Spoink, a LTR retrotransposon, invaded D. melanogaster populations in the 1990s

Riccardo Pianezza; Almorò Scarpa; Prakash Narayanan; Sarah Signor; Robert Kofler

doi:10.1371/journal.pgen.1011201

Abstract

During the last few centuries D. melanogaster populations were invaded by several transposable elements, the most recent of which was thought to be the P-element between 1950 and 1980. Here we describe a novel TE, which we named Spoink, that has invaded D. melanogaster. It is a 5216nt LTR retrotransposon of the Ty3/gypsy superfamily. Relying on strains sampled at different times during the last century we show that Spoink invaded worldwide D. melanogaster populations after the P-element between 1983 and 1993. This invasion was likely triggered by a horizontal transfer from the D. willistoni group, much as the P-element. Spoink is probably silenced by the piRNA pathway in natural populations and about 1/3 of the examined strains have an insertion into a canonical piRNA cluster such as 42AB. Given the degree of genetic investigation of D. melanogaster it is perhaps surprising that Spoink was able to invade unnoticed.

Author summary

Horizontal transfer of transposable elements (TE) is a major factor driving genome evolution. Yet well documented cases of such horizontal transfer events are rare. Most evidence is indirect, relying on sequence similarity of TEs between species. Based on strains sampled during the last decades we provide direct evidence that the retrotransposon Spoink was absent in worldwide D. melanogaster populations before 1983 but present in populations after 1993. We suggest that the Spoink invasion was triggered by a horizontal transfer from a Drosophila species of the willistoni group.

Citation: Pianezza R, Scarpa A, Narayanan P, Signor S, Kofler R (2024) Spoink, a LTR retrotransposon, invaded D. melanogaster populations in the 1990s. PLoS Genet 20(3): e1011201. https://doi.org/10.1371/journal.pgen.1011201

Editor: Cédric Feschotte, Cornell University, UNITED STATES

Received: November 28, 2023; Accepted: February 27, 2024; Published: March 26, 2024

Copyright: © 2024 Pianezza et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The consensus sequence of Spoink as well as the sequences of the six PCR amplicons are available at https://github.com/rpianezza/Dmel-Spoink/tree/main/releasedseqs. The tool LTRtoTE is available on GitHub (https://github.com/Almo96/LTRtoTE). The analysis performed in this work have been documented with RMarkdown and have been made publicly available, together with the resulting figures, at GitHub (https://github.com/rpianezza/Dmel-Spoink; see *.md files).

Funding: This work was supported by the National Science Foundation Established Program to Stimulate Competitive Research grants NSF-EPSCoR-1826834 and NSF-EPSCoR-2032756 to SS, and by the Austrian Science Fund (FWF) grants P35093 and P34965 to RK. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Transposable elements (TEs) are short genetic elements that can increase in copy number within the host genome. They are abundant in most organisms and can make up the majority of some genomes, i.e. maize where TEs constitute 83% of the genome [1]. There are two classes of TEs which transpose by different mechanisms—DNA transposons which replicate by directly moving to a new genomic location in a ‘cut and paste’ method, and retrotransposons which replicate through an RNA intermediate in a ‘copy and paste’ method [2–4]. From humans to flies, more genetic variation (in bp) is due to repetitive sequences such as transposable elements than all single nucleotide variants combined [5]. Although some TEs, such as R1 and R2 elements, may benefit hosts [6, 7] most TE insertions are thought to be deleterious [8, 9]. Host genomes have therefore evolved an elaborate system of suppression frequently involving small RNAs [10]. Suppression of TEs in Drosophila relies upon small RNAs termed piRNA, which are cognate to TE sequences [11–13]. These small RNAs bind to PIWI clade proteins and mediate the degradation of TE transcripts and the formation of heterochromatin silencing the TE [11, 14–19]. However, while host defenses quickly adapt to new transposon invasions, TEs can escape silencing through horizontal transfer to new, defenseless, genomes [20–23]. This horizontal transfer allows TEs to colonize the genomes of novel species [20, 23–26]. The first well-documented instance of horizontal transfer of a TE was the P-element, which spread from D. willistoni to D. melanogaster [27]. Following this horizontal transfer the P-element invaded natural D. melanogaster populations between 1950 and 1980 [28, 29]. It was further realized that the I-element, Hobo and Tirant spread in D. melanogaster populations earlier than the P-element, between 1930 and 1960 [29–31]. The genomes from historical D. melanogaster specimens collected about two hundred years ago, recently revealed that Opus, Blood, and 412 spread in D. melanogaster populations between 1850 and 1933 [21]. In total, it was suggested that seven TEs invaded D. melanogaster populations during the last two hundred years where one invasion (the P-element) was triggered by horizontal transfer from a species of the willistoni group and six invasions by horizontal transfer from the simulans complex [21, 27, 31–34].

