Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

There have been several cases of large-scale wind generators (WGs) tripping off caused by untimely fault removing in recent years. Currently, the discoordination between the box-type transformer fuse protection (BTFP) and two-section collecting line current protection (CLCP) brings a security risk to wind farm. In order to ensure the selectivity, the first section (Sec-I) CLCP should be set a enough interval that is longer than the fuse melting time, and another interval is set for the Sec-II CLCP, which weakens the speed of the CLCP. When a fault occurs on the collecting line, there is no doubt that WGs cannot work too long in abnormal operation, which may cause WGs to be placed off the grid. For a power system with high penetration of wind power, large-scale WGs tripping off will cause a great power shortage, and affect the stability of the power system. The selectivity and sensitivity of the CLCP is analyzed in detail to make the CLCP speed better. Considering the fault ride-through ability of WGs, the fault clear time is an important factor to lead to large-scale WGs tripping off. Two main works are done in this paper. The first is to accelerate the speed of the Sec-I CLCP though reducing the protection zone. Another one is introduce the risk assessment module into the CLCP, which not only improve the speed of the CLCP but also ensure the safety of the wind farm during faults. According to the deference in trip-off causes of WGs, the matching functions are created to assess the trip-off risk of WGs on the spot. In the case of fault, the trip-off risk indicators of WGs are timely updated to data sharing center and open to the CLCPs. The set of risk indicators is divided into several subsets according to the risk range. The dynamic changes of the subsets during fault help to improved CLCP scheme. This scheme can accelerate protection speed based on the increasing risk of large-scale WGs tripping off in wind farms. Compared with traditional CLCP, this approach can make the CLCP combines selectivity and speed better based on the analysis of the ride- through ability of WGs.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

Cisplatin-based chemotherapy has long been viewed as the first-line chemotherapy for advanced and metastatic urothelial carcinoma (UC). However, many patients with UC have been classified as “cisplatin-ineligible patient”, which requires alternative chemotherapy due to their poor responses. In fact, vast majority of those who initially responded to cisplatin-based chemotherapy eventually progressed. Understanding of UC tumor immunology provided an immunopathogenic bases for immune checkpoint inhibitors, targeting PD-1 and CTLA-4, to treat cisplatin ineligible metastatic UC and patients with platinum-refractory metastatic UC. In 2020, data from the trail further showed that PD-L1 inhibitors benefit prolonged survival and progression-free survival as maintenance therapy. Besides immune-targeting therapies, manipulation of tumor microenvironment via metabolic pathways alternation, such as inhibiting tumor glycolysis, lactate accumulation and exogenous glutamine uptake, has been investigated in the past few years. In this comprehensive review, we started by introducing traditional chemotherapy of UC, and summarized current evidences supporting the use of immune checkpoint inhibitors and highlighted ongoing clinical trials. Lastly, we reviewed the tumor metabolic characteristic and the anti-tumor treatments targeting metabolic pathways.

The changing of land use and land cover (LULC) are both affected by climate and human activity and affect climate, biological diversity, and human well-being. Accurate and timely information about the LULC pattern and change is crucial for land management decision-making, ecosystem monitoring, and urban planning, especially in developing economies undergoing industrialization, urbanization, and globalization. Biodiversity degradation and urban expansion in eastern China are research hot-spots. However, the influence of LULC changes on the region remains largely unexplored. Here, an object-based and multi-temporal image analysis approach was developed to detect how LULC changes during 1985-2015 in the Tiaoxi watershed (Zhejiang province, eastern China) using Landsat TM and OLI data. The main objective of this study is to improve the accuracy of unsupervised change detection from object-based and multi-temporal images. To this end, a total of seven LULC maps are generated with multi-temporal images. A random stratified sample design was used for assessing change detection accuracy. The proposed method achieved an overall accuracy of 91.86%, 92.14%, 92.00%, and 93.86% for 2000, 2005, 2010, and 2015, respectively. Nevertheless, the proposed method, in conjunction with object-oriented and multi-temporal satellite images, offers a robust and flexible approach to LULC changes mapping that helps with emergency response and government management. Urbanization and agriculture efficiency are the main reasons for LULC changes in the region. We anticipate that this freely available data will improve the modeling for surface forcing, provide evidence of changes in LULC, and inform water-management decision-making.

As the core of intelligent manufacturing, CPS has serious security issues, especially for the communication security of its terminal M2M. In this paper, blockchain technology is introduced to address such a security problem of communications between different types of machines in CPS. According to the principles of blockchain technology, we design a blockchain for secure M2M communications. As a communication system of M2M consists of public network areas, equipment areas and private areas, we design a sophisticated blockchain structure between the public area and private area. For validating our design, we take cotton spinning production as a case study to demonstrate our solution to M2M communication problems under the CPS framework.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Recently, light traps using light-emitting diode (LED) lights have been applied to monitor or control insect pests. The oriental armyworm, Mythimna separata Walker, is an important insect pest that has caused damage to several cereal crops, including corn, wheat and rice. The present study aims to seek out a sensitive wavelength causing high phototactic response in M. separata. The study evaluated the phototactic responses of M. separata moths to several LED lights of different wavelengths and luminance intensities under laboratory condition. Results showed that green (520 nm) LED light resulted in significant phototactic response of M. separata moths compared to LED lights of other wavelengths. Additionally, the highest attraction rate of the moths to green LED light appeared in luminance intensity group of 200 lux compared to the other intensities groups. Experiments under optimum conditions based on the above experiments revealed that the green LED light exhibited the strongest attraction rate (64.44%) among all experimental groups. An experiment performed in a net cage also showed that green LED light resulted in the highest phototactic response of M. separata moths, 1.7 times more than a commercial black light used as control. These findings clearly demonstrate that M. separata moths have a high sensitivity to the green LED light. Therefore, a light trap equipped with green LED light could be useful for monitoring and controlling M. separata moths.

A phenomenological constitutive model is developed to describe the uniaxial transformation ratcheting behaviors of super–elastic shape memory alloy (SMA) by employing a cosine–type phase transformation equation with the initial martensite evolution coefficient that can capture the feature of the predictive residual martensite accumulation evolution and the nonlinear hysteresis loop on a finite element (FE) analysis framework. The effect of the applied loading level on transformation ratcheting are considered in the proposed model. The evolutions of transformation ratcheting and transformation stresses are constructed as the function of the accumulated residual martensite volume fraction. The FE implementation of the proposed model is carried out for the numerical analysis of transformation ratcheting of the SMA bar element. The integration algorithm and the expression of consistent tangent modulus are deduced in a new form for the forward and reverse transformation. The numerical results are compared with those of existing model and the experimental results to show the validity of the proposed model and its FE implementation in transformation ratcheting. Finally, a FE modeling is established for a repeated preload analysis of SMA bolted joint

The transition region is a very thin but most peculiar layer in the solar atmosphere, located between the solar chromosphere and the corona. It is a key region for understanding the coronal heating, the solar eruptions triggering, and the origin of solar winds. Here, the gradients of all physical parameters are very high, including plasma density, ionization degree, temperature, and magnetic fields, etc. Therefore, the transition region should be highly dynamic, such as fast energy releasing and transporting, plasma heating, and even particle accelerating. They include two physical aspects: thermal and non-thermal processes. The thermal processes can be observed from the ultraviolet (UV) and extreme ultraviolet (EUV) emission by multi-wavelength images. The non-thermal processes, however, should be related to radio emissions especially at millimeter wavelengths, and the frequency range should span from several GHz to beyond 300 GHz, and the emission mechanism should be highly related to the magnetic fields and variations. The ultra-wide broadband spectral observations at millimeter wavelengths with high spectral resolutions may provide rich dynamic information about the transition region, such as non-thermal energy release and transmission, the flows of plasma and energetic particles, the magnetic fields and their variations, the generation and transportation of various waves, and the formation and evolution of the source regions of solar eruptions. Here, we discussed the spectral characteristics of millimeter-wave emission from the transition region and proposed a new conception of ultra-wide broadband millimeter-wave spectrometers to observe them.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Objective: To explore the hot spots and development trends of community public health research. Methods: The literature related to this topic was searched in CNKI and PubMed databases, and the trend map of the number of articles was drawn according to the obtained data. The included literature were analyzed with Vosviewer software for keyword and author co-occurrence, and CiteSpace 6.3.R1 Basic software was used for mechanism co-occurrence, key emergence and clustering analysis, and timeline distribution map drawing. Results: 189 Chinese literature and 77 English literature were selected. The Chinese literature focused on “community public health service, emergency management, and community governance”, and the research trend was “community public health emergency management and community governance”; English literature focuses on “nursing education, health education, human qualitative research”. Conclusion: Although the Chinese and English literature shows that scholars in this field have different emphases, the primary community health is the key and difficult point to realize the national public health service project, and improving the basic public health service in the primary community is related to the health of all the people, so it is very important.

