The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Diets, Experimental Design, and Animal Management
2.2. Sample Collection
2.3. Determination of Enzyme Activities in Pectoralis Major Muscles
2.4. Real-Time PCR Analysis
2.5. Statistical Analysis
3. Results
3.1. mRNA Expressions of TNF-α, IL-6, IL-1β in the Liver
3.2. The Activities of ALT and AST in the Muscle of Broilers
3.3. GS Activity and mRNA Expression of GA in the Pectoralis Major Muscle of Broilers
3.4. mTOR Signaling Molecules in the Pectoralis Major Muscle
3.5. mRNA Expression of Akt/FOXO Signals Mediated by TLR4
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, K.; Zhen, W.; Bai, D.; Tan, H.; He, X.; Li, Y.; Liu, Y.; Zhang, Y.; Ito, K.; Zhang, B.; et al. Lipopolysaccharide-induced immune stress negatively regulates broiler chicken growth the COX-2-PGE-EP4 signaling pathway. Front. Immunol. 2023, 14, 1193798. [Google Scholar] [CrossRef] [PubMed]
- Bi, S.; Shao, J.; Qu, Y.; Hu, W.; Ma, Y.; Cao, L. Hepatic transcriptomics and metabolomics indicated pathways associated with immune stress of broilers induced by lipopolysaccharide. Poult. Sci. 2022, 101, 102199. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Li, Q.; Liu, J.; Liu, Y.; Xu, Y.; Zhang, R.; Yu, Y.; Wang, Y.; Yang, C. Integrating Serum Metabolome and Gut Microbiome to Evaluate the Benefits of Lauric Acid on Lipopolysaccharide-Challenged Broilers. Front. Immunol. 2021, 12, 759323. [Google Scholar] [CrossRef]
- Lee, Y.; Lee, S.-H.; Gadde, U.D.; Oh, S.-T.; Lillehoj, H.S. Dietary Allium hookeri reduces inflammatory response and increases expression of intestinal tight junction proteins in LPS-induced young broiler chicken. Res. Vet. Sci. 2017, 112, 149–155. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Zhong, Q.; Liu, N.; Song, P.; Zhu, P.; Zhang, C.; Sun, Z. Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers. Animals 2022, 12, 1729. [Google Scholar] [CrossRef]
- Orellana, R.A.; Suryawan, A.; Wilson, F.A.; Gazzaneo, M.C.; Fiorotto, M.L.; Nguyen, H.V.; Davis, T.A. Development aggravates the severity of skeletal muscle catabolism induced by endotoxemia in neonatal pigs. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2012, 302, R682–R690. [Google Scholar] [CrossRef]
- Zhang, B.L.; Yu, C.N.; Lin, M.; Fu, Y.N.; Zhang, L.; Meng, M.J.; Xing, S.; Li, J.L.; Sun, H.; Gao, F. Regulation of skeletal muscle protein synthetic and degradative signaling by alanyl-glutamine in piglets challenged with Escherichia coli lipopolysaccharide. Nutrition 2015, 31, 749–756. [Google Scholar] [CrossRef]
- Jagoe, R.T.; Goldberg, A.L. What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? Curr. Opin. Clin. Nutr. Metab. Care 2001, 4, 183–190. [Google Scholar] [CrossRef]
- A Orellana, R.; Kimball, S.R.; Nguyen, H.V.; A Bush, J.; Suryawan, A.; Thivierge, M.C.; Jefferson, L.S.; A Davis, T. Regulation of muscle protein synthesis in neonatal pigs during prolonged endotoxemia. Pediatr. Res. 2004, 55, 442–449. [Google Scholar] [CrossRef]
- Orellana, R.A.; O’Connor, P.M.J.; Nguyen, H.V.; Bush, J.A.; Suryawan, A.; Thivierge, M.C.; Fiorotto, M.L.; Davis, T.A. Endotoxemia reduces skeletal muscle protein synthesis in neonates. Am. J. Physiol. Endocrinol. Metab. 2002, 283, E909–E916. [Google Scholar] [CrossRef]