It was, however, widely assumed until now that the P-element invasion, which occurred between 1950–1980, was the last and most recent TE invasion in D. melanogaster [21, 29, 31, 35, 36]. Here we report the discovery of Spoink, a novel TE which invaded worldwide D. melanogaster populations between 1983 and 1993, i.e. after the invasion of the P-element. Spoink is a LTR retrotransposon of the Ty3/gypsy group. We suggest that the Spoink invasion in D. melanogaster was triggered by horizontal transfer from a species of the willistoni group, similarly to the P-element invasion in D. melanogaster. In a model species as heavily investigated as D. melanogaster it is perhaps surprising that Spoink was able to invade undetected.

Materials and methods

Discovery of the recent Spoink invasion

We identified TE insertions in different long-read assemblies using RepeatMasker [37] and the TE library from [5]. When comparing the TE composition between strains collected in the 1950’s and 1960’s [38, 39] and more recently collected strains (≥ 2003 [40] we noticed an element labeled ‘gypsy-7_DEl’ which was only present in short degraded copies in the older genomes but was present in full length copies in the more recent genomes (S1 Table).

Structure and classification of Spoink

To generate a consensus sequence of Spoink we extracted the sequence of full-length matches of ‘gypsy-7_DEl’ plus some flanking sequences from long-read assemblies [Ten-15, RAL91, RAL176, RAL732, RAL737, Sto-22; [40]] and made a consensus sequence by performing multiple sequence alignment (MSA) with MUSCLE (v3.8.1551) [41] and then choosing the most abundant nucleotide in each position of the MSA with a custom Python script (MSA2consensus).

The consensus sequence of the LTR was used to identify the TSD with our new tool LTRtoTE (https://github.com/Almo96/LTRtoTE). We used LTRdigest to identify the PBS of Spoink [42].

We picked several sequences from each of the known LTR superfamily/groups using the consensus sequences of known TEs [2, 43] (v9.44). We performed a blastx search against the NCBI database to identify the RT domain in the consensus sequences of the TE [44]. We then performed a multiple sequence alignment of the amino-acid sequences of the RT domain using MUSCLE (v3.8.1551) [41]. We obtained the xml file using BEAUti2 [45] (v2.7.5) and generated the trees with BEAST (v2.7.5) [45]. The maximum credibility tree was built using TreeAnnotator (v2.7.5) [45] and visualized with FigTree (v1.4.4, http://tree.bio.ed.ac.uk/software/figtree/).

Distribution of Spoink insertions

Genes were annotated in each of the 31 genomes from [40] using the annotation of the reference genome of D. melanogaster (6.49; Flybase) and liftoff 1.6.3 [46, 47]. The 1kb regions upstream of each gene were classified as putative promotors. The location of canonical D. melanogaster piRNA clusters was determined using CUSCO, which lifts over the flanks of known clusters in a reference genome to locate the homologous region in a novel genome [48]. The location of Spoink insertions within genes or clusters was determined with bedtools intersect [49]. To determine if genic insertions were shared or independent, the sequence of the insertion was extracted from each genome along with an extra 1 kb of flanking sequence on each end. Insertions purportedly in the same gene were then aligned, and if the flanks aligned they were considered shared insertions. To determine if cluster insertions were shared the flanking TE regions were aligned using Manna, which aligns TE annotations rather than sequences, to determine if there was any shared synteny in the surrounding TEs [50].