Poor interlaminar fracture toughness has been a major issue in glass fiber-reinforced epoxy resin (GF/EP) laminate composites. In this paper, soft carboxy-terminated liquid nitrile (CTBN) rubber particles and rigid nano-SiO2 are used to toughen the epoxy resin (EP) matrix to improve the interlayer properties of GF/EP laminate composites. The effects of adding two toughening agents on the mechanical and interlayer properties of GF/EP laminates were studied. The results showed that adding the two kinds of particles improved the mechanical properties of the epoxy matrix. When the additional amount of flexible CTBN rubber particles was 8wt%, and the rigid nano SiO2 was 0.5wt%, the fracture toughness of the matrix resin was increased by 215.8%, and the tensile strength was only decreased by 2.3% compared with the pure epoxy resin. On this basis, the effects of two kinds of particles on the interlayer properties of GF/EP composites were studied. Compared with the unmodified GF/EP laminates, the interlayer shear strength and mode Ⅰ interlayer fracture toughness is significantly improved by toughening agent, and the energy release rate GIC of interlayer shear strength and interlayer fracture toughness is increased by 109.2%, and 86.8%, respectively.

Malignancy is a fatal disease with an increasing incidence with each passing year, and the early diagnosis of malignancy can significantly improve the cure rate of patients, which has profound implications for saving patients' lives. The changes of miRNA are closely related to the occurrence of malignant tumors. The expression of miRNA in many malignant tumors is obviously different and unique from that in normal tissues. In this study, a strategy for amplifying microRNA (miRNA) signal was designed using duplex specific nuclease (DSN), which was then combined with Peptide nucleic acid (PNA) probe hybridization technology to prepare a sensitive and efficient paper-based lateral flow biosensor (LFB) for the detection of pancreatic cancer (PC) associated microRNA-10b. The performance evaluation results of the LFB showed that the detection limit of miR-NA-10b is 5 nM/mL, and carries demonstrated well specificity, stability, reproducibility. The biosensor prepared in this paper can provide accurate and rapid detection of miRNA-10b. The detection results play a guiding role in the early diagnosis of PC. Meeting the clinical need for largescale screening of individuals at high risk of PC. Providing new avenues to achieve early mass screening in individuals at high risk of PC.

Lead-free copper halide perovskite nanocrystals (NCs) are emerging materials with excellent photoelectric properties. Herein, we present a colloidal synthesis route of orthorhombic Cs2CuCl4 NCs with well-defined cubic shape and an average diameter of 24 ± 2.1 nm. The Cs2CuCl4 NCs exhibit bright deep blue photoluminescence, which is attributed to the Cu(II) defects. In addition, passivating the Cs2CuCl4 NCs by Ag+ can effectively improve the photoluminescence quantum yield (PLQY) and environmental stability.

Permeability has an important effect on drug absorption. In this study, the effect of different concentrations of sodium sulfobutyl ether-β-cyclodextrin (SBE-β-CD) on the absorption of ranitidine was investigated to examine the mechanism of permeability changes. The results of parallel artificial membrane permeability assay (PAMPA) showed that increasing the concentration of sodium sulfobutyl ether-β-cyclodextrin, 0, 0.12% (w/v), 0.36% (w/v) and 3.6% (w/v), respectively, the apparent permeability coefficient of ranitidine decreased to 4.62×10-5 , 4.5×10-5 , 3.61×10-5 and 1.08×10-5 in Caco-2 cells, respectively. The same results were obtained from oral pharmacokinetic study in rats; Further studies indicated that SBE-β-CD significantly increased the zeta potential of ranitidine. SBE-β-CD interacted with ranitidine charges to form a complex that reduced ranitidine permeability, and SBE-β-CD should be chosen with caution for drugs with poor permeability.

This research aims to explore the integration method of deep learning and large language models in speech recognition to improve the system’s recognition accuracy and ability to handle complex contexts. Deep neural network (DNN), convolutional neural network (CNN), long short-term memory network (LSTM) and Transformer-based large language model are used to build an integrated acoustic and language model framework. Experiments on TIMIT, LibriSpeech and Common Voice datasets show that the ensemble model shows significant improvements in both word error rate (WER) and real-time factor (RTF) compared to traditional models. Especially in terms of adaptability to multiple languages and accent changes, the model shows superior performance. The conclusion shows that through technology integration, the performance of the speech recognition system in complex environments can be effectively improved, providing a new direction for the future development of speech recognition technology.

Cyclin E2, a member of the cyclin family, is a key cell cycle-related protein. This protein plays essential roles in cancer progression, and as such, an inhibitor of cyclin E2 has been approved to treat several types of cancers. Even so, mechanisms underlying how to regulate cyclin E2 expression in cancer remain largely unknown. The current study found that miR-3687 is up-regulated in clinical bladder cancer (BC) tumor tissues, TCGA database and human BC cell lines. Inhibition of miR-3687 expression significantly reduces human BC cell proliferation in vitro and tumor growth in vivo, which are concurrently with the induction of G0/G1 cell cycle arrest and downregulation of cyclin E2 protein expression. Interestingly, overexpression of cyclin E2 reversed the inhibition of BC proliferation induced by miR-3687. Mechanistic studies suggest that miR-3687 could bind to the 3'-UTR of foxp1 mRNA, downregulates FOXP1 protein expression, and in turn promotes the transcription of cyclin E2, thereby promoting the growth of BC cells. Collectively, the current study not only establishes a novel regulatory axis of miR-3687/FOXP1 in regard to regulation of cyclin E2 expression in BC cells, but also provides strong suggestive evidence that miR-3687 and FOXP1 may be potentially promising targets in therapeutic strategies of human BC.

Effective biomarkers are essential to the early diagnosis of non-small cell lung cancer (NSCLC). Herein, a retrospective study of 49 newly diagnosed and recurrent NSCLC patients, 31 patients with benign pulmonary disease and 24 healthy volunteers was conducted, to evaluate the diagnostic value of circulating rare cells for NSCLC. The expression of circulating tumor cells (CTCs) and circulating tumor-derived endothelial cells (CTECs) in peripheral blood were measured by subtraction enrichment-immunostaining-fluorescence in situ hybridization (SE-iFISH). The level of CTCs (P＜0.001) and CTECs (P＜0.001) was significantly higher in NSCLC group than that in benign pulmonary disease group. The proportion of small CTCs (P＜0.001) and CTECs (P＜0.0001) significantly increased from benign lung disease individuals to NSCLC patients. The AUC of ROC curves of total CTCs and CTECs were 0.815 (95%CI: 0.722~0.907), 0.739 (95%CI: 0.618~0.860), respectively. The cut-off values for discriminating NSCLC with benign lung disease patients were total CTCs 11.5 units/6ml and total CTECs 10.5 units/6ml, with sensitivity and specificity being 67.3% and 83.9%, 77.6% and 77.4%, respectively. When CTCs and CTECs were combined, predictive value significantly increased to 82.6% as measured by the area under the curve. Small CTCs and triploid CTCs had high positive predictive value (PPV) and positive likelihood ratio (LR+) of the diagnosis of NSCLC in early stage. CTCs and CTECs can not only be used as new biomarkers for the diagnosis of NSCLC, but can also improve diagnostic performance of the early stage NSCLC. Moreover, the combined examination of CTCs and CTECs is be superior to the single.

