractive indices to study the sensing properties. The maximum achieved sensitivity of the sensor reached 1071.4 nm/RIU. The results reveal potential applications of the coupled system in the field of sensors.

To investigate the effects of plant polysaccharides combined with boric acid on digestive function, immune function, and harmful gas and heavy metal contents in faeces of finishing pigs, for this study, 90 healthy three-way cross-bred pigs were selected and randomly divided into five groups: Con) A control, fed basic feed; BA) fed basic feed supplemented with 40 mg/kg of boric acid; BA+APS) fed basic feed supplemented with 40 mg/kg of boric acid and 400 mg/kg of Astragalus polysaccharides; BA+GLP) fed basic feed supplemented with 40 mg/kg of boric acid with 200 mg/kg of Ganoderma lucidum polysaccharides; and BA+EPS) fed basic feed supplemented with 40 mg/kg of boric acid and 500 mg/kg of Echinacea polysaccharides. Compared with the Con, the average daily gain (ADG) and trypsin activity were higher in BA, along with there being increased glutathione peroxidase (p < 0.05); furthermore, lower malondialdehyde content and harmful substance emissions from manure were observed (p < 0.05). Compared with BA, increases in ADG, gain-to-feed ratio (G/F), trypsin, and maltase activities were observed in BA+EPS (p < 0.05), as well as a lower NH3 emissions (p < 0.05). Compared with BA, BA+APS exhibited higher ADG, average daily feed intake (ADFI), G/F, trypsin, and maltase activities (p < 0.05), while H2S emissions were lower (p < 0.05). And Taken together, our findings reveal that supplementation with boric acid and plant polysaccharides in the diet of finishing pigs synergistically improved their growth performance, trypsin and maltase activities, and immune function, while also discovered the intestinal digestive enzymes, serum inflammatory factors, oxidative stress responseand emissions of harmful gases and heavy metals from feces and urine were tightly related, further reducing the impact of fecal pollution generated by modern animal husbandry on the environment.

Mulberry (Morus alba L), a significant fruit tree crop, requires magnesium (Mg) for its optimal growth and productivity. Nonetheless, our understanding of the molecular basis underlying magnesium stress tolerance in mulberry plants remains unexplored. In our previous study, we identified several differential candidate genes associated with Mg homeostasis via transcriptome analysis including xyloglucan endotransglucosylase/hydrolase (XTH) gene family. The XTH gene family is crucial for plant cell wall reconstruction and stress responses. These genes have been identified and thoroughly investigated in various plant species. However, there is no research pertaining to XTH genes within the M. alba plant. This research systematically examined the M. alba XTH (MaXTH) gene family at the genomic level using a bioinformatic approach. In total, 22 MaXTH genes were discovered and contained the Glyco_hydro_16 and XET_C conserved domains. The MaXTH’s were categorized into five distinct groups by their phylogenetic relationships. The gene structure possesses four exons and three introns. Furthermore, the MaXTH gene promoter analysis reveals a plethora of cis-regulatory elements; mainly stress responsiveness, growth and development, light responsiveness, and phytohormone responsiveness. GO analysis indicated that MaXTHs encode proteins that exhibit xyloglucan xyloglucosyl transferase and hydrolase activities in addition cell wall biogenesis as well as xyloglucan and carbohydrate metabolic processes. Moreover, a synteny analysis unveiled an evolutionary relationship between the XTH genes in M. alba and those in three other species: A. thaliana, P. trichocarpa, and Zea mays. Expression profiles from RNA-Seq data displayed distinct expression patterns of XTH genes in M. alba leaf tissue during Mg treatments. Real-time quantitative PCR analysis confirmed the expression of the MaXTH genes in Mg stress response. Overall, this research enhances our understanding of the characteristics of MaXTH gene family members and lays the foundation for future functional genomic study in M. alba.

Magnetoelectric (ME) sensor is a new type magnetic sensor with ultrahigh sensitivity, low power consumption, and suitable for the measurement of low frequency weak magnetic field. In this study, metglas/PZT-5B ME sensor with a mechanical resonance frequency f_res of 60.041 kHz was prepared. It is interesting to note that its magnetic field resolution reaches 0.20 nT at f_res and 0.34 nT for DC field, respectively. In order to measure the ultralow frequency AC magnetic fields, a frequency upconversion technique was employed. Under this technique, a limit of detection (LOD) of AC magnetic field lower than 1 nT at 8 Hz is obtained, and the minimum LOD of 0.51 nT is achieved at 20 Hz. The high resolution ME sensor with sub-pT level is promising in the field of low frequency weak magnetic field measurement technology.

：Non-Euclidean data, such as social networks, and citation relationships between documents, has node information and structural information. Graph Convolutional Network(GCN) can automatically learn node features and association information between nodes. The core ideology of the graph convolutional network is to aggregate node information by using edge information, thereby generating a new node feature. In the process of updating node features, there are two core influencing factors. One is the number of neighboring nodes of the central node, the other is the contribution of the neighboring nodes to the central node. Due to the previous GCN methods not simultaneously considering the numbers and different contributions of neighboring nodes to the central node, we design the Adaptive Attention Mechanism(AAM). To further enhance the representational capability of the model, we utilize Multi-Head Graph Convolution(MHGC). Finally, we adopt cross-entropy(CE) loss function to describe the difference between the predicted results of node categories and the ground truth (GT). Combined with backpropagation, this ultimately achieves accurate node classification. Based on AAM, MHGC and CE, we contrive the novel Graph Adaptive Attention Network (GAAN). Experiments show that the classification accuracy has achieved outstanding performances on Cora, Citeseer and Pubmed datasets.

The existing segmentation-based scene text detection methods mostly need complicated post-processing, and the post-processing operation is separated from the training process, which greatly reduces the detection performance. The previous method, DBNet successfully simplified post-processing and integrated the post-processing into a segmentation network. However, the training process of the model took a long time for 1200 epochs and the sensitivity to texts of various scales was lacking, leading to some text instances being missed. Considering the above two problems, we design the text detection Network with Binarization of Hyperbolic Tangent(HTBNet). First of all, we propose Binarization of Hyperbolic Tangent (HTB), optimized along with which, the segmentation network can expedite the initial convergent speed by reducing the amount of epochs from 1200 to 600. Because features of different channels in the same scale feature map focus on the information of different regions in the image, to better represent the important features of all objects in the image, we devise the Multi-Scale Channel Attention(MSCA). Meanwhile considering that multi-scale objects in the image cannot be simultaneously detected, we propose a novel module named Fused Module with Channel and Spatial(FMCS), which can fuse the multi-scale feature maps from channel and spatial dimension. Finally we adopt cross entropy as the loss function, which measures the difference between predicted values and ground truths. The experimental results show that HTBNet compared with lightweight models has achieved competitive performance and speed on Total-Text(F-measure:86.0%, FPS:30) and MSRA-TD500 (F-measure:87.5%, FPS:30).