Abundance of Spoink insertions in different D. melanogaster strains

We investigated the abundance of Spoink in multiple publicly available short-read data sets [31, 40, 51–53]. These data include genomic DNA from 183 D. melanogaster strains sampled at different geographic locations during the last centuries. For an overview of all analysed short-read data see S5 Table. We mapped the short reads to a database consisting of the consensus sequences of TEs [43] (v9.44), the sequence of Spoink and three single copy genes (rhi, tj, RpL32) with bwa bwasw (version 0.7.17-r1188) [54]. We used DeviaTE (v0.3.8) [55] to estimate the abundance of Spoink. DeviaTE estimates the copy number of a TE (e.g. Spoink) by normalizing the coverage of the TE by the coverage of the single copy genes. We also used DeviaTE to visualize the abundance and diversity of Spoink as well as to compute the frequency of SNPs in Spoink (see below).

To identify Spoink insertions in 49 long-read assemblies of D. melanogaster strains collected during the last 100 years we used RepeatMasker [37] (open-4.0.7; -no-is -s -nolow). For an overview of all analysed assemblies see S6 Table [39, 40, 48, 56]. For estimating the abundance of Spoink in the long-read assemblies we solely considered canonical Spoink insertions (> 80% of length, < 5% sequence divergence).

Population frequency of Spoink insertions

For every putative Spoink insertion (including degraded ones) in the eight long-read assemblies of individuals from Raleigh [40], we extracted the sequence of the insertion plus 1 kb of flanking sequence with bedtools [49]. The sequence of the Spoink insertion was removed with seqkit [57] and the flanking sequences were mapped to the AKA017 genome (i.e. the common coordinate system) with minimap2 allowing for spliced mappings [40, 57, 58]. The mapping location of each read was extracted and if they overlapped between strains they were considered putative shared sites. Regions with overlapping reads were visually inspected in IGV (v2.4.14) and if the mapping location was shared they were considered shared insertions sites [59, 60].

PCR

To validate whether Spoink is absent in old D. melanogaster strains but present in recent strains we used PCR. We designed two primers pairs for Spoink and one for vasa as a control. We extracted DNA from different strains of D. melanogaster (Lausanne-S, Hikone-R, iso-1, RAL59, RAL176, RAL737) using a high salt extraction protocol [61]. We designed two primers pairs for Spoink (P1,P2) and one for the gene vasa (P1 FWD TCAGAAGTGGGATCGGGCTCGG, P1 REV CAGTAGAGCACCATGCCGACGC, P2 FWD ATGGACCGTAATGGCAGCAGCG, P2 REV ACACTCCGCGCCAGAGTCAAAC, Vasa FWD AACGAGGCGAGGAAGTTTGC, Vasa REV GCGATCACTACATGGCAGCC). We used the following PCR conditions: 1 cycle of 95°C for 3 minutes; 33 cycles of 95°C for 30 seconds, 58°C for 30 seconds and 72°C for 20 seconds; 1 cycle of 72°C for 6 minutes.

Small RNAs

To identify piRNAs complementary to Spoink we analysed the small-RNA data from 10 GDL strains [62]. The adaptor sequence GAATTCTCGGGTGCCAAGG was removed using cutadapt (v4.4 [63]). We filtered for reads having a length between 18 and 36nt and aligned the reads to a database consisting of D. melanogaster miRNAs, mRNAs, rRNAs, snRNAs, snoRNAs, tRNAs [64], and TE sequences [43] with novoalign (v3.09.04). We used previously developed Python scripts [65] to compute ping-pong signatures and to visualize the piRNA abundance along the sequence of Spoink.

UMAP

We used the frequencies of SNPs in the sequence of Spoink to compute the UMAP. This frequencies reflect the Spoink composition in a given sample. For example if a specimen has 20 Spoink insertions and a biallelic SNP with a frequency of 0.8 at a given site in Spoink than about 16 Spoink insertions will have the SNP and 4 will not have it. The frequency of the Spoink SNPs was estimated with DeviaTE [55]. Solely bi-allelic SNPs were used and SNPs only found in few samples were removed (≤3 samples). UMAPs were created in R (umap package; v0.2.10.0 [66]).