MicroRNAs (miRNAs) play a pivotal role in important biological processes by regulating posttranscriptional gene expression and exhibit differential expression patterns during development, immune responses, and stress challenges. The diamondback moth causes significant economic damage to crops worldwide. Despite substantial advancements in understanding the molecular biology of this pest, our knowledge regarding the role of miRNAs in regulating key immunity-related genes remains limited. In this study, we leveraged whole transcriptome resequencing data from P. xylostella infected with Metarhizium anisopliae to identify specific miRNAs targeting the prophenoloxidase-activating protease1 (PAP1) gene through bioinformatic analysis. Seven miRNAs (pxy-miR-375-5p, pxy-miR-4448-3p, pxy-miR-279a-3p, pxy-miR-3286-3p, pxy-miR-965-5p, pxy-miR-8799-3p and pxy-miR-14b-5p) were identified and validated. Luciferase reporter assays confirmed that pxy-miR-279a-3p binds to the open reading frame (ORF) and pxy-miR-965-5p to the 3’ untranslated region (3’ UTR) of PAP1. Our experiments demonstrated that injecting a pxy-miR-965-5p mimic significantly reduced PAP1 expression in P. xylostella larvae, suppressing PO activity and increasing larval mortality rate. Conversely, the injection of inhibitors obtained opposite results. Furthermore, we identified four LncRNAs (MSTRG.32910.1, MSTRG.7100.1, MSTRG.6802.1, and MSTRG.22113.1) that potentially interact with pxy-miR-965-5p. Interference assays using antisense oligonucleotides (ASO) revealed that silencing MSTRG.7100.1 and MSTRG.22113.1 increased the expression of pxy-miR-965-5p. These findings shed light on the potential role of pxy-miR-965-5p in the immune response of P. xylostella to M. anisopliae infection and provide a theoretical basis for biological control strategies targeting the immune system of this pest.

Eurotium is the teleomorph genus associated with section Aspergillus. Eurotium comprises approximately 20 species, which are widely distributed in nature and human environments. Eurotium is usually the key microorganism for the ferment ation of traditional food, such as Fuzhuan brick tea, Liupao tea, Meju, and Karebushi, thus Eurotium is an important fungus in food industry. Eurotium has been extensively studied because they contain a series of interesting, structurally diverse, and biologically important secondary metabolites, including anthraquinones, benzaldehyde derivatives, and indol diketopiperazine alkaloids. These secondary metabolites have shown multiple biological activities, including antioxidative, antimicrobial, cytotoxic, antitumor, insecticidal, antimalarial, and anti-inflammatory activities. This study presents an up-to-date review of the phytochemistry and biological activities of all Eurotium species. This review will provide the recent advances on the secondary metabolites and their bioactivities in genus Eurotium for the first time and serve as a database for future research and drug development from the genus Eurotium.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

This paper discovers that current variational principle and Noether theorem for different physics systems with (in)finite freedom systems have missed the double extremum processes of the general extremum functional that both is deduced by variational principle and is necessarily taken in deducing all the physics laws, but these have not been corrected for over a century since Noether's proposing her famous theorem, which result in the crisis deducing relevant mathematical laws and all physics laws. This paper discovers there is the hidden logic cycle that one assumes Euler-Lagrange equations, and then he finally deduces Euler-Lagrange equations via the equivalent relation in the whole processes in all relevant current references. This paper corrects the current key mistakes that when physics systems choose the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current articles, reviews and (text)books. The real physics should be after choosing the variational extreme values of physics systems, the general extremum functional of the physics systems needs to further choose the minimum absolute extremum zero of the general extremum functional, otherwise, the appearing processes of physics systems are still virtual processes. Using the double extremum processes of the general extremum functionals, the crisis and the hidden logic cycle in current variational principle and current Noether theorem are solved. Furthermore, the new mathematical and physical double extremum processes and their new mathematical pictures and physics for (in)finite freedom systems are discovered. This paper gives both general variational principle and general Noether theorem as well as their classical and quantum new physics, which would rewrite all relevant current different branches of science, as key tools of studying and processing them.

Developing and utilising of underground space is an vital direction for urban growth. Underground commercial streets, as a significant component of underground space accommodating extensive human social activities, and consequently necessitate the creation of human-scale spaces. In the evolution of urban design development towards greater refinement, applying architectural theories and excessively subjective designs has resulted in a deficiency of human-centered design and a disordered spatial environment. This study merges environmental psychology and architectural theory to determine the appropriate length of spatial scale. Two experiments focusing on spatial perception evaluation were conducted using a virtual experimental platform that featured varying dimensions of spatial scale combinations. These quantified combinations were correlated with perception evaluation, and regression analysis was employed to identify appropriate scale ranges, which were superimposed on the range of length selection. Finally, the optimal length and scale combination for underground commercial street spaces were established, providing a reference for the human-centered design of these environments.

This paper discovers that current canonical variational principle and canonical Noether theorem of (in)finite freedom systems for different physics systems have neglected doublet extreme value processes of the general extreme value functional that both is derived by variational principle and is necessarily be taken in deriving all ( quantum ) physics laws in phase space, but which have not been done for over one century since Noether's showing her distinguished theorem, which lead to the crisis deriving all (quantum) physics laws (necessary) in phase space. We discover there is the hidden logic cycle that people assume canonical equations, and then they finally deduce canonical equations by the equivalent relation in the whole processes in all current references. We correct the current key mistake concepts that when physics systems take the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current references. The real physics should be what after taking the physics systems' variational extreme values, the physics systems' general extremum functional needs to further take the general extremum functional's minimum absolute extremum zero, otherwise, the appearing processes of physics systems still are virtual processes. Conservation current equations and conservation currents, in phase space, of general canonical variational principle and general canonical Noether theorem are, respectively, deduced for the first time. Using the general extremum functionals' doublet extreme value processes, the hidden logic cycle and the crisis in current canonical variational principle and current canonical Noether theorem are solved. Consequently, the new mathematical pictures, classical and quantum new physics in phase space and the new mathematical and physical doublet extremum processes for (in)finite freedom systems are discovered. General canonical variational principle and general canonical Noether theorem naturally are given, which would rewrite all the different sciences in phase space, as key tools of studying and dealing with them.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The exceptional performance advantages of the fiber optic gyroscope (FOG) position it as a dominant player in middle and high-end inertial navigation systems. To prevent the loss of sensor precision caused by algorithm design and simplify the complex modeling strategy in traditional methods. We gradually demonstrate the significant role of Convolutional Neural Network (CNN) in the navigation system based on FOG, and utilize the particle swarm optimization algorithm (PSO) to expedite the convergence of the network. The experimental results demonstrate that the initial alignment method based on deep learning is more accurate than the traditional method. The attitude angle error is reduced by 81.25%, 92.54% and 36.53% respectively. The research provides support for the future application of deep learning in optical navigation systems.

The reduction in rheological parameters and dissolution rate of precursors in geopolymer coatings during early hydration significantly contributes to sagging. This study aims to improve the sag resistance of these coatings by incorporating diatomite filler. Rheological testing was conducted to assess the impact of diatomite and its concentration on yield stress, plastic viscosity, and thixotropy of the geopolymer coatings. The results indicated that diatomite's large specific surface area and high reactivity have a significant influence on the rheological parameters and early dissolution rate of precursors. With a diatomite concentration of 1.1%, the coating exhibited a yield stress of 2.749 Pa and a plastic viscosity of 0.921 Pa·s, maintaining stability, homogeneity, and no sagging at a thickness of 600 μm. Furthermore, the highly active SiO2 in diatomite participates in the secondary hydration reaction of the geopolymer materials, leading to the formation of substantial C-(A)-S-H gel. This gel enhances internal interconnectivity within the coating, thereby improving its rheological and mechanical properties.