The degree of ore rock fragmentation of mine blasting is an important index for evaluating the effect of engineering blasting. In order to study the effect of millisecond delayed blasting on the internal fragmentation of the ore rock, LS-DYNA numerical simulation software was used to obtain the damage characteristics of the ore rock in the blasting area using the RHT model. The Mohr-Coulomb strength damage criterion was applied to analyze the internal stress state of the ore rock, and the effects of 25ms, 50ms and 75ms delay time conditions on ore rock fragmentation were studied. The results show that, within a certain range of delay time, the degree of rock fragmentation increases with the increase of delay time. The stress state in the ore rock due to blasting is strengthened with the increase of delay time in the direction of the blast hole, which shows that the stress concentration is strengthened from the excavation face to the interior of the ore rock. The damage and the degree of fragmentation show a characteristic relationship of 25ms＜50ms＜75ms, which is verified by carrying out blasting experiments on site.

The intense motion of a ship can greatly impacts the comfort of crew members and the safety of the vessel. Therefore, accurately estimating and predicting ship attitudes has become an important issue. This paper introduces the latest development in functional deep learning model called DeepOnet. It takes wave height as input and ship motion as output, using a cause-to-result prediction approach. The modeling data used in this study is sourced from publicly available experimental data from the Iowa Institute of Hydraulic Research. Firstly, parameters system tuning was conducted for the neural network's hyperparameters to determine the appropriate combination of parameters. Secondly, the DeepOnet model for wave height and multi-degree-of-freedom motion was established, and the influence of increasing time steps on prediction accuracy was examined. Finally, a comparison was made between the DeepOnet model and the classical time series model LSTM. It was found that the DeepOnet model had a 10-fold improvement in accuracy for roll and heave attitudes. Moreover, as the forecast duration increased, the advantage of DeepOnet showed a trend of strengthening. As a functional prediction model, DeepOnet provides a new promising tool for very short-term prediction of ship motion.

Flavonoids are major secondary metabolites in plants, which play important roles in maintaining the cellular redox balance in cells. Chalcone synthase (CHS) is the key enzyme in the flavonoids biosynthesis pathway, and has been proved to monitor the changes to drought stress tolerance. In this work, we overexpressed a CHS gene in tobacco (Nicotiana tabacum). The transgenic tobacco plants were more tolerant than the control plants to drought stress. The transcription levels of the key genes involved in the flavonoids pathway and the contents of seven flavonoids were also significantly raised in the transgenic tobacco plants. In addition, overexpression of the CHS gene lead to a lower concentration of the oxidative stress product malondialdehyde. Overall, the NtCHS gene studied in this work was considered as a candidate gene for genetic engineering to enhance drought tolerance of plants and improve response to oxidative stress.

In (Semigroup Forum 77: 325-338, 2008) Mahmoudi M. and Renshaw J. solved a study that covers of cyclic $S$-acts over monoids. This article is an attempt to initiate the covers of finitely generated $S$-acts. We give a necessary and sufficient condition for a monoid to have the properties that $n$-generated $S$-acts have strongly flat covers, Condition $(P)$ covers and projective covers. The main conclusions extend some known results. We show also that Condition $(P)$ covers of finitely generated $S$-acts are not unique, unlike the situation for strongly flat covers. Additionally, we demonstrate that the property of Enochs' $\mathcal{X}$-precover of $S$-act $A$, where $\mathcal{X}$ denotes a class of $S$-acts that are closed under isomorphisms.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

In this paper, we study the well-posedness and asymptotics of a one-dimensional thermoelastic laminated beam system either with or without structural damping, where the heat conduction is given by Fourier's law effective in the rotation angle displacements. We show that the system is well-posed by using Lumer-Philips theorem, and prove that the system is exponentially stable if and only if the wave speeds are equal, by using the perturbed energy method and Gearhart-Herbst-Prüss-Huang theorem. Furthermore, we show that the system with structural damping is polynomially stable provided that the wave speeds are not equal, by using the second-order energy method.

SARS-CoV-2, the newly identified human coronavirus causing severe pneumonia epidemic, was probably originated from Chinese horseshoe bats. However, direct transmission of the virus from bats to humans is unlikely due to lack of direct contact, implying the existence of unknown intermediate hosts. Angiotensin converting enzyme 2 (ACE2) is the receptor of SARS-CoV-2, but only ACE2s of certain species can be utilized by SARS-CoV-2. Here, we evaluated and ranked the receptor-utilizing capability of ACE2s from various species by phylogenetic clustering and sequence alignment with the currently known ACE2s utilized by SARS-CoV-2, predicting potential intermediate hosts of SARS-CoV-2.

In the contemporary world of science, continuous observation of specific fixed regions is required, awaiting the emergence of targets or phenomena within those areas to locate and identify them. Astronomy requires continuous monitoring of stars, swiftly pinpointing occurrences, such as flares, and acquiring their spectral data to aid identification. In military contexts, continuous observation of specific areas is essential for promptly locating enemy movements and obtaining target spectral data for deciphering enemy disguises. Additionally, continuous observation of experimental samples in biochemistry is mandatory to pinpoint localized changes and acquire spectral data from those areas. Hence, this paper develops a novel imaging spectrometer solution to monitor localized regions continuously. Specifically, this paper first elaborates on the developed instrument’s characteristics and optical structure, followed by optical design software simulations. The instrument has an F-number of 5, a focal length of 100mm, and a field of view covering the wavelength range from 400nm to 600nm. The optical path diagram indicates that the system’s dispersion and imaging images can be separated, meeting the system’s requirements. Besides, the Modulation Transfer Function (MTF) graph confirms that the image quality meets the requirements. Furthermore, a region-monitoring type imaging spectrometer was constructed to assess the instrument’s capability for spectral observation of fixed regions. The instrument can detect a fixed area, with the target placed within the detection area. Spectral data were successfully obtained by conducting image processing on the acquired images. The correlation coefficient between this data and reference data was as high as 0.9226, indicating the instrument’s successful measurement of the target’s spectrum. Thus, the developed instrument demonstrated that it can image the observed areas and acquire spectral data from targets within those regions.