- Liu, Y.; Chen, F.; Odle, J.; Lin, X.; Zhu, H.; Shi, H.; Hou, Y.; Yin, J. Fish oil increases muscle protein mass and modulates Akt/FOXO, TLR4, and NOD signaling in weanling piglets after lipopolysaccharide challenge. J. Nutr. 2013, 143, 1331–1339. [Google Scholar] [CrossRef] [PubMed]
- Dai, S.; Wen, A.; Wang, L.; Jin, G. Dietary glutamine supplementation improves growth performance, meat quality and colour stability of broilers under heat stress. Br. Poult. Sci. 2009, 50, 333–340. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Wang, K.; Khan, R.U.; Zhang, C.; Hu, H. Effect of Glutamine on the Growth Performance, Oxidative Stress, and Nrf2/p38 MAPK Expression in the Livers of Heat-Stressed Broilers. Animals 2023, 13, 652. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.J.; Zhu, D.D.; Wang, D.D.; Zhang, B.B.; Ren, A.; Bin Zhang, Z. Effects of dietary supplementation with glutamine on the lymphocyte proliferation and intestinal immune gene expression in broiler chickens infected with Salmonella Enteritidis. Res. Vet. Sci. 2021, 139, 18–24. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Liu, N.; Hao, M.; Xie, Y.; Song, P. Effects of substitution of soybean meal with rapeseed meal and glutamine supplementation on growth performance, intestinal morphology, and intestinal mucosa barrier of Qiandongnan Xiaoxiang Chicken. Anim. Biosci. 2022, 35, 1711–1724. [Google Scholar] [CrossRef] [PubMed]
- Xing, S.; Zhang, B.; Lin, M.; Zhou, P.; Li, J.; Zhang, L.; Gao, F.; Zhou, G. Effects of alanyl-glutamine supplementation on the small intestinal mucosa barrier in weaned piglets. Asian-Australas. J. Anim. Sci. 2017, 30, 236–245. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.; Barekatain, R.; Wu, S.; Choct, M.; Swick, R. Dietary L-glutamine supplementation improves growth performance, gut morphology, and serum biochemical indices of broiler chickens during necrotic enteritis challenge. Poult. Sci. 2018, 97, 1334–1341. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Chen, H.; Du, J.; Tai, H.; Han, X.; Huang, N.; Wang, X.; Gong, H.; Yang, M.; Xiao, H. Glutamine Availability Regulates the Development of Aging Mediated by mTOR Signaling and Autophagy. Front. Pharmacol. 2022, 13, 924081. [Google Scholar] [CrossRef]
- Yi, D.; Hou, Y.; Wang, L.; Ouyang, W.; Long, M.; Zhao, D.; Ding, B.; Liu, Y.; Wu, G. L-Glutamine enhances enterocyte growth via activation of the mTOR signaling pathway independently of AMPK. Amino Acids 2015, 47, 65–78. [Google Scholar] [CrossRef]
- Xi, P.; Jiang, Z.; Dai, Z.; Li, X.; Yao, K.; Zheng, C.; Lin, Y.; Wang, J.; Wu, G. Regulation of protein turnover by L-glutamine in porcine intestinal epithelial cells. J. Nutr. Biochem. 2012, 23, 1012–1017. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wu, Q.J.; Wang, Y.Q.; Qi, Y.X. Influence of procyanidin supplementation on the immune responses of broilers challenged with lipopolysaccharide. Anim. Sci. J. 2017, 88, 983–990. [Google Scholar] [CrossRef] [PubMed]