The Yixian Formation (Lower Cretaceous) of China is famous worldwide for its fossils of early angio-sperms, but there is only one record of flower bud hitherto. A previous fossil record of flower bud just showed the appearance and lacked any internal details. Such a lacuna in knowledge of flower buds hin-ders our understanding of the evolution of flowers. Our new specimen was collected from an outcrop of the Yixian Formation (the Barremian-Aptian, Lower Cretaceous) near Dawangzhangzi, Lingyuan, Liao-ning, China. The specimen was observed and photographed using a Sony ILCE-7 digital camera and a Nikon SMZ1500 stereomicroscope, and details were observed using a TESCAN MAIA3 SEM. Our ob-servations document a fossil flower bud, Archaebuda cretaca sp. nov, from the Lower Cretaceous of China. The occurrence of two species of Archaebuda in the Yixian Formation not only confirms the ex-istence of the expected gynoecium (and possible androecium) in a flower bud, but also underscores the occurrence of typical flowers in the Early Cretaceous.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

This paper gives both a general canonical quantum gravity theory and the general canonical quantum gravity theories of the Universe and general black hole, and discovers the relations reflecting symmetric properties of the standard nonlinear gravitational Lagrangian, which are not relevant to any concrete metric models. This paper concretely shows the general commutation relations of the general gravitational field operators and their zeroth, first, second and third style, respectively, of high order canonical momentum operators for the general nonlinear system of the standard gravitational Lagrangian, and then has finished all the four styles of the canonical quantization of the standard gravity.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Due to the impacts from climate change, the allocation of water resources must urgently be optimized worldwide to ensure that the needs of both water managers and farmers are balanced. In this study, manager-oriented and farmer-oriented assessment models were developed for irrigation water optimization and allocation. The distance from water sources and hydraulic head were the main factors in the manager-oriented assessment model; crop value, water demand of crops, and soil type were additional factors in the farmer-oriented assessment model. The developed assessment models were used to assess irrigation water allocation in five villages in Neimen District. Cadasters at high elevation were discovered to not be suitable for cultivation of crops because of the difficulties in constructing irrigation facilities and the loss of irrigation water during transportation. The result obtained from the manager-oriented assessment system was related to the costs involved in the construction and maintenance of irrigation facilities, which indicated that cadasters located at long distances from water sources and at high elevation are unsuitable for cultivation. By contrast, the result obtained from the farmer-oriented assessment system was related to the profits of farmers and revealed that more cadasters would be suitable for cultivation if suitable crops were chosen.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

This paper gives solutions to puzzles of double Wheeler’s delayed choice experiments, a photon’s passing two paths simultaneously and wave collapse velocity measure, and shows new quantum control, new quantum oscillation and new controlling photon oscillator (that can be arranged in quantum computer and quantum network as their classical correspondences) in experiments. Furthermore, this paper obtains the measured attractive state and the new useful key technology of altering state’s evolving paths for quantum systems. We discover the reason and the technological way for the present changes the past, further show their feasible experiments of new quantum control, new quantum oscillation and new quantum oscillator. Finally, this paper achieves the collapse response time t of wave, further concretely deduces the measured collapse velocity of quantum system. In the past, the collapse velocity cannot be objectively deduced and experimentally measured.

Strong-aroma Baijiu is a traditional Chinese spirit distilled from grains that undergo solid-state fermentation. At the end of each fermentation cycle, a significant quantity of Huangshui accumulates at the bottom of the fermentation pit, constituting one of the primary by-products in the brewing process of strong-flavor liquor. In this report, the chemical component analysis of Huangshui obtained from a strong-flavor liquor factory revealed a diverse array of organic acids, alcohols, esters, starch, reducing sugars, amino acids, and other compounds present in Huangshui. Additionally, two specialized solid-state fermentation models were developed to investigate the formation process of Huangshui. Our findings demonstrate a positive correlation between the yield of Huangshui and the initial moisture content of fermented grains. It is concluded that Huangshui is the percolate produced during the solid-state brewing process of strong-flavor liquor, with its water content originating from the initial moisture of fermented grains.

This paper uncovers that quantum uncertain principle makes the single particle with global property have no certain path, and then wave of quantum particle can simultaneously do pass the double slits. The two subwaves after passing Young’s double slits are entanglement, they may form interference of subwaves. Consequently, we find a kind of quantum probabilistic entanglements with Wheeler's delayed choice. Quantum particles such as photons, electrons, neutrons, protons etc mean that wave of the quantum particle can simultaneously do pass through Young's double slits, rather than individual quantum particle may pass through Young's double slits at the same time. When considering wave property, we cannot consider particle property (Just as in the photoelectric effect, considering the particle nature of the system, people cannot consider wave property, otherwise the photoelectric effect cannot appear). Therefore, this paper discovers that the ability of single photon to hit electrons out in photoelectric effect is complementarily equivalent to the ability of wave of the single photon to simultaneously pass through Young's double slits in wave-particle duality. Objective criteria for distinguishing classical and quantum particles are discovered and objectively give the applicable realm of quantum mechanics for the first time. The crisis of the single particle’s simultaneously passing through Young's double slits, which has been plaguing physicists in the whole world up to now for decades, is solved, in which the studies are classified as classical and quantum particles, the classical particle and quantum particle wave cannot and can pass the Young’s slits, respectively. This paper discovers both the new physics mechanism of passing the double slits of the wave with the amplitude of 4-dimensional momentum representation wave function reflecting particle nature and the principle of self-adaptive emergence of wave-particle duality, and then using the principle, this paper gives both direct explanations to the current experiments and new predictions of new some experiments for wave-particle duality. All the deduced results here are consistent with all relevant physics experiments.

Density distribution function of classical statistical mechanics is generally generalized as a product of a general complex function and its complex Hermitian conjugate function, and the average of classical statistical mechanics is generalized as the average of the quantum mechanics. Furthermore, this paper derives three ones of the five axiom presumptions of quantum mechanics, e.g., deduces Schrȍdinger equation by two general ways, makes the three axiom presumptions into three theorems of quantum mechanics, not only solves the crisis to hard understand, but also gets new theories and new discoveries, e.g., this paper solves the crisis of the origin of the wave-particle duality, derives operators, eigenvalues and eigenstates, deduces commutation relations for coordinate and momentum as well as the time and energy, and discovers quantum mechanics is just a generalization ( mechanics ) theory of the complex square root of ( real density function of ) classical statistical mechanics. Quantum mechanics being just a generalization theory of the complex square root of classical statistical mechanics is both new physics and revolutionary discovery, which are affecting people’s deep philosophical thinking for modern physics development, solve all the crisises of quantum mechanics, quantum information and so on, and make quantum mechanics have scientific solid bases being checked and both no basic axiom presumption and no all the quantum strange incomprehensible properties, because classical statistical mechanics and the complex square root of classical statistical mechanics have the scientific solid bases being checked. In addition, this paper discovers the reason no taking the time derivative of space coordinates in Schrȍdinger equation. Therefore, this paper gives solution to the crisis of the first quantization origin, and mainly deduces quantum physics no all the quantum current strange incomprehensible properties.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

This paper proposed an optimal tracking control scheme through adaptive dynamic programming(ADP) for a class of partially unknown discrete-time nonlinear systems based on radial basis function neural network(RBF-NN). In order to acquire the unknown system dynamics, we use two RBF-NNs, the one is used to construct the identifier, and the another is used to directly approximate the steady-state control input, where a novel adaptive law is proposed to update neural network weights. While the optimal feedback control and the cost function are derived via feedforward neural networks approximating, it is proposed to regulate the tracking error, the critic network and the actor network are then trained online to obtain the solution of the associated Hamilton–Jacobi–Bellman (HJB) equation being built under the ADP framework. Simulations verify the effectiveness of the optimal tracking control technique using the neural networks.