Aiming at the problems of inaccurate segmentation of long object and information loss of small object in real-time semantic segmentation algorithm, this paper proposes a lightweight multi-branch real-time semantic segmentation network based on BiseNetV2. The new auxiliary branch makes full use of spatial details and context information to cover the long object in the field of view. Meanwhile, in order to ensure the inference speed of the model, the asymmetric convolution is used in each stage of the auxiliary branch to design a structure with low computational complexity. In the multi-branch fusion stage, the alignment and fusion module is designed to provide guidance information for deep and shallow feature mapping, so as to make up for the problem of feature misalignment in the fusion of information at different scales, and thus reduce the loss of small target information. In order to further improve the model’s awareness of key information, a global context module is designed to capture the most important features in the input data. The proposed network uses NVIDIA GeForce RTX 3080 Laptop GPU experiment, on the road street view data set Cityscapes and CamVid average occurring simultaneously ratio reached 77.1% and 78.4% respectively, with running speed of 127 frames/s respectively and 112 frames/s. The experimental results show that the proposed algorithm can achieve real-time segmentation and improve the accuracy significantly, showing good semantic segmentation performance

Plant Factory Transplanter (PFT) is a key component of the plant factory system. Its operation status directly affects the quality and survival rate of planted seedlings, which in turn affects the overall yield and economic efficiency. To monitor the operation status and transplanting quality of a transplanting machine in a timely manner, the primary task is to use a computerized and easy-to-use method to monitor the transplanting units. Inspired by the latest developments in augmented reality and robotics, a DT model-based and data-driven online monitoring method for plant factory transplanting equipment is proposed. First, a data-driven and virtual model approach is combined to construct a multi-domain digital twin of the transplanting equipment. Then, taking the vibration frequency domain signal above the transplanting manipulator and the image features of the transplanting seedling tray as input variables, the evaluation method and configuration method of the PFT digital twin system are proposed. Finally, the effect of the transplanter is evaluated, and the cycle can be repeated to optimize the transplanter to achieve optimal operation parameters. The results show that the digital twin model can effectively use the sensor data to identify the mechanical vibration characteristics and avoid affecting transplanting quality due to mechanical resonance. At a transplanting rate of 3000 plants/h, the transplanting efficiency can be maintained at a high level and the vibration signal of X, Y, Z-axis above the transplanting manipulator is relatively calm. In this case, Combined the optimal threshold method with the traditional Wiener algorithm, the identification rate of healthy potted seedlings can reach 94.3%. Through comprehensively using the optimal threshold method and 3D block matching filtering algorithm for image threshold segmentation and denoising, the recognition rate of healthy seedlings has reached over 96.10%. In addition, the developed digital twin can predict the operational efficiency and optimal timing of the detected transplanter, even if the environmental and sensor data are not included in the training. The proposed digital twin model can be used for damage detection and operational effectiveness assessment of other plant factory equipment structures.

A PLS-based quality prediction method is proposed for batch processes using two-dimensional extended windows. To realize the adoption of information in the direction of sampling time and batch, a new definition region of support (ROS), k-i-back-extended region of support (KIBROS), is proposed to establish the extended window, which including the data of the previous sampling times in the same batch, the data of the same sampling time in the historical batches, the data of the previous sampling times in the historical batches and the data of the later sampling times in the historical batches. According to these regions of support, extended windows are established, and different models are proposed based on the extended windows for batch processes quality prediction. Further, using a typical batch process as an example, the injection molding process, the proposed quality prediction method is experimentally verified, proving that the proposed methods have higher prediction accuracy than the traditional method and the prediction stability is also improved.

Given of the outstanding versatile properties, the multilayered anti-corrosion coatings have drawn great interests in academic and engineering fields. However, the application of multilayered coatings is restricted by some limitations such as low interlayer compatibilities, harsh preparation process, etc. This work introduced a composite film fabricated on 2A12 aluminum alloy surface, including an anodic oxide film, a sol-gel film as well as a layer-by-layer (LBL) self-assembling film from bottom to top. The microstructure and elemental characterization indicated that the finish of the coating with the LBL film resulted in a closely connected multilayered coating with a smoother surface. The anticorrosion performance was systematically evaluated in the simulated corrosive medium and neutral salt-spray environment. The intergrated coating with the LBL film presented an excellent anticorrosion ability with the system impedance over 108 Ω•cm² and the self-corrosion current density two orders of magnitude lower than that of the other coatings. After the acceleration test in salt-spray environment, the multilayered coatings could still show a good protective performance with almost no cracks and no penetration of chloride ions. It is believed that the as-constructed multilayered coating with high corrosive properties and fine surface state will have promising applications in the field of anticorrosion engineering.

In this paper, the sol−gel method was used to synthesize powders of LaMnO3 (LMO), La0.85Ca0.15MnO3 (LCM), and La0.85Sr0.15MnO3 (LSM). We investigated the impact of substituting Ca and Sr at the A−site on the perovskite crystal structure and electrochemical capabilities of LMO. LCM retained its orthogonal structure in comparison to the parent LMO components, whereas LSM transitioned to a rhombic structure. At 0.5 A/g, the specific capacitance of LCM and LSM electrodes is 185.5 F/g and 248 F/g, respectively.The specific capacitance of LCM was more three times than that of the LMO electrode. Among the three samples (LMO, 22.25 m2 g−1; LSM, 31.56 m2 g−1), the LCM sample exhibited the highest specific surface area of 38.79 m2 g−1. The charge transfer resistances of the LMO, LCM, and LSM are 0.48 Ω, 0.36 Ω, and 0.38 Ω, correspondingly. The LCM electrode exhibits the greatest capacitance performance due to its more refined morphology, increased concentration of oxygen vacancy, and more complete utilization of the perovskite bulk structure. The above results demonstrate that Ca or Sr substitution of A−site compounds has great potential for supercapacitor applications.

With the rapid development of earth observation, satellite navigation, mobile communication and other technologies, the order of magnitude of the spatial data we acquire and accumulate is increasing, and higher requirements are put forward for the application and storage of spatial data. Under this circumstance, a new form of spatial data organization emerged-the global discrete grid. This form of data management can be used for the efficient storage and application of large-scale global spatial data, which is a digital multi-resolution the geo-reference model that helps to establish a new model of data association and fusion. It is expected to make up for the shortcomings in the organization, processing and application of current spatial data. There are different types of grid system according to the grid division form, including global discrete grids with equal latitude and longitude, global discrete grids with variable latitude and longitude, and global discrete grids based on regular polyhedrons. However, there is no accuracy evaluation index system for remote sensing images expressed on the global discrete grid to solve this problem. This paper is dedicated to finding a suitable way to express remote sensing data on discrete grids, and establishing a suitable accuracy evaluation system for modeling remote sensing data based on hexagonal grids to evaluate modeling accuracy. The results show that this accuracy evaluation method can evaluate and analyze remote sensing data based on hexagonal grids from multiple levels, and the comprehensive similarity coefficient of the images before and after conversion is greater than 98%, which further proves that the availability hexagonal grid-based remote sensing data of remote sensing images. And among the three sampling methods, the image obtained by the nearest interpolation sampling method has the highest correlation with the original image.