- Ramires, C.C.; Balbinot, D.T.; Cidral-Filho, F.J.; Dias, D.V.; dos Santos, A.R.; da Silva, M.D. Acupuncture reduces peripheral and brainstem cytokines in rats subjected to lipopolysaccharide-induced inflammation. Acupunct. Med. 2021, 39, 376–384. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Liu, G.; Zhu, X.; Luo, Y.; Shang, Y.; Gu, X.-L. The anti-inflammatory and antioxidant effects of leonurine hydrochloride after lipopolysaccharide challenge in broiler chicks. Poult. Sci. 2019, 98, 1648–1657. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Liu, G.; Liang, X.; Wang, M.; Zhu, X.; Luo, Y.; Shang, Y.; Yang, J.Q.; Zhou, P.; Gu, X.L. Effects of berberine on the growth performance, antioxidative capacity and immune response to lipopolysaccharide challenge in broilers. Anim. Sci. J. 2019, 90, 1229–1238. [Google Scholar] [CrossRef] [PubMed]
- Sifa, D.; Bai, X.; Zhang, D.; Hu, H.; Wu, X.; Wen, A.; He, S.; Zhao, L. Dietary glutamine improves meat quality, skeletal muscle antioxidant capacity and glutamine metabolism in broilers under acute heat stress. J. Appl. Anim. Res. 2018, 46, 1412–1417. [Google Scholar] [CrossRef]
- Achamrah, N.; Déchelotte, P.; Coëffier, M. Glutamine and the regulation of intestinal permeability: From bench to bedside. Curr. Opin. Clin. Nutr. Metab. Care 2017, 20, 86–91. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Lin, M.; Yu, C.; Li, J.; Zhang, L.; Zhou, P.; Yang, W.; Gao, F.; Zhou, G. Alanyl-glutamine supplementation regulates mTOR and ubiquitin proteasome proteolysis signaling pathways in piglets. Nutrition 2016, 32, 1123–1131. [Google Scholar] [CrossRef] [PubMed]
- Newsholme, E.; Parry-Billings, M. Properties of glutamine release from muscle and its importance for the immune system. J. Parenter. Enter. Nutr. 1990, 14, 63S–67S. [Google Scholar] [CrossRef]
- Cruzat, V.; Macedo Rogero, M.; Keane, K.N.; Curi, R.; Newsholme, P. Glutamine: Metabolism and Immune Function, Supplementation and Clinical Translation. Nutrients 2018, 10, 1564. [Google Scholar] [CrossRef]
- Labow, B.I.; Souba, W.W.; Abcouwer, S.F. Mechanisms governing the expression of the enzymes of glutamine metabolism--glutaminase and glutamine synthetase. J. Nutr. 2001, 131, 2467S–2474S. [Google Scholar] [CrossRef]
- Karinch, A.M.; Pan, M.; Lin, C.-M.; Strange, R.; Souba, W.W. Glutamine metabolism in sepsis and infection. J. Nutr. 2001, 131, 2535S–2538S. [Google Scholar] [CrossRef]
- Xiao, Y.P.; Li, X.Y.; Wu, T.X.; Yang, L.; Hong, Q.H.; Yang, C.M.; Chen, A.G. Effects of dietary glutamine supplementation on nutrient absorption and activity of enzymes involved in glutamine metabolism and energy production in the jejunum of weaned piglets. J. Anim. Vetrinary Adv. 2012, 11, 1441–1449. [Google Scholar] [CrossRef]
- Cao, Y.; Liu, S.; Liu, K.; Abbasi, I.H.R.; Cai, C.; Yao, J. Molecular mechanisms relating to amino acid regulation of protein synthesis. Nutr. Res. Rev. 2019, 32, 183–191. [Google Scholar] [CrossRef]
- Frost, R.A.; Lang, C.H. mTOR signaling in skeletal muscle during sepsis and inflammation: Where does it all go wrong? Physiology 2011, 26, 83–96. [Google Scholar] [CrossRef]
- Dai, S.F.; Gao, F.; Zhang, W.H.; Song, S.X.; Xu, X.L.; Zhou, G.H. Effects of dietary glutamine and gamma-aminobutyric acid on performance, carcass characteristics and serum parameters in broilers under circular heat stres. Anim. Feed. Sci. Technol. 2011, 168, 51–60. [Google Scholar] [CrossRef]
