Epidemiological Surveillance of Respiratory Diseases in Urban Stray Cats in Shanghai
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples Collection
2.2. Reagents
2.3. Sample Treatment and Primers Designing
2.4. Gene Amplification
2.5. Data Analysis
3. Results
3.1. Detection of Respiratory Pathogens among Urban Stray Cats
3.2. Co-Infections Status of Respiratory Pathogens among Urban Stray Cats
3.3. The Seasonal Distribution Characteristics of Respiratory Pathogens among Urban Stray Cats
3.4. The Distribution of Respiratory Pathogens among Male and Female Urban Stray Cats
3.5. The Distribution of Respiratory Pathogens among Urban Stray Cats across Various Age Groups
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sykes, J.E. Pediatric feline upper respiratory disease. Vet. Clin. Small Anim. 2014, 44, 331–342. [Google Scholar] [CrossRef] [PubMed]
- Palombieri, A.; DiProfio, F.; Fruci, P.; Sarchese, V.; Martella, V.; Marsilio, F.; Di Martino, B. Emerging Respiratory Viruses of Cats. Viruses 2022, 14, 663. [Google Scholar] [CrossRef] [PubMed]
- Hofmann-Lehmann, R.; Hosie, M.J.; Hartmann, K.; Egberink, H.; Truyen, U.; Tasker, S.; Belák, S.; Boucraut-Baralon, C.; Frymus, T.; Lloret, A.; et al. Calicivirus Infection in Cats. Viruses 2022, 14, 937. [Google Scholar] [CrossRef] [PubMed]
- Caringella, F.; Elia, G.; Decaro, N.; Martella, V.; Lanave, G.; Varello, K.; Catella, C.; Diakoudi, G.; Carelli, G.; Colaianni, M.L.; et al. Feline calicivirus infection in cats with virulent systemic disease, Italy. Res. Vet. Sci. 2019, 124, 46–51. [Google Scholar] [CrossRef]
- Zhao, F.R.; Zhou, D.H.; Zhang, Y.G.; Shao, J.J.; Lin, T.; Li, Y.F.; Wei, P.; Chang, H.Y. Detection prevalence of H5N1 avian influenza virus among stray cats in eastern China. J. Med. Virol. 2015, 87, 1436–1440. [Google Scholar] [CrossRef] [PubMed]
- Lee-Fowler, T. Feline respiratory disease: What is the role of Mycoplasma species? J. Feline Med. Surg. 2014, 16, 563–571. [Google Scholar] [CrossRef] [PubMed]
- Sandøe, P.; Jensen, J.B.; Jensen, F.; Nielsen, S.S. Shelters reflect but cannot solve underlying problems with relinquished and stray animals—A retrospective study of dogs and cats entering and leaving shelters in Denmark from 2004 to 2017. Animals 2019, 9, 765. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Jiang, A. Public opinions on stray cats in China, evidence from social media data. Animals 2023, 13, 457. [Google Scholar] [CrossRef]
- Abdulkarim, A.; Khan, M.A.K.B.G.; Aklilu, E. Stray animal population control: Methods, public health concern, ethics, and animal welfare issues. World’s Vet. J. 2021, 11, 319–326. [Google Scholar] [CrossRef]
- Lefkaditis, M.A.; Sossidou, A.V.; Panorias, A.H.; Koukeri, S.E.; Paştiu, A.I.; Athanasiou, L.V. Urban stray cats infested by ectoparasites with zoonotic potential in Greece. Parasitol. Res. 2015, 114, 3931–3934. [Google Scholar] [CrossRef]