Origin of horizontal transfer

To identify the origin of the horizontal transfer of Spoink we used RepeatMasker [37] (open-4.0.7; -no-is -s -nolow) to identify sequences with similarity to Spoink in the long-read assemblies of 101 drosophilid species and in 99 different insect species [67, 68] (S8 Table). We included the long-read assembly of the D. melanogaster strain RAL737 and of the D. simulans strain SZ129 in the analysis [23, 40]. We used a Python script to identify in each assembly the best hit with Spoink (i.e. the highest alignment score) and than estimated the similarity between this best hit and Spoink. The similarity was computed as s = rms_best/rms_max, where rms_best is the highest RepeatMasker score (rms) in a given assembly and rms_max the highest score in any of the analysed assemblies. A s = 0 indicates no similarity to the consensus sequence of Spoink whereas s = 1 represent the highest possible similarity. To generate a phylogenetic tree we identified Spoink insertions in the assemblies of the 101 drosophilid species and RAL737 using RepeatMasker. We extracted the sequences of full-length insertions (> 80% of the length) from species having at least one full-length insertion using bedtools [49] (v2.30.0). A multiple sequence alignment of the Spoink insertions was generated with MUSCLE (v3.8.1551) [41] and a tree was generated with BEAST (v2.7.5) [45].

Results

Previous work showed that at least seven TE families invaded D. melanogaster populations during the last two hundred years [21, 29, 31]. To explore whether additional, hitherto poorly characterised TEs could have invaded D. melanogaster, we investigated long-read assemblies of recently collected D. melanogaster strains [40] using a newly assembled repeat library [5]. Interestingly we found differences in the abundance of “gypsy_7_DEl” between the reference strain Iso-1 and more recently collected D. melanogaster strains (S1 Table). To better characterize this TE, we generated a consensus sequence based on the novel insertions and checked if this consensus sequence matches any of the repeats described in repeat libraries generated for D. melanogaster and related species [5, 40, 43, 69, 70]. A fragmented copy of this TE, with just one of the two LTRs being present, was reported by [40] (0.13% divergence; “con41_UnFmcl001_RLX-incomp”; S2 Table). The next best hits were gypsy7 Del, gypsy2 DSim, micropia and Invader6 (18–30% divergence; S2 Table). Given this high sequence divergence from previously described TE families and the fact that this novel TE belongs to an entirely different superfamily/group than gypsy7 (see below), we decided to give this TE a new name. We call this novel TE “Spoink” inspired by a Pokémon that needs to continue jumping to stay alive.

Spoink is an LTR retrotransposon with a length of 5216 bp and LTRs of 349 bp (Fig 1A; for coordinates of the analysed insertions see S3 Table). At positions 4639–4700 Spoink contains a poly-A tract, which length may differ by a few bases between insertions. Spoink encodes a 695 aa putative gag-pol polyprotein. Ordered from the N- to the C-terminus, the conserved domains of the polyprotein are: reverse transcriptase of LTR (e-value = 2.2e − 59; CDD v3.20 [71]), RNase HI of Ty3/gypsy elements (e-value = 1.65e − 48;) and integrase zinc binding domain (e-value = 4.81e − 16). Spoink lacks an env. The order of these domains, with the integrase downstream of the reverse transcriptase, is typical for Ty3/gypsy transposons [72].

Download:

Fig 1. Spoink is a novel TE of the Ty3/gypsy superfamily.

A) Overview of the composition of Spoink. Features are shown in color and the alignments show the sequences around the main features of Spoink for two insertions in each of three different long-read assemblies of D. melanogaster. B) Phylogenetic tree based on the reverse-transcriptase domain of pol for Spoink and several other LTR retrotransposons. Multiple families have been picked for each of the main superfamilies/groups of LTR transposons [2]. Our data suggest that Spoink is a member of the gypsy/mdg3 group.