This paper derives measurement and identical principles, then makes the two principles into measurement and identical theorems of quantum mechanics, plus the three theorems derived earlier, we deduce the axiom system of current quantum mechanics, the general quantum theory no axiom presumptions not only solves the crisis to understand in current quantum mechanics, but also obtains new discoveries, e.g., discovers the velocities of quantum collapse and entanglement are instantaneously infinitely large. We deduce the general Schrȍdinger equation of any n particles from two aspects, and the wave function not only has particle properties of the complex square root state vector of the classical probability density of any n particles, but also has the plane wave properties of any n particles. Thus, the current crisis of the dispute about the origin of wave- particle duality of any n microscopic particles is solved. We display the classical locality and quantum non-locality for any n particle system, show entanglement origins, and discover not only any n-particle wave function system has the original, superposition and across entanglements, but also the entanglements are of interactions preserving conservation or correlation, three kinds of entanglements directly give lots of entanglement sources. This paper discovers, one of two pillars of modern physics, quantum mechanics of any n particle system is a generalization ( mechanics ) theory of the complex square root ( of real density function ) of classical statistical mechanics, any n particle system’s quantum mechanics of being just a generalization theory of the complex square root of classical statistical mechanics is both a revolutionary discovery and key new physics, which are influencing people’s philosophical thinking for modern physics, solve all the crisises in current quantum theories, quantum information and so on, and make quantum theory have scientific solid foundations checked, no basic axiom presumption and no all quantum strange incomprehensible properties, because classical statistical mechanics and its complex square root have scientific solid foundations checked. Thus, all current studies on various entanglements and their uses to quantum computer, quantum information and so on must be further updated and classified by the new entanglements. This and our early papers derive quantum physics, solve all crisises of basses of quantum mechanics, e.g., wave-particle duality & the first quantization origins, quantum nonlocality, entanglement origins & classifications, wave collapse and so on.Key words: quantum mechanics, operator, basic presumptions, wave-particle duality, principle of measurement, identical principle, superposition principle of states, entanglement origin, quantum communication, wave collapse, classical statistical mechanics, classical mechanics

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Objective: Daratumumab (Dara) is the first-in-class human-specific anti-CD38 mAb approved for treating multiple myeloma (MM). However, DARA-induced depletion of CD38high natural killer (NK) cells results in crippled antibody-dependent cellular cytotoxicity (ADCC), which limits its clinical detection and prediction for Dara efficacy. Therefore, we aimed to explore new NK subsets that could predict Dara efficacy and the underlying mechanism in Dara development. Methods: Multicolour spectral flow cytometry monitored changes in the immune cells of 13 paired RRMM patients. We used machine learning-driven clustering, FlowSOM (Flow Self-Organizing Maps), and dimensional reduction with tSNE (t-distributed Stochastic Neighbour Embedding) to identify unique cell populations pre- and posttreatment. Then, in vitro, fratricide and proliferation assays were performed to explore the function of new NK subsets against MM under Dara treatment. Results: The NK cells were divided into 25 subsets, among which we found that the percentages of KIR-NKP46+ NK cells decreased in paired RRMM patients compared to healthy controls but increased significantly post-Dara treatment. The fold change in KIR-NKP46+ after one dose of Dara treatment can predict whether the best response could be achieved within one month (ROC=0.86, p=0.011). Further in vitro experiments showed that KIR-NKP46+ NK cells are superior to KIR+ NK cells, cooperatively acting with daratumumab to sustainably eradicate MM cells. Meanwhile, apoptosis was significantly decreased, and the proliferation ability was relatively increased post-Dara treatment. Conclusion: In conclusion, the fold change in KIR-NKP46+ NK cell subsets after one dose of Dara treatment can predict the outcome of the curative effect, indicating a putative role of KIR-NKP46+ subsets against MM cells. The mechanism attributed to a relative expansion of the subset due to decreased apoptosis and increased proliferation ability.

Hydro generator sets serve as the peak and frequency regulation of the power system,and play a very important role in maintaining system stability and improving power quality.Based on the internal characteristics model of a specific type of hydro generator,this paper constructs a hydroelectric coupling model for hydropower units,studies the influence of the regulation system of hydropower units on low-frequency oscillations under different load conditions,and adopts variable speed reaching law and fuzzy sliding mode control strategy to improve the regulation quality of the system and ensure the stable operation of the units.Results of simulation and water turbine set under different load conditions show that varible speed reaching law can effectively improve the power-angle oscillation behavior of the hydropower set and suppress the occurrence of low-frequency oscillations of the system when the system is subject to power disturbance,which provide a new theoretical basis and solution for the vibration analysis and control optimization of hydraulic turbine units.

This research focuses on the Hopf bifurcation occurring at a singular point with high-order degeneracy in a class of three-dimensional systems. Based on center manifold theorem, by expanding the technique for determining singular point values of degenerate singularities in two-dimensional systems, the formal series method to determine the singular point values at the high-order degenerate critical point is discussed. Furthermore, a class of specific three-dimensional differential systems with high-order degenerate singularities is explored. By computing the singular point values and determining center conditions, we proved that a minimum of 5 small-amplitude limit cycles in the vicinity of the origin. This research provides new perspectives on the center problem and limit cycle bifurcation in high-dimensional systems with high-order degenerate singular points.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

As a fundamental, overall, and strategic issue facing human society, human migration is a key factor affecting the development of countries and cities given constantly changing population numbers. The fuzziness of the spatiotemporal attributes of human migration limits the pool of open-source data for human migration prediction, leading to a relative lag in human migration prediction algorithm research. This study expands the definition of human migration research, reviews the progress of research into human migration prediction, and classifies and compares human migration algorithms based on open-source data. It also explores the critical uncertainty factors restricting the development of human migration prediction. Given the effect of human migration prediction, in combination with artificial intelligence and big data technology, the paper concludes with specific suggestions and countermeasures aimed at enhancing human migration prediction research results to serve economic and social development and national strategy.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

A friction loss model for brake testing platform is constructed to revise the braking force test results, which can largely improve the accuracy of automotive brake performance testing. Specifically, the influence of tire pressure, vehicle axle load, placement angle and vehicle speed on the friction loss is tested and analyzed on a wheelbase adjustable automotive anti-force brake testing platform. The friction loss model for the platform is constructed based on the defined relative slip and placement angle, which is validated through actual tests on four types of vehicles. The results showed that the maximum relative error between the values of the model calculated simulation and the measured was 2.2%, indicating the friction loss model is valid and can provide a basis for revising the braking force of automotive brake. Meanwhile, the maximum braking force increases from 3982 N to 4772 N, increased by 19.8%, when the placement angle increased from 36.9° to 47.0°. Accordingly, in order to improve the accuracy of detection results of the automotive anti-force rolling brake testing platform, the friction loss caused by the change in the placement angle should be revised, and then braking rate of the vehicle should be judged according to GB 7258-2017 and GB 38900-2020.

Apurinic/apyrimidinic endonuclease 1 (APE1), also known as redox factor-1 (Ref-1), is a multifunctional protein which is widely existing in living organisms. It can specifically recognize and cleave the DNA in apurinic/apyrimidinic (AP) site in the base excision repair (BER) pathway, as well as regulate the expression of genes to activate some transcription factors. The abnormal ex-pression and disruptions in the biological functions of APE1 are linked to a number of diseases, including inflammation, immunodeficiency, and cancer. Hence, it is extremely desired to monitor the activity of APE1, acquiring a thorough understanding of the healing process of damaged DNA and making clinical diagnoses. Thanks to the advent of DNA nanotechnology, some nanodevices are used to image the activity of APE1 with great sensitivity and simplicity. In this review, we will summarize DNA nanotechnology-empowered fluorescence imaging in the past years for APE1 activity according to the types of DNA probe, which are classified into linear DNA probes, composite DNA nanomaterials and three-dimensional (3D) DNA nanostructures. We also highlight the future research directions in the field of APE1 activity imaging.