- Khademvatan, S.; Abdizadeh, R.; Rahim, F.; Hashemitabar, M.; Ghasemi, M.; Tavalla, M. Stray cats gastrointestinal parasites and its association with public health in Ahvaz City, South Western of Iran. Jundishapur J. Microbiol. 2014, 7, e11079. [Google Scholar] [CrossRef]
- Helps, C.; Lait, P.; Damhuis, A.; Björnehammar, U.; Bolta, D.; Brovida, C.; Chabanne, L.; Egberink, H.; Ferrand, G.; Fontbonne, A. Factors associated with upper respiratory tract disease caused by feline herpesvirus, feline calicivirus, Chlamydophila felis and Bordetella bronchiseptica in cats: Experience from 218 European catteries. Vet. Rec. 2005, 156, 669–673. [Google Scholar] [CrossRef]
- Söderlund, R.; Bölske, G.; Holst, B.S.; Aspán, A. Development and evaluation of a real-time polymerase chain reaction method for the detection of Mycoplasma felis. J. Vet. Diagn. Investig. 2011, 23, 890–893. [Google Scholar] [CrossRef]
- Gunther, I.; Raz, T.; Berke, O.; Klement, E. Nuisances and welfare of free-roaming cats in urban settings and their association with cat reproduction. Prev. Vet. Med. 2015, 119, 203–210. [Google Scholar] [CrossRef]
- Ravicini, S.; Pastor, J.; Hawley, J.; Brewer, M.; Castro-López, J.; Beall, M.; Lappin, M.R. Prevalence of selected infectious disease agents in stray cats in Catalonia, Spain. J. Feline Med. Surg. Open Rep. 2016, 2, 2055116916634109. [Google Scholar] [CrossRef] [PubMed]
- McManus, C.; Levy, J.; Andersen, L.; McGorray, S.; Leutenegger, C.; Gray, L.; Hilligas, J.; Tucker, S. Prevalence of upper respiratory pathogens in four management models for unowned cats in the Southeast United States. Vet. J. 2014, 201, 196–201. [Google Scholar] [CrossRef]
- Walter, J.; Foley, P.; Yason, C.; Vanderstichel, R.; Muckle, A. Prevalence of feline herpesvirus-1, feline calicivirus, Chlamydia felis, and Bordetella bronchiseptica in a population of shelter cats on Prince Edward Island. Can. J. Vet. Res. 2020, 84, 181–188. [Google Scholar]
- Gruffydd-Jones, T.; Addie, D.; Belák, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Hartmann, K.; Hosie, M.J.; Lloret, A.; Lutz, H. Chlamydophila felis infection: ABCD guidelines on prevention and management. J. Feline Med. Surg. 2009, 11, 605–609. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.; Barrs, V.R.; Kelman, M.; Ward, M.P. Feline upper respiratory tract infection and disease in Australia. J. Feline Med. Surg. 2019, 21, 973–978. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Li, Y.; Xie, Q.; Al-Zaban, M.I.; Al-Saeed, F.A.; Shati, A.A.; Al-Doaiss, A.A.; Ahmed, A.E.; Nawaz, S.; Ebrahem, H. Epidemiological investigation of feline upper respiratory tract infection encourages a geographically specific FCV vaccine. Vet. Sci. 2023, 10, 46. [Google Scholar] [CrossRef]
- Deschamps, J.Y.; Topie, E.; Roux, F. Nosocomial feline calicivirus-associated virulent systemic disease in a veterinary emergency and critical care unit in France. J. Feline Med. Surg. Open Rep. 2015, 1, 2055116915621581. [Google Scholar] [CrossRef] [PubMed]