The tourism economy plays an essential role in supporting and driving tourism development. Therefore, studying its resilience is crucial for promoting sustainable and high-quality tourism development. Based on the core essentials of economic toughness, this paper constructs the tourism economic toughness evaluation index system, uses the entropy weight TOPSIS method to measure the tourism economic toughness of 10 counties and cities in the Yili River Valley in 2010-2019, analyzes its spatio-temporal evolution characteristics through the standard deviation ellipse, the traditional Markov chain, and the spatial Markov chain, and uses the grey correlation analysis method to analyze the driving factors of the tourism economic toughness. The results show that: (1) the economic resilience of tourism in the Yili River Valley shows a "W"-shaped time-series dynamic development trend with an average index of 0.28394, in which it experienced a decline from 0.28 to 0.27 during 2012-2013 and 2015-2016; (2) Spatial Pattern: The Yili River Valley tourism economic resilience is characterized by a clear uneven spatial distribution. The city of Yining, representing the northwestern region, exhibits a high level of resilience, while the southwestern region, endowed with rich tourism resources, demonstrates a medium level of resilience. Conversely, the central to southeastern counties and cities, such as ChabuchaerXibo Autonomous County and other counties and cities, are characterized by a lack of developed tourism facilities, which has resulted in a lower level of resilience and a weak development situation; (3) In terms of spatial and temporal evolution, the standard deviation ellipse is stabilized year by year pointing to "northwest-southeast", the clustering tendency is gradually enhanced, and five tourism economic resilience convergence clubs are identified, whose internal transition probability is significantly affected by spatial location, and which show obvious stability and neighborhood effects; (4) Regarding the driving factors, the impact of each driving factor on the resilience of the tourism economy reaches the statistical significance threshold of 0.77 or above. Among them, the number of employees in the tertiary industry, especially the input of high-quality talents in the tourism industry, plays a key role in improving the quality of tourism services and strengthening the industry's ability to withstand risks and development potential.

Functional partially linear regression model, contains a functional linear part and a non-parametric part, in which testing the linear relationship between the response and the functional predictor is of fundamental importance. When functional data cannot be approximated with a few principal components, based on a pseudo estimate for the unknown non-parametric component, we develop a U-statistic of order-two in this paper. Under some regularity conditions, we use the martingale central limit theorem to prove that the proposed test statistic is asymptotically normal. The finite sample performance with simulation studies and real data application are assessed to verify the proposed test procedure.

This study describes a novel method for grading pathological sections of gliomas. Our own integrated hyperspectral imaging system was employed to characterize 270 bands of cancerous tissue samples from microarray slides of gliomas. These samples were then classified according to the guidelines developed by the World Health Organization, which define the subtypes and grades of diffuse gliomas. We explored a hyperspectral feature extraction model called SMLME-Resnet using microscopic hyperspectral images of brain gliomas of different malignancy grades. The model combines the channel attention mechanism and multi-scale image features to automatically learn the pathological organization of gliomas and obtain hierarchical feature representations, effectively removing the interference of redundant information. It also completes multi-modal, multi-scale spatial and spectral feature extraction to improve the automatic classification of glioma subtypes. The proposed classification method demonstrated high average classification accuracy (>97.3\%) and Kappa coefficient (0.954), indicating its effectiveness in improving the automatic classification of hyperspectral gliomas. The method is readily applicable in a wide range of clinical settings, offering valuable assistance in alleviating the workload of clinical pathologists. Furthermore, the study contributes to the development of more personalized and refined treatment plans, as well as subsequent follow-up and adjustment of treatment, by providing physicians with insights into the underlying pathological organization of gliomas.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

Amid escalating urbanization, devising rational commercial space layouts is a critical challenge. Leveraging machine learning, this study uses a Back-propagation (BP) neural network to optimize commercial spaces in Weinan City's central urban area. The results indicate an increased number of commercial facilities with a trend of multi-centered agglomeration and outward expansion. Based on these findings, we propose a strategic framework for rational commercial space development emphasizing aggregation centers, development axes, and spatial guidelines. This strategy provides valuable insights for urban planners in small and medium-sized cities in the Yellow River Basin and metropolitan areas, ultimately showcasing the power of machine learning in enhancing urban planning.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Adipose tissue composition contributes greatly to the quality and nutritional value of meat. Transcriptomic and lipidomic techniques were used to investigate the molecular mechanism of fat deposition difference among Ningxiang, Berkshire and F1 pigs. Transcriptomic analysis identified 680, 592 and 380 differentially expressed genes (DEGs) by comparing the groups of Ningxiang pigs vs Berkshire pigs, Berkshire pigs vs F1 pigs, Ningxiang pigs vs F1 pigs. Lipidomic analysis screened 423, 252, and 50 significantly changed lipids (SCLs) by comparing the groups of Ningxiang pigs vs Berkshire pigs, Berkshire pigs vs F1 pigs, Ningxiang pigs vs F1 pigs. Lycine, serine and threonine metabolism pathway, fatty acid biosynthesis and metabolism related pathways were siginificant enriched in the groups of Berkshire pigs vs Ningxiang pigs and Berkshire pigs vs F1 pigs. The DEGs (PHGDH, LOC110256000) and the SCLs (Phosphatidylserines) may have a great impact on lycine, serine and threonine metabolism pathway. Moreover, the DEGs (FASN, ACACA, CBR4, SCD, ELOV6, HACD, CYP3A46, CYP2B22, GPX1, GPX3) and the SCLs (palmitoleic acid, linoleic acid, arachidonic acid, icosadienoic acid) play important role in fatty acid biosynthesis and metabolism. Thus, the fat deposition difference among Ningxiang, Berkshire and F1 pigs may be caused by the difference of the expression pattern of key genes in multiple enrichment KEGG pathways. The research presented multiple lipids that were potentially available biological indicator and screened key genes that were potentially gene targets for molecular design breeding. The research also explored the molecular mechanisms of fat deposition difference among Ningxiang, Berkshire and F1 pigs and provides insight into the selection of backfat thickness and fat composition of adipose tissue for future breeding strategies.