- Nicklin, P.; Bergman, P.; Zhang, B.; Triantafellow, E.; Wang, H.; Nyfeler, B.; Yang, H.; Hild, M.; Kung, C.; Wilson, C.; et al. Bidirectional transport of amino acids regulates mTOR and autophagy. Cell 2009, 136, 521–534. [Google Scholar] [CrossRef] [PubMed]
- Lecker, S.H.; Goldberg, A.L.; Mitch, W.E. Protein degradation by the ubiquitin-proteasome pathway in normal and disease states. J. Am. Soc. Nephrol. 2006, 17, 1807–1819. [Google Scholar] [CrossRef]
- A Franch, H.; Price, S.R. Molecular signaling pathways regulating muscle proteolysis during atrophy. Curr. Opin. Clin. Nutr. Metab. Care 2005, 8, 271–275. [Google Scholar] [CrossRef] [PubMed]
- Crossland, H.; Constantin-Teodosiu, D.; Gardiner, S.M.; Constantin, D.; Greenhaff, P.L. A potential role for Akt/FOXO signalling in both protein loss and the impairment of muscle carbohydrate oxidation during sepsis in rodent skeletal muscle. J. Physiol. 2008, 586, 5589–5600. [Google Scholar] [CrossRef]
- Doyle, A.; Zhang, G.; Fattah, E.A.A.; Eissa, N.T.; Li, Y.-P. Toll-like receptor 4 mediates lipopolysaccharide-induced muscle catabolism via coordinate activation of ubiquitin-proteasome and autophagy-lysosome pathways. FASEB 2011, 25, 99–110. [Google Scholar] [CrossRef] [PubMed]
- Crossland, H.; Constantin-Teodosiu, D.; Greenhaff, P.L.; Gardiner, S.M. Low-dose dexamethasone prevents endotoxaemia-induced muscle protein loss and impairment of carbohydrate oxidation in rat skeletal muscle. J. Physiol. 2010, 588, 1333–1347. [Google Scholar] [CrossRef] [PubMed]
- Tan, H.W.S.; Sim, A.Y.L.; Long, Y.C. Glutamine metabolism regulates autophagy-dependent mTORC1 reactivation during amino acid starvation. Nat. Commun. 2017, 8, 338. [Google Scholar] [CrossRef]
- Lambertucci, A.C.; Lambertucci, R.H.; Hirabara, S.M.; Curi, R.; Moriscot, A.S.; Alba-Loureiro, T.C.; Guimarães-Ferreira, L.; Levada-Pires, A.C.; Vasconcelos, D.A.A.; Sellitti, D.F.; et al. Glutamine supplementation stimulates protein-synthetic and inhibits protein-degradative signaling pathways in skeletal muscle of diabetic rats. PLoS ONE 2012, 7, e50390. [Google Scholar] [CrossRef] [PubMed]
Ingredients (g/kg Diet) | Nutrient Content (g/kg Diet) | ||
---|---|---|---|
Maize | 563.0 | Crude protein ‡ | 210.8 |
Wheat bran | 51.30 | Metabolism energy (MJ/kg) | 121.2 |
Soybean meal | 285.0 | Calcium (%) | 10.00 |
Corn gluten meal | 43.0 | Phosphorus (%) | 4.50 |
DL-methionine | 1.50 | DL-methionine (%) | 8.60 |
Phytase | 0.40 | L-Lysine (%) | 10.60 |
Choline | 1.50 | Threonine (%) | 8.0 |
Dicalcium phosphate | 18.70 | ||
Limestone | 12.60 | ||
Salt | 1.50 | ||
Soybean oil | 16.50 | ||
Vitamin and mineral premix † | 5.00 |
Genes | ID | Primer Sequences (5′-3′) | Product Size (bp) |
---|---|---|---|
MAFbx | NM_001030956.1 | F: GCCAGTACCACTTCACAGACAGAC R: GCGTGTCACCATACTGCTCCTTC | 132 |
MuRF1 | XM_424369.4 | F: GAACGACCGCATCCAGACCATC R: TCCGTCTTCTTCTCCTCCAGCAG | 138 |
FOXO1 | NM_204328.1 | F: GACCTCATCACCAAGGCCATCG R: GCACGCTCTTGACCATCCACTA | 85 |
Akt | NM_205055.1 | F: GGCTACAAGGAACGACCGCAAG R: TACTGTGGTCCACTGGAGGCATC | 141 |