https://doi.org/10.1371/journal.pgen.1011201.g001

A phylogeny based on the reverse transcriptase domain of different TE families suggests that Spoink is a member of the gypsy/mdg3 superfamily/group of LTR retrotransposons (Fig 1B; [2]). As expected for members of the Ty3/gypsy superfamily, Spoink generates a target site duplication of 4 bp and it has an insertion motif enriched for ATAT (Fig 1A; [2, 73]). A gag-pol polyprotein as encoded by Spoink was observed for some Ty3/gypsy transposons [74, 75] but not for others [72]. However, Spoink differs from what is expected for the Ty3/gypsy superfamily in two ways. First, the predicted primer binding site of Spoink directly follows the LTR, whereas typically for Ty3/gypsy there is a shift of 5–8nt (Fig 1A; [2]). Second, the LTR motif is TG…TA which is different from the TG…CA motif usually reported for gypsy TEs [2].

Finally we investigated the genomic distribution of Spoink insertions in long-read assemblies of D. melanogaster strains collected ≥ 2003 [40]. In total, these assemblies contains 481 full-length (> 80% length with at least one LTR) insertions of Spoink (on the average 16 per genome). Unlike the P-element which has a strong insertion bias into promoters, Spoink insertions are mostly found in introns and intergenic regions (S1 Fig). 54% of the Spoink insertions are in 201 different genes. Interestingly we found 7 independent Spoink insertions in Myo83F.

To summarize we characterized a novel LTR-retrotransposon of the Ty3/gypsy superfamily in the genome of D. melanogaster that we call Spoink.

Spoink recently invaded worldwide D. melanogaster populations

To substantiate our hypothesis that Spoink recently invaded D. melanogaster we used three independent approaches: Illumina short read data, long-read assemblies, and PCR/Sanger sequencing. First we aligned short reads from a strain collected in 1958 (Hikone-R) and a strain collected in 2015 (Ten-15) [31, 40] to the consensus sequence of Spoink using DeviaTE [55]. DeviaTE estimates the abundance of Spoink insertions by normalizing the coverage of Spoink to the coverage of a sample of single-copy genes. Furthermore, DeviaTE is useful for generating an intuitive visualization of the abundance and composition (i.e. SNPs, indels, truncations) of Spoink in samples. We found that only a few degraded reads aligned to Spoink in the 1950’s strain (Hikone-R) whereas many reads covered the sequence of Spoink in the more recently collected strain Ten-15 (Fig 2A). There were also very few SNPs or indels in the recently collected strain suggesting that most insertions have a very similar sequence (Fig 2A). This observation holds true when multiple old and young D. melanogaster strains are analysed (S2 Fig).

Download:

Fig 2. Spoink invaded D. melanogaster.

A) DeviaTE plots of Spoink for a strain collected in 1954 (Hikone-R) and a strain collected in 2015 (Ten-15). Short reads were aligned to the consensus sequence of Spoink and the coverage was normalized to the coverage of single-copy genes. The coverage based on uniquely mapped reads is shown in dark grey and light grey is used for ambiguously mapped reads. Single-nucleotide polymorphisms (SNPs) and small internal deletions (indels) are shown as colored lines. The coverage was manually curbed at the poly-A track (between dashed lines). B) Insertions with a similarity to the consensus sequence of Spoink in the long-read assemblies of Oregon-R (collected around 1925) and the more recently collected strain RAL737 (2003). C) PCR results for two Spoink primer pairs (for location of primers see sketch at bottom) and one primer pair for the gene vasa. Spoink is absent in old strains (Lausanne-S, Hikone-R and Iso-1) and present in more recently collected strains (RAL59, RAL176, RAL737). D) Population frequency of Spoink insertions in long-read assemblies of strains collected in 2003 from Raleigh [40]. Note that highly diverged insertions are largely segregating at a high frequency while canonical Spoink insertions mostly segregate at a low frequency.

https://doi.org/10.1371/journal.pgen.1011201.g002

Next we investigated the abundance of Spoink in long-read assemblies of a strain collected in 1925 (Oregon-R) and a strain collected in 2003 (RAL737). We found solely highly diverged and fragmented copies of sequences with similarity to Spoink in Oregon-R (Fig 2B). These degraded fragments were mostly found near the centromeres of Oregon-R. Investigating the identity of these degraded fragments of Spoink in more detail we found that they largely match with short and highly diverged fragments of Invader6, micropia and the Max-element (S4 Table). In addition to these degraded fragments, the more recently collected strain RAL737 also carries a large number of full-length insertions with a high similarity to the consensus sequence of Spoink (henceforth canonical Spoink insertions; Fig 2B). The canonical Spoink insertions are distributed all over the chromosomes of RAL737 (Fig 2B). This observation is again consistent when several long-read assemblies of old and young D. melanogaster strains are analysed (S3 Fig).