This study establishes a multivariate function model for natural human load carrying walking in some typical scenarios like college equipments and materials relocation for students. For classified materials relocation needs and constraints, we obtain the relationship between walking speed and load weight for single person, as well as the time cost for different round trips. By establishing an integer programming model with the minimum total transportation time cost and quality assurance as the objective function and the requirements of negative weight and speed as the constraints conditions, we reach the optimal item allocation methods considering time cost and shelf life were obtained. We discover that there is an approximate linear relationship between the change in natural walking speed and travel time when the load is small, thus obtaining the time cost of student transportation under different round-trip situations. The Monte Carlo simulation algorithm is used to obtain the optimal allocation scheme that meets the efficiency and quality requirements. The analysis methods and results can be used as guidance for task scheduling optimization for material relocation in educational organizations as well as commercial agencies.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

To estimate the progressive collapse resistance capacity of a multi-column frame tube structure with the assembled truss beam composite floor (ATBCF), the pushdown analysis, and the nonlinear dynamic analysis as well, are conducted for such a structure by using the alternate load path (ALP) method. The bearing capacities of the remaining structures at three different work conditions, which are the side middle column failure, the edge middle column failure, and the corner column failure, are individually studied, and the collapse mechanism for the remaining structures is analyzed from the aspects of the internal force redistribution and the failure mode of the second defense line. Simultaneously, the influence of the column failure time on the dynamic response of the remaining structure and the dynamic amplification coefficient are discussed. The results show that the residual bearing capacity of the remaining structure with the bottom corner column failure is higher than that of the one with the side or edge middle column failure, while the latter has a stronger plastic deformation capacity. When the ALP method is adopted to operate the progressive collapse analysis, it is reasonable to take the column failure time as 0.1 times of the first-order vertical vibration period of the remaining structure, and it is suitable to set the dynamic amplification coefficient as of 2.0, which is the ratio of the maximum dynamic displacement to the static displacement of the remaining structure under the transient loading condition.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Buckling defect will appear on the outer surface of the deformed ring during constrained ring rolling (CRR) of aluminum alloy thin wall conical ring with inner high ribs (AATWCRIHR), if the geometrical dimension of the ribs doesn't match the wall thickness. To avoid the buckling defect, a quantitative method for characterizing the degree of the buckling defect is proposed using the area of buckling profile. Then an orthogonal experimental scheme was designed taking the width of the middle rib, thickness of wall, and height of the middle rib as design variables and defining the area of buckling profile as optimization objective. Subsequently, a quadratic polynomial response surface model was established by combining the optimization algorithm with the finite element method (FEM), and the geometrical dimension of the middle ribs of the deformed AATWCRIHR is optimized. Also the optimal parameter combination to minimize the area of buckling profile is obtained and verified using FE simulation. Results show that the AATWCRIHR after optimization doesn’t generate the buckling defect during constrained ring rolling, and it is proved that the quantitative buckling defect representation method and the optimization design method based on the response surface model and the finite element simulation results are feasible for the constrained ring rolling process of the AATWCRIHR.

Objective: Daratumumab (Dara) is the first-in-class human-specific anti-CD38 mAb approved for treating multiple myeloma (MM). However, DARA-induced depletion of CD38high natural killer (NK) cells results in crippled antibody-dependent cellular cytotoxicity (ADCC), which limits its clinical detection and prediction for Dara efficacy. Therefore, we aimed to explore new NK subsets that could predict Dara efficacy and the underlying mechanism in Dara development. Methods: Multicolour spectral flow cytometry monitored changes in the immune cells of 13 paired RRMM patients. We used machine learning-driven clustering, FlowSOM (Flow Self-Organizing Maps), and dimensional reduction with tSNE (t-distributed Stochastic Neighbour Embedding) to identify unique cell populations pre- and posttreatment. Then, in vitro, fratricide and proliferation assays were performed to explore the function of new NK subsets against MM under Dara treatment. Results: The NK cells were divided into 25 subsets, among which we found that the percentages of KIR-NKP46+ NK cells decreased in paired RRMM patients compared to healthy controls but increased significantly post-Dara treatment. The fold change in KIR-NKP46+ after one dose of Dara treatment can predict whether the best response could be achieved within one month (ROC=0.86, p=0.011). Further in vitro experiments showed that KIR-NKP46+ NK cells are superior to KIR+ NK cells, cooperatively acting with daratumumab to sustainably eradicate MM cells. Meanwhile, apoptosis was significantly decreased, and the proliferation ability was relatively increased post-Dara treatment. Conclusion: In conclusion, the fold change in KIR-NKP46+ NK cell subsets after one dose of Dara treatment can predict the outcome of the curative effect, indicating a putative role of KIR-NKP46+ subsets against MM cells. The mechanism attributed to a relative expansion of the subset due to decreased apoptosis and increased proliferation ability.

Classifying network flow subsequences in an Industrial IoT gateway is an effective method for identifying Industrial IoT faults. This paper proposes a subsequence classification algorithm SSGBUL-IKNN based on unsupervised learning encoding to address the problem of low classification accuracy. Firstly, we built a network module based on unsupervised learning to encode the flow sequence of the Industrial IoT gateway. In the encoding module, a subsequence calibration algorithm controls the increasing error during the coding process. Then, the specific fault type is obtained through an improved KNN classification algorithm based on the indication distance source from the integrated coding sequences converted by multi-dimensional network flow sequences. The test result on three Industrial IoT datasets of a sewage treatment plant shows that the accuracy of SSGBUL-IKNN in this paper exceeds 92%, significantly higher than the algorithm DTW and TSF. It reaches the classification requirements of Industrial IoT fault diagnosis.

This study investigates the impact of specimen size on the mechanical properties of wood, specifically focusing on compression strength, elastic modulus, and Poisson's ratio. Compression tests were conducted using three different specimen sizes (20mm×20mm×30mm, 40mm×40mm×60mm, 60mm×90mm×90mm) in the longitudinal, radial, and tangential directions. Mechanical parameters, failure mechanisms, load-displacement curves, and stress-strain relationships were systematically analyzed for each size. The study also evaluated the influence of specimen size on the accuracy of finite element numerical simulations by utilizing the obtained mechanical parameters. The results reveal a significant correlation between compressive strength and specimen size, indicating a decrease in compressive strength with increasing specimen size. Conversely, elastic modulus and Poisson's ratio exhibit less sensitivity to variations in specimen size. Notably, parameters derived from small-sized specimens (20mm×20mm×30mm) exhibited substantial errors, while those obtained from medium-sized (40mm×40mm×60mm) and large-sized specimens (60mm×90mm×90mm) demonstrated greater reliability, providing precise results in finite element numerical simulations.