- Chiu, S.; Skura, B.; Petric, M.; McIntyre, L.; Gamage, B.; Isaac-Renton, J. Efficacy of common disinfectant/cleaning agents in inactivating murine norovirus and feline calicivirus as surrogate viruses for human norovirus. Am. J. Infect. Control 2015, 43, 1208–1212. [Google Scholar] [CrossRef] [PubMed]
- Donnett, U.B. Feline Upper Respiratory Disease Complex: The Detection and Epidemiology of Respiratory Pathogens in Midwestern Feline Shelter Populations. Master’s Thesis, Iowa State University, Ames, IA, USA, 2014. [Google Scholar]
- Taha-Abdelaziz, K.; Bassel, L.L.; Harness, M.L.; Clark, M.E.; Register, K.B.; Caswell, J.L. Cilia-associated bacteria in fatal Bordetella bronchiseptica pneumonia of dogs and cats. J. Vet. Diagn. Investig. 2016, 28, 369–376. [Google Scholar] [CrossRef] [PubMed]
- Halánová, M.; Petrová, L.; Halán, M.; Trbolová, A.; Babinská, I.; Weissová, T. Impact of way of life and environment on the prevalence of Chlamydia felis in cats as potentional sources of infection for humans. Ann. Agric. Environ. Med. 2019, 26, 222–226. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence (5′ to 3′) | Size | References |
---|---|---|---|
FCV ORF1 gene | F: GTTGGATGAACTACCCGCCAATC R: CATATGCGGCTCTGATGGCTTGAAACTG P: FAM TCGGTGTTTGATTTGGCCTG BHQ1 | 121 bp | [12] |
FHV-1 thymidine kinase gene | F: GGACAGCATAAAAGCGATTG R: AACGTGAACAACGACGCAG P: FAM AATTCCAGCCCGGAGCCTCAAT BHQ1 | 74 bp | [12] |
B.b FimA | F: ACTATACGTCGGGAAATCTGTTTG R: CGTTGTCGGCTTTCGTCTG P: FAM CGGGCCGATAGTCAGGGCGTAG BHQ1 | 80 bp | [12] |
C. felis major outer membrane protein gene | F: GAACTGCAAGCAACACCACTG R: CCATTCGGCATCTTGAAGATG P: FAM CGCTGCCGACAGATCAAATTTTGCC BHQ1 | 76 bp | [12] |
M. felis | F: TAAATTAGCTCTTGATGGTGTTCCT R: TTCAAAGTCTTTTTCTGGAGTTTCA P: FAM TGAGAAGAAAAAGTTATGGAATTAATGGATGCA BHQ1 | 100 bp | [13] |
District | Sample Numbers | Positive Number (Positive Rate) | |||||
---|---|---|---|---|---|---|---|
IV-A | FCV | FHV-1 | M. felis | C. felis | B.b | ||
Fengxian | 38 | 0 (0) | 1 (2.63) | 3 (7.89) | 8 (21.05) | 1 (2.63) | 0 (0) |
Minhang | 72 | 0 (0) | 0 (0) | 0 (0) | 23 (31.94) | 5 (6.94) | 0 (0) |
Songjiang | 29 | 0 (0) | 0 (0) | 1 (3.45) | 4 (13.79) | 5 (17.24) | 1 (3.45) |
Qingpu | 83 | 0 (0) | 12 (14.46) | 8 (9.64) | 9 (10.84) | 17 (20.48) | 1 (1.21) |
Jiading | 34 | 0 (0) | 1 (2.94) | 0 (0) | 5 (14.71) | 8 (23.53) | 2 (5.88) |
Changning | 30 | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (3.33) |
Hongkou | 50 | 0 (0) | 0 (0) | 1 (2.00) | 12 (24.00) | 6 (12.00) | 0 (0) |
Putuo | 38 | 0 (0) | 0 (0) | 0 (0) | 9 (23.68) | 2 (5.26) | 0 (0) |
Total | 374 | 0 (0) | 14 (3.74) | 13 (3.48) | 70 (18.72) | 44 (11.76) | 5 (1.34) |
Mixed Infection Pathogens | Sample Number | Positives Number | Positive Rate |
---|---|---|---|
FCV + M. felis | 374 | 4 | 1.07 |