Finally we used PCR to test whether Spoink recently spread in D. melanogaster. We designed two PCR primer pairs for Spoink and, as a control, one primer pair for vasa (Fig 2C; bottom panel). The Spoink primers amplified a clear band in three strains collected 2003 in Raleigh but no band was found in earlier collected strains, including the reference strain of D. melanogaster, Iso-1 (Fig 2C). We sequenced the fragments amplified by the Spoink primers using Sanger sequencing and found that the sequence of the six amplicons matches with the consensus sequence of Spoink (S4 Fig).

Finally we investigated the population frequency of canonical and degraded Spoink insertions. Using the long-read assemblies of eight strains collected in 2003 in Raleigh we computed the population frequency of different Spoink insertions. We found that canonical Spoink insertions (< 5% divergence) are largely segregating at a low population frequency, as expected for recently active TEs (Fig 2D). While several degraded fragments that were annotated as Spoink are private, there were many at a higher population frequency as expected for older sequences (Fig 2D).

In summary our data suggest that Spoink recently spread in D. melanogaster and that degraded fragments with some similarity to Spoink are present in heterochromatic regions of the centromeres of all investigated D. melanogaster strains. These degraded fragments may be the remnants of more ancient invasions of TEs sharing some sequence similarity with Spoink.

Timing the Spoink invasion

Next we sought to provide a more accurate estimate of the time when Spoink spread in D. melanogaster. First we generated a rough timeline of the Spoink invasion using D. melanogaster strains sampled during the last two hundred years. We estimated the abundance of Spoink in these strains using DeviaTE [55]. As reference we also estimated the abundance of the P-element, which is widely assumed as to be the most recent TE that invaded D. melanogaster populations [28, 31]. Spoink was absent from all strains collected ≤1983 but present in strains collected ≥1993 (Fig 3A). By contrast our data suggest that the P-element was absent in the strains collected ≤ 1962 but present in strains collected ≥1967 (Fig 3A). This is consistent with previous works suggesting that the P-element invaded D. melanogaster between 1950 and 1980 [21, 29, 35, 36]. Our data thus suggest that Spoink invaded D. melanogaster after the P-element invasion. To investigate the timing of the invasion in more detail we estimated the abundance of Spoink in short-read data of 183 strains collected between 1960 and 2015 from different geographic regions using DeviaTE (S5 Table; data from [31, 40, 51–53]). The analysis of these 183 strains supports the view that Spoink was largely absent in strains collected ≤ 1983 but present in strains collected ≥ 1993 (Fig 3B). However there are two outliers. Spoink is present in one strain collected in 1979 in Providence (USA), which could be due to a contamination of the strain. On the other hand Spoink is absent in one strain collected in 1993 in Zimbabwe (Fig 3B). As Spoink was present in six other strains collected in 1993 from Zimbabwe, it is feasible that Spoink was still spreading in populations from Zimbabwe around 1993. The strains supporting the absence of Spoink prior to 1983 were collected from Europe, America, Asia and Africa while the strains supporting the presence of Spoink after 1993 were collected from all five continents (S5 Table).

Download:

Fig 3. Spoink invaded D. melanogaster between 1983 and 1993 after the invasion of the P-element.