TLR4 | NM_001030693.1 | F: TTCGGTTGGTGGACCTGAATCTTG R: ACAGCTTCTCAGCAGGCAATTCC | 114 |
GA | NM_001031248.1 | F: TCCTCGCAGAGAAGGTGGTGATC R: TACGTGCAATGCTGTTCGTGAGTC | 154 |
S6K1 | NM_001030721.1 | F: GTTCAGGCTCACCCGTTCTTCAG R: TGGCTCACATCCTCTTCAGATTGC | 107 |
FOXO4 | XM_015278657.2 | F: CAACGTTCCACCACCCGTGA R: TGGAGGCAGATTGCTGGGTA | 101 |
TNF-α | NM_204267.1 | F: TGTGTATGTGCAGCAACCCG R: AACAACCAGCTATGCACCCC | 178 |
mTOR | XM_417614.6 | F: AACCACTGCTCGCCACAATGC R: CATAGGATCGCCACACGGATTAGC | 120 |
4E-BP1 | XM_424384.6 | F: GACCGTAAGTTCCTGATGGAGTGC R: ATTGGGCTGGTAACACCTGGAATG | 92 |
IL-1β | NM_204524.1 | F: AAGCCTCGCCTGGATTCTAG R: TCAGGTCGCTGTCAGCAAAG | 90 |
IL-6 | NM_204628.1 | F: TCCCTCCTCGCCAATCTGAA R: AAATAGCGAACGGCCCTCAC | 80 |
β-actin | NM_205518.1 | F: ATTGTCCACCGCAAATGCTTC R: AAATAAAGCCATGCCAATCTCGTC | 113 |
Treatment | TNF-α | IL-6 | IL-1β |
---|---|---|---|
Ala-saline | 1.15 | 1.04 bc | 1.00 b |
Ala-LPS | 1.87 | 1.48 a | 1.76 a |
Gln-saline | 0.52 | 0.98 c | 0.69 c |
Gln-LPS | 1.46 | 1.18 b | 1.03 b |
SEM | 0.108 | 0.044 | 0.084 |
Main effect | |||
Diet | |||
Ala | 1.51 a | 1.26 a | 1.38 a |
Gln | 0.99 b | 1.08 b | 0.86 b |
Stress | |||
Saline | 0.84 b | 1.01 b | 0.85 b |
LPS | 1.67 a | 1.33 a | 1.40 a |
p-value | |||
Gln | <0.001 | <0.001 | <0.001 |
LPS | <0.001 | <0.001 | <0.001 |
Gln × LPS | 0.117 | 0.005 | <0.001 |
Treatment | ALT (u/g of Protein) | AST (u/g of Protein) |
---|---|---|
Ala-saline | 2.93 | 22.97 |
Ala-LPS | 2.43 | 16.49 |
Gln-saline | 3.05 | 27.79 |
Gln-LPS | 2.68 | 24.63 |
SEM | 0.542 | 4.587 |
Main effect | ||
Diet | ||
Ala | 2.68 | 19.73 b |
Gln | 2.87 | 26.21 a |
Stress | ||
Saline | 2.99 | 25.38 a |
LPS | 2.56 | 20.56 b |
p-value | ||
Gln | 0.603 | <0.001 |
LPS | 0.236 | 0.002 |
Gln × LPS | 0.848 | 0.160 |
Treatment | TLR4 | Akt | FOXO4 | FOXO1 | MAFbx | MuRF1 |
---|---|---|---|---|---|---|
Ala-Saline | 1.00 c | 1.00 | 0.99 | 1.04 b | 1.0 | 1.07 c |
Ala-LPS | 1.43 a | 0.59 | 1.42 | 2.93 a | 1.4 | 2.81 a |
Gln-Saline | 0.86 d | 1.39 | 0.92 | 0.94 b | 0.69 | 1.03 c |
Gln-LPS | 1.01 b | 0.96 | 1.11 | 1.28 b | 1.14 | 1.47 b |
SEM | 0.234 | 0.301 | 0.249 | 0.868 | 0.292 | 0.762 |
Main Effect | ||||||
Diet | ||||||
Ala | 1.22 a | 0.80 b | 1.21 a | 1.99 a | 1.29 a | 1.94 a |
Gln | 0.94 b | 1.18 a | 1.02 b | 1.11 b | 0.92 b | 1.25 b |
Stress | ||||||
Saline | 0.93 b | 1.20 a | 0.96 b | 0.99 b | 0.89 b | 1.05 b |
LPS | 1.22 a | 0.78 b | 1.27 a | 2.11 a | 1.32 a | 2.14 a |
p Value | ||||||
Gln | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
LPS | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
Gln × LPS | 0.002 | 0.932 | 0.091 | <0.001 | 0.266 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, B.; Yang, Q.; Liu, N.; Zhong, Q.; Sun, Z. The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers. Animals 2024, 14, 480. https://doi.org/10.3390/ani14030480
Zhang B, Yang Q, Liu N, Zhong Q, Sun Z. The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers. Animals. 2024; 14(3):480. https://doi.org/10.3390/ani14030480
Chicago/Turabian StyleZhang, Bolin, Qian Yang, Ning Liu, Qingzhen Zhong, and Zewei Sun. 2024. "The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers" Animals 14, no. 3: 480. https://doi.org/10.3390/ani14030480