COVID-19 patients can recover with a median SARS-CoV-2 clearance of 20 days post initial symptoms (PIS). However, we observed some COVID-19 patients with existing SARS-CoV-2 for more than 50 days PIS. This study aimed to investigate the cause of viral clearance delay and the infectivity in these patients. Demographic data and clinical characteristics of 22 long-term COVID-19 patients were collected. SARS-CoV-2 nucleic acid, peripheral lymphocyte count, and functionality were assessed. SARS-CoV-2-specific and neutralization antibodies were detected, followed by virus isolation and genome sequencing. The median age of the studied cohort was 59.83±12.94 years. All patients were clinically cured after long-term SARS-CoV-2 infection ranging from 53 to 112 days PIS. Peripheral lymphocytes counts were normal. Interferon gamma (IFN-ƴ)-generated CD4+ and CD8+ cells were normal as 24.68±9.60% and 66.41±14.87%. However, the number of IFN-ƴ-generated NK cells diminished (58.03±11.78%). All patients presented detectable IgG, which positively correlated with mild neutralizing activity (ID50=157.2, P=0.05). SARS-CoV-2 was not isolated, and a cytopathic effect was lacking. Only three synonymous variants were identified in spike protein coding regions. In conclusion, decreased IFN-γ production by NK cells and low neutralizing antibodies might favor SARS-CoV-2 long-term existence. Further, low viral load and weak viral pathogenicity was observed in COVID-19 patients with long-term SARS-CoV-2 infection.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (>90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

The characteristics of gap plasmon formed by nanoparticle-on-mirror (NPOM) structure composed of metal nanoparticles (MNP) and metal thin films have aroused the interest of various optoelectronic devices. The resonant spectrum obtained by the internal coupling effect of gap can be flexibly controlled by the polarization of incident light and the thickness of the dielectric layer between MNP and metal thin films. We have theoretically studied the resonance spectra of polarization-dependent gold ellipsoidal nanoparticles (GENP) and gold thin films in the gap region of NPOM structures. GENP and gold thin films are separated by a dielectric layer with a refractive index of 1.36. We observe that the intensity of the local electric field resonance peak in the gap region is inversely proportional to the polarization angle. Similarly, the intensity of the local electric field resonance peak in the gap region is inversely proportional to the thickness of the dielectric layer. We have obtained more than 2200 V/m local electric field intensity (dielectric layer thickness 0.3nm). Finally, the resonant peak wavelength of the electric field in the gap region of the NPOM structure is also controlled by the polarization angle of the incident light and the thickness of the dielectric layer.

This study investigated whether reciprocal collaborative pedagogy significantly impacts Indonesian electrical engineering polytechnic students in reducing reading anxiety and improving self-efficacy in ESP reading comprehension skills. Fifty Polytechnic students were equally assigned to two groups. Control groups learned in the traditional reciprocal teaching method individually. Experimental group engaged in reciprocal collaborative pedagogy. Each group received a 6-week reading strategy training. E-learning platforms were used in this study as a complementary tool to distribute ESP reading materials, announcements, and the experiment details being taught. The quantitative and qualitative results demonstrated that the tasks in reciprocal collaborative pedagogy positively affects Indonesian electrical engineering polytechnic students' learning experience and outcomes. This pedagogy promotes a productive learning environment through peer interaction, active engagement, and peer group discussions of the whole learning activities, reducing feelings of anxiety and building confidence in ESP-specialized text.

Complex models have received significant interest in recent years and are being increasingly used to explain the stochastic phenomenon with upward and downward fluctuation such as the stock market. Different from existing semi-variance methods in traditional integer dimension construction for two variables, this paper proposes a simplified multi-factorized fractional dimension derivation with the exact Excel tool algorithm involving the fractional center moment extension to covariance, which is a complex parameter average that is a multi-factorized extension to Pearson covariance. By examining the peaks and troughs of gold price averages, the proposed algorithm provides more insight into revealing underlying stock market trends to see who is the financial market leader during good economic times. The calculation results demonstrate that the complex covariance is able to distinguish subtle differences among stock market performances and gold prices for the same field that the two variable covariance may overlook. We take the London, Tokyo, Shanghai, Toronto and Nasdaq as the representative examples.

ITRF input data which are integrated by GNSS, SLR, VLBI, DORIS combination centers are considered to be relatively high-quality and accurate solutions. However, when utilizing these inputs, one still needs to identify outliers, rescale inaccurate covariance matrix and evaluate the precision of the observed datum information. To achieve the above-mentioned objectives, we propose a terrestrial reference frame (TRF) stacking approach to establish the single technical reference frameworks for the ITRF2014 and ITRF2020 datasets of all four technologies. As a result, roughly 0.5% or less of the SLR observations are identified as outliers, while the ratio of DORIS, GNSS, and VLBI observations are below 1%, around 2%, and ranging from 1% to 1.2%, respectively. The post-rescaling covariance scale factors are 25.07, 27.25, 18.84, 6.98 for GNSS, SLR, VLBI, and DORIS in ITRF2014 datasets, and 8.95, 14.9, 16.8, 7.78 in ITRF2020 datasets, respectively. It is shown that the consistency between the SLR scale and ITRF has improved, increasing from around -5mm in ITRF2014 datasets to approximately -1mm in ITRF2020 datasets. The scale velocity derived from fitting the VLBI scale parameter series with all epochs in ITRF2020 datasets differs by approximately 0.21mm/year from the velocity obtained by fitting the data up to 2013.75 because of the scale drift of VLBI at around 2013. The decreasing standard deviations of the Polar motion parameter (XPO, YPO) offsets between Stacking TRFs and 14C04 (20C04) indicating an improvement in the precision of polar motion observations for all of the four techniques. From the perspective of the Weighted Root Mean Square in station coordinates, the measurement precision of GNSS, SLR, and DORIS techniques has improved, while VLBI shows no significant change.

The correlation and comorbidity between depression and chronic pain have been observed for a long time. Generally, it is considered that the two conditions reinforce each other, whereas the causal relationship between them is not clear. However, some evidence suggested that chronic pain may reverse the progression of depression in some cases. This article presents a selective review of clinical and pharmacological relationship between depression and pain, and their interactions at neurochemical and neurobiological levels. In addition, we open a discussion on a recent case report of repeated success of using short but continuous pain (SCP) during meditation as the only treatment for depression, compared to initial success but no remission with other conventional antidepressants on the same patient. Together this review proposes an updated model for depression and its various treatments that is based on synaptic and system homeostasis. More importantly, it suggests that SCP may benefit depression recovery through its properties that are different from either acute or chronic pain and represents a novel research area that has been largely neglected to date.