A) Rough timeline of the Spoink and P-element invasion based on different strains sampled during the last two hundred years. The numbers represent the estimated copy number of Spoink and P-element based on DeviaTE. B) Timeline of the Spoink and P-element invasion based on 183 strains sampled between 1960 and 2015. The intensity of the color varies due to overlapping dots C) Abundance of canonical Spoink insertions (> 80% length and < 5% divergence) in long-read assemblies of D. melanogaster strains collected between 1925 and 2018.

https://doi.org/10.1371/journal.pgen.1011201.g003

Finally we estimated the abundance of Spoink in 49 long-read assemblies of strains collected during the last 100 years (S6 Table; [39, 40, 48, 56]). We used RepeatMasker [37] to estimate the abundance of canonical Spoink insertions (> 80% length and < 5% divergence) in these strains. Canonical Spoink insertions were absent in strains collected before 1975 but present in all long-read assemblies of strains collected after 2003 (Fig 3C). The strains of the assemblies supporting the absence of canonical Spoink insertions were collected from America, Europe, Asia, and Africa whereas the strains showing the presence of Spoink were largely collected from Europe, though genomes from North America and Africa are also represented (S6 Table).

In summary we conclude that Spoink invaded worldwide populations of D. melanogaster approximately between 1983 and 1993. Moreover, the Spoink invasion is more recent than the P-element invasion.

Geographic heterogeneity in the Spoink sequence variation

Previous work showed that the composition of TEs within a species may differ among geographic regions [21, 31]. Such geographic heterogeneity could result from founder effects occurring during the geographic spread of a TE. For example, a TE spreading in a species with a cosmopolitan distribution such as D. melanogaster may need to overcome geographic obstacles such as oceans and deserts. The few individuals that overcome these obstacles, thereby spreading the TE into hitherto naive populations, may carry slightly different variants of the TE than the source populations. These distinct variants will then spread in the new population. Such founder effects during the invasion may lead to a geographically heterogeneous composition of a TE within a species. For example, for the retrotransposon Tirant, individuals sampled from Tasmania carry distinct variants [31], while for 412 and Opus individuals from Zimbabwe are distinct from the other populations [21]. To investigate whether we find such geographic heterogeneity we analysed the Spoink composition in the Global Diversity Lines (GDL), which comprise 85 D. melanogaster strains sampled after 1988 from five different continents (Africa—Zimbabwe, Asia—Beijing, Australia—Tasmania, Europe—Netherlands, America—Ithaca; [51]). Except for a single strain from Zimbabwe all GDL strains harbour Spoink insertions (S5 Fig). We estimated the allele frequency of SNPs in Spoink, where a SNP refers to a variant among dispersed copies of Spoink. The allele frequency estimate thus reflects the composition of Spoink within a particular strain. To summarize differences in the composition among the GDL strains we used UMAP [76]. We found that the composition of Spoink varies among regions where three distinct groups can be distinguished: Tasmania, Bejing/Ithaca and Netherlands/Zimbabwe (S5 Fig). It is interesting that clusters are formed by geographically distant populations such as Bejing (Asia) and Ithaca (America). We speculate that human activity, where flies might for example hitchhike with merchandise, could be responsible for this pattern. In summary, we found a geographically heterogeneous composition of Spoink which is likely due to founder effects occurring during the spread of this TE.

Spoink is silenced by the piRNA pathway in natural populations

The host defence against TEs in Drosophila is based on small RNAs termed piRNAs. These piRNAs bind to PIWI clade proteins and silence a TE at the transcriptional as well as the post-transcriptional level [11, 12, 14, 77]. To test whether Spoink is silenced in D. melanogaster populations we investigated small RNA data from the GDL lines [62]. Small RNA were sequenced for 10 out of the 84 GDL lines such that two strains were picked from each of the five continents [62].

We find piRNAs mapping along the sequence of Spoink in the GDL strain I17 which was collected in 2004 but not in the strain Lausanne-S which was sampled around 1938 (Fig 4A; [78]). piRNAs mapping to Spoink were further found for all 10 GDL strains (S6 Fig).

Download:

Fig 4.