Moisture and thermal are the key factors for influencing methane desorption during CBM exploitation. Using high pressure water injection technology into coalbed, new fractures and pathways are formed to methane transport. It is existed a phenomenon of water inhibiting gas flow. This study is focused on various water pressures impacted on gas adsorbed coal samples, then the desorption capacity could be revealed under different conditions. And the results are shown that methane desorption capacity was decreased with water pressure increased at room temperature and the downtrend would be steady until water pressure was large enough. Heating could promote gas desorption capacity effectively, with the increasing of water injection pressures, the promotion of thermal on desorption became more obvious. These results are expected to provide a clearer understanding of theoretical efficiency of heat water or steam injection into coalbed, they can provide some theoretical and experimental guidance on CBM production and methane control.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Pore structure characterization and fractal analysis have great significance for understanding and evaluating tight limestone reservoirs. In this work, the pore structure of tight limestone is characterized combined with low-temperature nitrogen adsorption (LTNA) and low-field nuclear magnetic resonance (NMR), and the fractal dimension of tight limestone pore structure is discussed based on LTNA and NMR data. The results indicate that the pores of tight limestone have H3 and H4 types, the pore size distribution (PSD) of H3 type is a wave distribution ranging from 2 to 10 nm, and the PSD of H4 type is a unimodal distribution ranging from 2 to 10 nm. The transverse relaxation time (T2) spectrum of tight limestone shows single peak (DF), double peak (SF) and three peak (TF), and the T2 spectrums for micropores, mesopores and macropores range from 0.1 to 10 ms, from 10 to 100 ms, and greater than 100 ms, respectively. The LTNA fractal dimension of tight limestone (DL) ranges between 2.4446 and 2.7688, with an average of 2.5729, and the NMR fractal dimensions of micropores (DNMR1), mesopores (DNMR2) and macropores (DNMR3) are distributed between 0.3744 to 1.1293, 2.4263 to 2.9395 and 2.6582 to 2.9989, respectively. Moreover, there is no correlation between fractal dimension and permeability and porosity, a negative correlation between DL and average pore radius, a positive correlation between DL and specific surface area, and a positive correlation between DNMR2 and DNMR3 and micropore content, while DNMR2 and DNMR3 are negatively correlated with the content of mesopores and macropores.

In the fifth generation communication system, millimeter wave (mmWave) networks will coexist with traditional micro wave (μWave) networks, which allows for higher data transmission rate and better user experience. In this paper, we give a comprehensive framework of mathematical models and analytical methods for multi-tier mmWave and μWave hybrid caching networks based on stochastic geometry. We propose an association strategy by assuming average biased-received power association and Rayleigh fading. Accordingly, by using a D-ball approximating blockage model of mmWave networks, expressions of the cell association probability and the coverage probability of the hybrid networks are derived. Also, we use the average successful delivery probability as the performance metric to analyze the existing caching placement strategies. Simulation results validate the accuracy of our analytical conclusions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In this paper, a new axial-type magnetic gear with auxiliary flux-enhancing structure (AFS-AMG) is proposed. Compared to conventional AFS-AMG, it has the higher torque density and higher permanent magnet (PM) utilization factor. Firstly, the design rules and operating principles of proposed AFS-AMG are elaborated. Then, the mapping relation between the radial-type magnetic gears (RMGs) and AMGs are elucidated. Compared to its counterpart in RMGs, AFS-AMGs achieve small size. Then, the geometrical parameters of AFS-AMGs are optimized to obtain the better electromagnetic performances, where the torque density per volume and per PM volume is adopted as the evaluation standard. Finally, three different AMG topologies are constructed in finite element analysis (FEA) software for comparison. It is proven that the AFS-AMG has the largest torque density per volume and per PM volume.

Euler sums are alternating (or level two) extension of multiple zeta values (MZVs). Kaneko and Tsumura initiated the study of multiple T-values (MTVs), another level two generalization, by restricting the summation indices in the definition of MZVs to a fixed parity pattern. In this paper, we shall study finite MTVs and their alternating versions which are level two and level four variations of finite MZVs, respectively. We conjecture that all finite MZVs are in the Q-span of finite MTVs which in turn apparently lie in the span of finite Euler sums, and the inclusions are both proper. We shall first provide some structural results for Euler sums of small weights, guided by the author's previous conjecture that the finite Euler sum space of weight w is isomorphic to a quotient Euler sum space of weight w. Then, by utilizing some well-known properties of the classical alternating MTVs, we shall derive a few important Q-linear relations among the finite alternating MTVs, including the reversal, linear shuffle and sum relations. We then compute the upper bound for the dimension of the Q-span of weight w finite (alternating) MTVs for w<9, both rigorously using the newly discovered relations and numerically aided by computers.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

With the aging of China's population, the problem of pension security has become more and more prominent, and whether delayed retirement can effectively alleviate the pension fund gap and ensure the sustainability of the pension fund has become the focus of social concern. This study predicts the income and expenditure of urban workers' basic pension insurance fund from 2021 to 2050 by constructing an actuarial model of pension insurance fund income and expenditure, and simulates the effect of delayed retirement policy. The prediction results show that under the existing system, the basic pension insurance fund for urban workers will have a shortfall for the first time in 2027, and the shortfall will expand year by year. Compared with the non-implementation of delayed retirement policy, the simulation of the implementation of delayed retirementt program delayed the emergence of the fund gap until 2029, and the forecast period of the pension fund gap significantly narrowed, indicating that delayed retirement policy has a certain positive impact on alleviating the pressure of pension payments, but delayed retirementt can not completely eliminate the pension fund gap. In view of this, this paper suggests that a progressive and flexible delayed retirement policy should be introduced as soon as possible to better adapt to the needs of different groups. At the same time, differentiated policies should be formulated for different groups of people and a pension incentive mechanism for delayed retirement should be set up to improve public acceptance of delayed retirement policy. In addition, delayed retirement policy should be combined with other measures, such as lowering the corporate contribution rate and enhancing the value-added capacity of the pension fund, so as to ensure the sustainability of the pension fund.