Session-based recommendations which aim to predict subsequent user-item interaction based on historical user behavior during anonymous sessions can be challenging tasks. Two main challenges need to be addressed and improved: (1) How to analyze these sessions to accurately and completely capture users’ preferences, and (2) how to identify and eliminate any interference caused by noisy behavior. Existing methods have not adequately addressed these issues since they either neglected the valuable insight that can be gained from analyzing consecutive groups of items or failed to take these noisy data in sessions seriously and handled them properly, which can jointly impede recommendation systems from capturing users’ real intentions. To address these two problems, we designed a multi-order semantic denoising (MSD) model for session-based recommendations. Specifically, we grouped items of different lengths as varying multi-order semantic units to mine the user’s primary intention from multiple dimensions. Meanwhile, a novel denoising network was designed to alleviate the interference of noisy behavior and provide a more precise session representation. The result of extensive experiments on three real-world datasets demonstrated that the proposed MSD model exhibited improved performance compared with existing state-of-the-art methods in session-based recommendation.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

The magnetic polarization tensor has a promising capability of determining the geometry and material properties of metallic samples. In this paper, a novel computation method is proposed to estimate the magnetic polarization tensors for the metallic samples using the boundary element method. In this method, the metallic sample is placed in a uniformly distributed magnetic field. Based on assumptions that the excitation frequency and/or the conductivity of the sample is very high, the metallic sample is regarded as a perfect electrical conductor (PEC). Therefore, the scattered field at a certain distance can be simulated. By utilising the boundary element method, the magnetic polarization tensor can be derived from the simulated scattered field. The theoretical calculation is presented and simulations and experiments have been carried out to validate the proposed method. The results from the simulation are matched with the analytical solution for the case of sphere samples. Moreover, there is a good agreement between the simulation results and the experimental results for the copper cylindrical samples.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Using data from the China Family Panel Studies, this study examines the socioeconomic characteristics of Internet users, as well as the relationships between the dynamics of different forms of online activities and the subjective well-being of urbanites and rural migrants in urban China. The study finds that online behaviour may clearly reflect differences in individuals’ personal traits and socioeconomic positions. Patterns of the association between online activities and subjective well-being tend to differ among rural migrants and urbanites, especially in terms of depression. A difference-in-differences model is employed to estimate the impact of intensified engagement in online activities on depression and life satisfaction from 2010 to 2016. The results show that increased frequency of online entertainment exhibits a comparatively positive effect on depression and life satisfaction. Spending more time on online social networking has a similar impact on rural migrants, but not on urbanites. These findings suggest that the rapid development of urban China’s online community has important implications for residents’ subjective well-being.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Cesarean Section (CS) is one of the most frequently executed surgical procedures in gynecology and obstetrics. After a cesarean section, surgical site infection (SSI) increases hospital stay, lengthens maternal morbidity, and upsurges treatment costs. The current study determines the prevalence and risk factors for surgical site infection following cesarean section in China. A retrospective study was conducted on 23 cases of pregnant women who underwent cesarean section and incision severe infection and detection from March 2017 to January 2020 at Wuhan Maternal and Child Healthcare Hospital in China as the study group, and 20 cases of uninfected cesarean section during the same period were selected as the control group. Data were compared with the controls based on study variables and the presence of SSI. The mean age was 31±2.6. High fever and blood loss were observed in serous SSI-infected patients. The incidence rate of severe surgical site infection was 0.15 %. SSI was observed to be expected in pregnant women who had premature rupture of membrane before surgery (p < 0.001), who underwent postoperative antibiotic therapy (p < 0.001), and the patients who had gestational diabetes mellitus (p <0.001) and hematoma (p < 0.001) during surgery. Hence, following a cesarean section, surgical site infection is common. This research discovered several modifiable risk factors. SSI is associated with multifactorial rather than a single one. The development and strict implementation of a procedure by all health care practitioners can successfully reduce and prevent infection rates following cesarean section.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

In this study, we demonstrate a high luminous efficacy of 118 lm/W and high reliability through 450°C thermal aging of white LEDs (WLEDs) utilizing four-inch YAG: Ce3+ phosphor-in-glass (PiG) plates designed for vehicle headlights. The sintering process of mixing glass and phosphor typically generates pores, which can scatter light and reduce the luminous efficacy of the fabricated PiG. In this study, we produced four-inch PiG plates under four different fabrication conditions to evaluate their luminous efficacy. Our results revealed that the PiG plate with a thin thickness of 0.08 mm exhibited a 16.83% increase in luminous efficacy compared to the 0.15 mm plate, attributed to reduced light interaction with the pores. Unlike silicone-based phosphor WLEDs, which offer high performance but lower reliability due to the silicone resin's low transition temperature (150°C), our novel thin PiG plate achieves high performance and reliability. This advancement suggests that the proposed thin PiG plate could replace traditional silicone-based phosphors, enabling the development of high-quality WLEDs for vehicle headlights in automotive applications.

The Huichang fault Basin in Jiangxi Province exhibits high terrestrial heat flow values and a dense concentration of hot springs. However, existing research is limited to individual geothermal fields without a comprehensive basin-wide analysis of geothermal water origins. This study investigates the source of geothermal water across five representative geothermal fields using hydrochemical components and isotopic analyses. The findings indicate: (1) The hydrochemical type transitions from bicarbonate sulphate-sodium-calcium in the north to bicarbonate sodium-calcium in the south; (2) Major chemical components of the geothermal water derive from evaporative salt rocks (Cretaceous sand conglomerate cover) and siliceous formations (granite/metamorphic rock basement); (3) The recharge elevation for geothermal water is approximately 1 km, sourced from adjacent hills. The central basin's geothermal water has an apparent age of about 26,000 years, with δ¹³C indicating participation in deep circulation; (4) Thermal reservoir temperatures range from 74 to 113℃, with the lowest temperatures at the basin's edges (Anzishan and Shangjin geothermal fields) and higher temperatures towards the center, suggesting increased warming and a circulation depth of 1.5 to 2.5 km; (5) Simulation results of reverse water-rock interaction indicate that mineral precipitation-dissolution processes are governed by the basin's main thermal control structures. The geothermal fields are predominantly influenced by reduction alterations associated with granite and are closely linked to paleo-geothermal waters in the enclosed basin, with the formation of these fields heavily reliant on the heat production or conduction from radioactive elements in granite.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The basic oxygen furnace slag (BOF) was wide used in road construction, but there was a lack of characteristics in different asphalt mixtures. This study investigates the properties of hot-mixed asphalt (HMA) containing stone mastic asphalt (SMA), porous asphalt (PA) and dense-graded BOF as a partial substitution for natural aggregates. The purpose of this study is to evaluate various BOF slag contents in the asphalt mixtures would affect the cooling behavior after compaction. Asphalt mixture specimens contained 0%, 20%, 40% and 60% BOF slag, respectively, as coarse aggregate. Test results showed that BOF slag has a lipophilic property, so it can be adsorbed by asphalt cement, thereby reducing the cost of asphalt. The stability value of all asphalt mixtures increases with the proportion of BOF slag replacement. In addition, the voids in the mineral aggregate (VMA) value variable exhibited significant differences among asphalt mixtures, and could determine the deviation of the cooling trend of asphalt mixtures. Furthermore; it was found that the cooling procedure of the BOF slag used in dense-graded asphalt mixture takes about 100 min, and that the temperature tends to be moderate; however, it took about 120 min of cooling the SMA and PA mixture with BOF slag. In addition, the voids distribution of dense asphalt mixture was not uniform. It would result in various locations of thermal energy temperature on asphalt mixtures that were inconsistent.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Previously, a conductivity invariance phenomena (CIP) has been discovered – at a certain lift-off, the inductance change of the sensor due to a test sample is immune to conductivity variations, i.e. the inductance – lift-off curve passes through a common point at a certain lift-off, termed as conductivity invariance lift-off. However, this conductivity invariance lift-off is fixed for a particular sensor setup, which is not convenient for various sample conditions. In this paper, we propose using two parameters in the coil design – the horizontal and vertical distances between the transmitter and the receiver to control the conductivity invariance lift-off. The relationship between these two parameters and the conductivity invariance lift-off is investigated by simulation and experiments and it has been found that there is an approximate linear relationship between these two parameters and the conductivity invariance lift-off. This is useful for applications where the measurements have restrictions on lift-off, e.g. uneven coating thickness which limits the range of the lift-off of probe during the measurements. Therefore, based on this relationship, it can be easier to adjust the configuration of the probe for a better inspection of the test samples.