FCV + C. felis | 374 | 3 | 0.80 |
FHV-1 + M. felis | 374 | 1 | 0.27 |
M. Felis + C. felis | 374 | 25 | 6.68 |
C. Felis + B.b | 374 | 1 | 0.27 |
FCV + M. felis + C. felis | 374 | 2 | 0.53 |
Total | 374 | 36 | 9.63 |
Pathogens | Seasons | χ2 Value | p-Value | ||||
---|---|---|---|---|---|---|---|
Spring (Mar.–May) | Summer (June–Aug.) | Autumn (Sept.–Nov.) | Winter (Dec.–Feb.) | Total | |||
(n = 33) | (n = 99) | (n = 124) | (n = 118) | (n = 374) | |||
FCV | 0 (0) | 10 (10.10) | 0 (0) | 4 (3.39) | 14 (3.74) | 15.24 a | <0.001 |
FHV-1 | 0 (0) | 1 (1.01) | 1 (0.81) | 11 (9.32) | 13 (3.48) | 13.60 a | 0.001 |
M. felis | 3 (9.09) | 22 (22.22) | 25 (20.16) | 20 (16.95) | 70 (18.72) | 3.22 | 0.362 |
C. felis | 2 (6.06) | 15 (15.15) | 5 (4.03) | 22 (18.64) | 44 (11.76) | 15.34 a | 0.001 |
B.b | 1 (3.03) | 2 (2.02) | 0 (0) | 2 (1.69) | 5 (1.34) | 3.68 a | 0.251 |
Total | 6 (18.18) | 50 (50.51) | 31 (25.00) | 59 (50.00) | 146 (39.04) | 27.73 | <0.001 |
Pathogens | Gender | χ2 Value | p-Value | ||
---|---|---|---|---|---|
Male | Female | Total | |||
(n = 178) | (n = 196) | (n = 374) | |||
FCV | 6 (3.37) | 8 (4.08) | 14 (3.74) | 0.13 | 0.790 |
FHV-1 | 5 (2.81) | 8 (4.08) | 13 (3.48) | 0.45 | 0.580 |
M. felis | 33 (18.54) | 37 (18.88) | 70 (18.72) | 0.01 | 1.000 |
C. felis | 26 (14.61) | 18 (9.18) | 44 (11.76) | 2.64 | 0.111 |
B.b | 4 (2.25) | 1 (0.51) | 5 (1.34) | 1.02 | 0.313 |
Total | 74 (41.57) | 72 (36.73) | 146 (39.04) | 0.92 | 0.342 |
Pathogens | Age Groups | χ2 Value | p-Value | |||
---|---|---|---|---|---|---|
≤1 Year Old | 1~3 Years Old | ≥3 Years Old | Total | |||
(n = 178) | (n = 101) | (n = 95) | (n = 374) | |||
FCV | 5 (2.81) | 5 (4.95) | 4 (4.21) | 14 (3.74) | 1.08 a | 0.645 |
FHV-1 | 4 (2.25) | 6 (5.94) | 3 (3.16) | 13 (3.48) | 2.56 a | 0.290 |
M. felis | 29 (16.29) | 34 (33.67) | 7 (7.37) | 70 (18.72) | 23.56 | <0.001 |
C. felis | 20 (11.24) | 19 (18.81) | 5 (5.27) | 44 (11.76) | 8.75 | 0.012 |
B.b | 2 (1.12) | 2 (1.98) | 1 (1.05) | 5 (1.34) | 0.68 a | 0.851 |
Total | 60 (33.71) | 66 (65.35) | 20 (21.05) | 146 (39.04) | 44.41 | < 0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, D.; Ju, H.; Li, X.; Shen, H.; Ge, F.; Yang, X.; Zhao, H.; Wu, X.; Zhu, X.; Wang, X.; et al. Epidemiological Surveillance of Respiratory Diseases in Urban Stray Cats in Shanghai. Animals 2024, 14, 1562. https://doi.org/10.3390/ani14111562
Yang D, Ju H, Li X, Shen H, Ge F, Yang X, Zhao H, Wu X, Zhu X, Wang X, et al. Epidemiological Surveillance of Respiratory Diseases in Urban Stray Cats in Shanghai. Animals. 2024; 14(11):1562. https://doi.org/10.3390/ani14111562
Chicago/Turabian StyleYang, Dequan, Houbin Ju, Xin Li, Haixiao Shen, Feifei Ge, Xianchao Yang, Hongjing Zhao, Xiujuan Wu, Xiaoying Zhu, Xiaoxu Wang, and et al. 2024. "Epidemiological Surveillance of Respiratory Diseases in Urban Stray Cats in Shanghai" Animals 14, no. 11: 1562. https://doi.org/10.3390/ani14111562