Irrigation is one of key agricultural management practices of crop cultivation in the world. Irrigation practice is traceable on satellite image. Most irrigated area mapping methods were developed based on time series of NDVI or back scatter coefficient within the growing season. However, it found the winter irrigation out of growing season is also dominating in north China. This kind of irrigation aims to increase the soil moisture for coping with spring drought, and also reduce the wind erosion with the wet soil in the field surface as the strong wind happens in spring. This study developed a remote sensing-based classification approach to identify irrigated fields with Radom Forest algorithm out of growing season. The results showed that the mean of the highest accuracies of 7 RF models was 94.9% and the mean of the averaged accuracies of 7 RF models was 94.1%; the overall accuracy for all 7 outputs was in the range of 86.8-92.5%, Kappa in the range of 84.0-91.0% and F-1 score in the range of 82.1-90.1%. These results showed that the classification was acceptable and not over performed as the accuracies of all classified images were lower than the models. This study also found that irrigation started to apply in early November and irrigated fields were increased and suspended in December and January due to freeze. The newly irrigated fields were found again in March and April when the temperature goes up above zero degree. The area of irrigated fields in the study area were increasing over time with sizes of 98.6, 166.9, 208.0, 292.8, 538.0, 623.1, 653.8 km2 from December to April, accounting for 6.1%, 10.4%, 12.9%, 18.2%, 33.4%, 38.7%, and 40.6% of the total irrigatable land in the study area, respectively.

Large terrestrial carnivores play a crucial role in top-down control within terrestrial ecosystems, maintaining ecosystem stability and biodiversity. However, intense interspecific competition often arises among sympatric large carnivores, leading to population reductions or even extinctions. Spatial partitioning through divergent habitat selection helps mitigate such competition. In Xinlong County, Sichuan Province, we used 293 infrared cameras for monitoring from September to May 2016 and March to October 2022. By employing the Generalized Linear Model (GLM) and the Maximum Entropy Model (MaxEnt), we developed an ensemble model predicting the suitable habitat distribution of leopards (Panthera pardus) and wolves (Canis lupus). We analyzed the main environmental factors influencing habitat selection and the fragmentation of suitable habitats. We found that suitable habitat distribution differed significantly between them. Both species preferred areas with gentle slopes close to settlements. While leopards' habitat selection primarily depended on the distance from settlements, the slope was predominant for wolves. Suitable habitats displayed aggregation, yet wolves exhibited higher fragmentation and more complex patch shapes, indicating greater susceptibility to human activities. These results suggest that sympatric large carnivores, such as leopards and wolves, can reduce spatial competition intensity and promote spatial partitioning by selecting divergent suitable habitats, thereby facilitating species coexistence.

The magnetic polarization tensor has a promising capability of determining the geometry and material properties of metallic samples. In this paper, a novel computation method is proposed to estimate the magnetic polarization tensors for the metallic samples using the boundary element method. In this method, the metallic sample is placed in a uniformly distributed magnetic field. Based on assumptions that the excitation frequency and/or the conductivity of the sample is very high, the metallic sample is regarded as a perfect electrical conductor (PEC). Therefore, the scattered field at a certain distance can be simulated. By utilising the boundary element method, the magnetic polarization tensor can be derived from the simulated scattered field. The theoretical calculation is presented and simulations and experiments have been carried out to validate the proposed method. The results from the simulation are matched with the analytical solution for the case of sphere samples. Moreover, there is a good agreement between the simulation results and the experimental results for the copper cylindrical samples.

Earth observation satellites can capture images of specific areas in Earth's orbit based on user requirements. Despite the high demand for satellite imagery, satellites remain a scarce resource. When there are many observation tasks that are large and dense, they may interfere with each other due to satellite mobility. To address this issue, a multi-satellite scheduling algorithm based on a task merging mechanism has been proposed. This paper proposes a two-stage approach to the problem: task merging phase and merging task scheduling phase. The task merging phase introduces two methods based on Mean Shift and Complete Graph to generate the merging task set. In the merging task scheduling phase, a multi-satellite scheduling algorithm based on merging tasks is employed to solve the problem. Finally, certain measurement experiments suggest the effectiveness of the algorithm.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Purpose- This study seeks to investigate the collaboration between Digitalization and traditional manufacturing industry and investigate, how digitalized management brings new chances and challenges of management. Design/methodology/approach – The author designed a content analytical study researching the role of digitalization in traditional manufacturing industries. The article presents a selective but systematical review of recent digitalization trend and digital twin to be applied for innovative management in Industry 4.0 era. Findings– Digitalization is highly correlated with traditional manufactory in Industry 4.0 era. The study brings a new outlook on the next wave of Digitalization and review of associated challenges and opportunities for management and innovation in traditional manufacturing industries. Research limitations/implications – The research focuses on two branches of traditional industries only: machine tools building and metalworking industries. Future research needs to examine other traditional industries. The research is limited to 2 high related traditional manufacturing industries, machine tools and metalworking industry. Practical implications – The study and application of digitalization should be highly recommended and launched in traditional manufacturing industries. Universities, institutes and vocational schools should update, optimize their courses systems according to prediction of future industry. Originality/value – The paper enhances understanding about the collaboration between digitalization and traditional manufacturing industry. This paper analyzes an important issue the digitalization serves traditional industries. It is unique in its broad analysis of the related terms – Digitalization, Machines 4.0, Industry 4.0 and innovative management in Industry 4.0 era.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

This paper studies the mechanism of how China’s state-owned enterprise (SOEs) reform can influences economic growth, and distinguishes the capital efficiency between state-owned and private enterprises. The results show that: 1) the capital allocation efficiency among state-owned enterprises is lower than private enterprise due to an insufficiently released productivity of state-owned enterprises; 2) although with a higher capital allocation efficiency, the improvement of technology progress of private enterprises at a much slower pace compared to its rapidly increasing share in China’s economy. In case of poor allocation with private sector, blindly reforming ownership of state-owned enterprises cannot effectively alleviate the problem of efficiency losses. State-owned enterprise reform can boost economic growth by increasing capital marginal output, improving capital dynamic allocation efficiency, promoting TFP growth and exerting external spillovers on other firms. At present, China is exploring the endogenous power of economic growth, improving the market institutions and promoting the state-owned enterprises reform with positive and steady pace. By properly re-allocation SOEs into the private sector, which has significant influence on improving economic efficiency and promoting sustained economic growth.