The development of a method to produce coumarins unsubstituted on the pyranic nucleus catalyzed from Wells–Dawson heteropolyacid (H₆P₂W₁₈O₆₂), phenol derivatives and ethyl 3,3-diethoxypropionate using Pechmann condensation under solvent-free conditions is described. This catalytic method was also applied successfully to synthesize various substituted coumarins, including the corresponding phenols and ethyl 3,3-diethoxypropionate. This work provides a novel, cheaper and safer way to syhthesize coumarins unsubstituted on the pyranic nucleus.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

An in-depth understanding of the Se uptake and metabolism in plants is necessary for developing Se biofortification strategies. Thus, hydroponic experiments were conducted to investigate the associated processes and mechanisms of organic Se [selenomethionine (SeMet) and selenomethionine-oxide (SeOMet)] uptake, translocation, transformation and their interaction in wheat, in comparison to inorganic Se. Results showed that Se uptake by roots and the root-to-shoot translocation factor under the SeMet treatment were higher than those under the selenite, selenate, and SeOMet treatments. The uptake and translocation of SeMet were higher than those of SeOMet within 72 h, although the differences gradually narrowed with time. The uptake of SeMet and SeOMet was also sensitive to the aquaporin inhibitor: AgNO3 addition resulted in 99.5% and 99.9% inhibition of Se in root in the SeMet and SeOMet treatments, respectively. Once absorbed by root, were rapidly assimilated to other Se forms, and SeMet and Se-methyl-selenocysteine (MeSeCys) were the dominant species in SeMet and SeOMet-treated plants, while notably, an unidentified Se form was also found in the root and xylem sap under the SeMet treatment. In addition, within 16 h, SeOMet inhibited the uptake and translocation of SeMet, while the interaction was weakened with longer treatment time. Taken together, the present study provides new insights for the uptake and transformation processes of organic Se within plants.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

In the field of delta-sigma modulators, reducing system power consumption without sacrificing accuracy has become a challenge. The summing circuit, as the main part of the cascade-of-integrator-in-feedforward delta-sigma modulator, consumes a significant amount of power in active summing. On the other hand, passive summing circuits have low power consumption but can cause attenuation in the summing results. This article proposes a low-power multi-bit delta-sigma modulator based on passive and attenuationless summation scheme. The summation circuit achieves multiplication of the voltage signal carried on the summation capacitor through bidirectional sampling technique, compensating for the inherent attenuation caused by passive summation, thus eliminating the need for active OTA to achieve perfect summation. A 2-order delta-sigma modulator based on 4-bit 1-order passive noise-shaping (NS) SAR quantizer is designed to verify the scheme. By combining a passive NS SAR as the 4-bit quantizer and the third-stage integrator of the system, and incorporating an energy-efficient cascode floating inverter amplifier (FIA) structure as the core active OTA, these elements have significantly enhanced the energy-efficiency of the modulator. Simulation results show that at a supply voltage of 1.2 V and a bandwidth of 20 kHz, the SNDR reaches 102.62 dB, power consumption is only 148.32 μW, and Schreier figure-of-merit (FoM) of SNDR is 183.92 dB.

Forests have multifunctional roles. They not only increase forest carbon sinks through afforestation and management, but also indirectly realize multiple benefits of "economy + ecology + society". Therefore, we construct a multiple output-benefit system of forest carbon sinks based on the development of forest carbon sinks in provinces of China. This system is also able to distinguish the importance of forest carbon sinks from other outputs. For the efficiency evaluation of multi-level output systems, this paper constructs a cross-evaluation model based on evidential reasoning method, the original efficiency information by conducting efficiency evaluation before information fusion. Further, the spillover effects and influencing factors of forest carbon sink efficiency are analyzed through a spatial regression model to explore the spatial characteristics of forest carbon sink efficiency in China. The results show that: (1) there is a large gap between the cross-efficiency levels of forest carbon sinks in various regions of China, with significant spatial correlation. For the perspective of direct output benefits, the cross-efficiency of the eastern region is higher, while the cross-efficiency of the northwestern region is lower; for the perspective of indirect output benefits, the cross-efficiency of the southeastern region is higher. (2) China's forest carbon sink has a significant positive spillover effect, and the indirect output cross-efficiency has a significant negative impact on the forest carbon sink in its own region. Further analyzing the impact of indirect output cross-efficiency, it is found that the cross-efficiency of the ecological dimension and the cross-efficiency of the social dimension have a significant negative impact on the forest carbon sink in its own region, and the economic dimension has a significant positive impact on the forest carbon sink in its own region. In conclusion, corresponding policy recommendations are proposed for the development of forest carbon sinks to promote the realization of the dual-carbon goal.

By repeated unloading and loading of the excavation dynamic and static loads, repeated train dynamic and static loads of multi-factors, the underpass tunnel, cross tunnel engineering influence area rock layer, the existing tunnel structure of the three constitutes a multifaceted structure, multi-factor interaction system. Existing tunnels into the prediction theory model of the new tunnel excavation process of dynamic and static loads, dynamic and static loads of existing tunnels are mostly analyzed individually, the results of synergistic analysis needs to be improved. Based on the theory of the current layer method, the paper comprehensively considers the stiffness of the existing tunnel, the stiffness of the new tunnel, the excavation method load and the existing tunnel load, coupled with Peck's empirical formula, the theoretical model of deformation prediction for excavation of a two-lane highway tunnel under the tunnel through the existing railroad is proposed, and verified and optimized by numerical calculations and monitoring data, which proves the applicability and reliability of the theoretical model in the similar strata and the project promotion.

The research on the excavation mechanical properties of underpass tunnels has already had certain results, but fewer of them consider the effects of dynamic and static loads on the excavation mechanical properties of underground tunnels at the same time, especially the lack of research cases of double-line highway tunnels with angled underpasses of existing railway tunnels. In this paper, based on the tunnel project of the new double-line Shiqian Highway Tunnel passing under the Hurong Railway at an oblique angle, the mechanical parameters of the rock body in the cross-tunneling area under the influence of static and dynamic load coupling are obtained by using the disturbance quantification coefficients and the Hoek-Brown criterion based on the method of over-advanced geological prediction and the investigation of the surrounding rock on the palisade face, and the engineering-scale finite element model is constructed and the mechanical characteristics of the excavation in the tunnel of the double-lane highway tunnel passing under the existing railroad under the influence of the static and dynamic loads are analyzed. The results show that: the new tunnel rock movement law for the top of the arch sinking, bottom plate bulging, side wall to move outward, the height and width of the arch and bottom plate arch with the tunnel excavation and increase, the side wall rock displacement effect is smaller; left and right lines of the tunnel disturbed area of the rule of change is similar; the existing tunnel bottom plate displacement is more than the top plate and the left and right side walls by the excavation of the time step influence is larger. Typical profile displacement is mainly determined by the distance from the excavation surface; the new tunnel in the four types of calculation conditions of the rock disturbance angle is the same; the existing tunnel roof and side wall Von Mises stress extreme occurs in the tunnel structure, the bottom plate there are pressure relief and pressure-bearing areas; based on the displacement control criteria, the recommended upper and lower step blasting method.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

An accurate, economical, and reliable device for detecting falls in persons ambulating with the assistance of an orthopedic walker is crucially important for the elderly and patients with limited mobility. Existing wearable devices such as wristbands are not designed for walker users, and patients may not wear them at all times. This research proposes a novel idea of attaching an internet-of-things (IoT) device with an inertial measurement unit (IMU) sensor directly to an orthopedic walker to perform real-time fall detection as well as activity logging. A dataset is collected and labeled for walker users in four activities, including idle, motion, step, and fall. Classic machine learning algorithms are evaluated using the dataset by comparing their classification performance. Deep learning with convolutional neural network (CNN) is also explored. Furthermore, the hardware prototype is designed by integrating a low-power microcontroller for onboard machine learning, an IMU sensor, a rechargeable battery, and Bluetooth wireless connectivity. The research results show the promise of improved safety and well-being of walker users.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.