Rheumatoid arthritis (RA) is a chronic, systemic, abnormal inflammatory immune response. It is characterized by the involvement of the synovium and multiple organs and the destruction of joints and articular cartilage. Over the past 30 years, several promising novel compounds and antibodies have been developed for the treatment of RA. The introduction of new drugs and precision medicine for all forms of RA raises several issues related to access to novel treatments by patients, optimal regimen selection, cost-effectiveness, prognosis monitoring and outcome surveillance, particularly with regarding to the development of low drug response rates, drug resistance and adverse side effects. Tremendous attention has been given to the identification of optimized drug combinations for the treatment of RA, particularly in early high-risk vulnerable and early individuals. Addressing these issues requires novel therapeutic approaches with new mechanisms and the establishment of accurate guidelines for drug selection, drug recombination, and non-chemical therapeutic efforts. In this study, we reviewed the most exciting recently established or ongoing novel drugs and methods according to the clinical trial database maintained by the United States National Library of Medicine and discussed the trends in RA drug development and challenges in the treatment, providing a reference significant for the accurate treatment of RA and the research direction in the future.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

To address the requirements of sonar imaging, such as high receiving sensitivity, wide bandwidth, wide receiving angle, an AlN PMUT with an optimized ratio of 0.6 for the piezoelectric layer diameter to backside cavity diameter is proposed in this paper. A sample AlN PMUT is designed and fabricated with SOI substrate-based bulk MEMS process. The characterization test result of the sample demonstrates a -6 dB bandwidth of approximately 500 kHz and a measured receiving sensitivity per unit area of at 1.37 V/μPa/mm2, which significantly surpasses the performance of previously reported PMUTs. The -6 dB horizontal angles of the AlN PMUT at 300 kHz and 500 kHz are measured 68.30° and 54.24°, respectively. To achieve an accurate prediction of its characteristics when being packaged and assembled in a receive array, numerical simulations with the consideration of film stress are conducted. The numerical result shows a maximum deviation of ±7% in the underwater receiving sensitivity across the frequency range of 200 kHz to 1000 kHz and a deviation of about 0.33% in the peak of underwater receiving sensitivity comparing to the experimental data. By such good agreement, the simulation method reveals its capability of providing theoretical foundation for enhancing the uniformity of the AlN PMUTs in future studies.

The fluorinated organic compounds have superior physicochemical properties than general organic compounds due to the strong C-F single bond, and widely used in medicine, biology, pesticides, and materials science. In order to gain a deeper understanding of the physicochemical properties of fluorinated organic compounds, fluorinated aromatic compounds have been investigated by various spectroscopic techniques. 2-Fluorobenzonitrile and 3-fluorobenzonitrile are important fine chemical intermediates, and their excited state S1 and cationic ground state D0 vibrational features remain unknown. In this paper, we used two-color resonance two photon ionization (2-color REMPI) and mass analyzed threshold ionization (MATI) spectroscopy to study S1 and D0 states vibrational features of 2-fluorobenzonitrile and 3-fluorobenzonitrile. The precise excitation energy (band origin) and adiabatic ionization energy were determined to be 36028 2 cm-1 and 78650 5 cm-1 for 2-fluorobenzonitrile; and 35989 2 cm-1 and 78873 5 cm-1 for 3-fluorobenzonitrile, respectively. The density functional theory (DFT) at the levels of RB3LYP/aug-cc-pvtz, TD-B3LYP/aug-cc-pvtz, and UB3LYP/aug-cc-pvtz were used to calculate the stable structures and vibrational frequencies for the ground states S0, excited state S1, and cationic ground state D0, respectively. Franck-Condon spectral simulations for transitions of S1 S0 and D0 S1 were performed based on above DFT calculations. The theoretical and experimental results are in good agreement. The observed vibrational features in S1 and D0 states are assigned according to the simulated spectra and the comparison with structurally similar molecules. Several experimental findings and molecular features were discussed in detail.

Porous asphalt (PA) pavement systems with and without a geotextile layer were investigated in laboratory experiments to determine the impacts of the geotextile layer on processes leading to lead ion (Pb2+) removal from stormwater runoff. Two types of geotextile membranes placed separately at upper and lower levels within the PA systems were tested in an artificial rainfall experiment using synthetic rainwater. The effect of storage capacity within the system on Pb2+ removal was also investigated. Results indicated that the use of a geotextile layer resulted in a longer delay to the onset of effluent. The non-woven geotextile membrane placed below the reservoir course improved the Pb2+ removal rate by 20% over removal efficiency of the system using a woven geotextile placed just below the surface but before the choker course. Pb2+ ions were reduced by over 98% in the effluent after being held for 24 hours in reservoir storage. Results suggest that temporary storage of stormwater in the reservoir course of a PA system is essential to improving Pb2+ ion removal capability.

In this paper, I present a comprehensive theoretical framework for understanding surface-enhanced Raman scattering (SERS) measurements in both solution and thin film setups, focusing on electromagnetic enhancement principles. Two prevalent types of SERS substrates found in the literature are investigated: plasmonic colloidal particles, including spherical and spheroid nanoparticles, nanoparticle diameters, and thin-film-based SERS substrates like ultra-thin substrates, bundled nanorods, plasmonic, and porous thin films. The investigation explores the impact of analyte adsorption, orientation, and the polarization of the excitation laser on effective SERS enhancement factors. Notably, it considers the impact of analyte size on the SERS spectrum, by examining scenarios where the analyte is significantly smaller or larger than the hot-spot dimensions. The analysis also incorporates optical attenuations arising from the optical properties of the analyte and the SERS substrates. The findings provide possible explanations for many observations made in SERS measurements, such as variations in relative peak intensities during SERS assessments, reductions in SERS intensity at high analyte concentrations, and the occurrence of significant baseline fluctuations. The study offers valuable guidance for optimizing SERS substrate design, enhancing SERS measurements, and improving the quantification of SERS detection.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Aborycin is a type I lasso peptide with a stable interlocked structure, offering a favorable framework for drug development. The aborycin biosynthetic gene cluster gul from marine sponge-associated Streptomyces sp. HNS054 was cloned and integrated into the chromosome of S. coelicolor hosts with different copies. The 3-copy gul-integration strains S. coelicolor M1346::3gul showed better production than one-copy or 2-copy gul-integration strains, and the total titer reached approximately 10.4 mg/L, i.e., 2.1 times that of the native strain. Then, five regulatory genes, phoU (SCO4228), wblA (SCO3579), SCO1712, orrA (SCO3008) and gntR (SCO1678), which were reported to have negative effects on secondary metabolism, were further knocked out from the M1346::3gul genome by CRISPR/Cas9 technology. While the ΔSCO1712 mutant showed a significant decrease (4.6 mg/L) and the ΔphoU mutant showed no significant improvement (12.1 mg/L) in aborycin production, the ΔwblA, ΔorrA and ΔgntR mutations significantly improved the aborycin titers to approximately 23.6 mg/L, 56.3 mg/L and 48.2 mg/L, respectively, which were among the highest heterologous yields for lasso peptides in both Escherichia coli systems and Streptomyces systems. Thus, this study provided important clues for future studies on enhancing antibiotic production in Streptomyces systems.