A piRNA based defence against Spoink emerged in D. melanogaster A) piRNAs mapping to Spoink in a strain sampled 1938 (Lausanne-S) and 2004 (I17). The transposon HMS Beagle is included as reference. Solely the 5’ positions of piRNAs are shown and the piRNA abundance is normalized to one million piRNAs. Sense piRNAs are shown on the positive y-axis and antisense piRNAs on the negative y-axis. B) Ping-pong signature for the piRNAs mapping to Spoink and HMS Beagle in the D. melanogaster strain I17 (2004).

https://doi.org/10.1371/journal.pgen.1011201.g004

An important feature of germline piRNA activity in D. melanogaster is the ping-pong cycle [11, 12]. An active ping-pong cycle generates a characteristic overlap between the 5’ positions of sense and antisense piRNAs, i.e. the ping-pong signature. Computing a ping-pong signature thus requires several overlapping sense and antisense piRNAs. Since the amount of piRNAs was too low we could not compute a ping-pong signature for the strain Lausanne-S (collected in 1938; see above). However we found a pronounced ping-pong signature in all 10 GDL samples (Fig 4B and S6 Fig).

It is an important open question as to which events trigger the emergence of piRNA based host defence. The prevailing view, the trap model, holds that the piRNA based host defence is initiated by a copy of the TE jumping into a piRNA cluster [17, 25, 79–81]. If this is true we expect Spoink insertions in piRNA clusters in each of the long-read assemblies of the recently collected D. melanogaster strains [40]. We identified the position of piRNA clusters in these long-read assemblies based on unique sequences flanking the piRNA clusters [48]. Interestingly, we found an extremely heterogeneous abundance of Spoink insertions in piRNA clusters, where some strains (e.g. RAL176) have up to 14 cluster insertions whereas 18 out of 31 strains did not have a single cluster insertion (S7 Table). Three of the cluster insertions were into 42AB, which usually generates the most piRNAs [11, 69]. It is an important open question whether such a heterogeneous distribution of Spoink insertions in piRNA clusters is compatible with the trap model [82, 83]. In summary we found evidence that Spoink is silenced by the piRNA pathway but the number of Spoink insertions in piRNA clusters is very heterogeneous among strains.

Origin of Spoink

The invasion of Spoink in D. melanogaster was likely triggered by horizontal transfer from a different species. To identify the source of the horizontal transfer we investigated the long-read assemblies of 101 Drosophila species [67] (and D. simulans strain SZ129) and of 99 insect species [23, 67, 68] (S8 Table). We did not consider short-read assemblies, as TEs may be incompletely represented in them [48]. Apart from D. melanogaster we found insertions with a high similarity to Spoink in D. sechellia, in one out of two D. simulans assemblies (in SZ129 but not in 006), and species of the willistoni group, in particular D. willistoni (Fig 5A). In agreement with this, a sequence from D. willistoni with a high similarity to Spoink can be found in RepBase (Gypsy-78_DWil; I: 99.73% similarity, LTR: 93.54% similarity [84]). Spoink insertions with a somewhat smaller similarity were found in D. cardini and D. repleta. No sequences similar to Spoink were found in the 99 insect species (S7 Fig). To further shed light on the origin of the Spoink invasion we constructed a phylogenetic tree with full-length insertions of Spoink in D. melanogaster, D. sechellia, D. simulans (SZ129) D. cardini and species of the willistoni group (Fig 5B and for a star phylogeny see S8 Fig). We did not find a full-length insertion of Spoink in D. repleta. This tree reveals that Spoink insertions in D. sechellia and D. simulans have very short branches. Furthermore, in D. simulans just one out of the two analysed assemblies has Spoink insertions. We thus suggest that the Spoink invasion in these two species is also of recent origin (manuscript in preparation).

Download:

Fig 5. The Spoink invasion in D. melanogaster was likely triggered by a horizontal transfer from a species of the willistoni group.

A) Similarity of TE insertions in long-read assemblies of diverse drosophilid species to Spoink. The barplots show for each species the similarity between Spoink and the best match in the assembly. For example, a value of 0.9 indicates that at least one insertion in an assembly has a high similarity (≈ 90%) to the consensus sequence of Spoink. B) Bayesian tree of Spoink insertions in the different drosophilid species. Only full-length insertions of Spoink (> 80% of the length) were considered. Node support values are posterior probabilities estimated by BEAST [45]. Note that Spoink insertions of D. melanogaster are nested in insertions from the willistoni group (blue shades).

https://doi.org/10.1371/journal.pgen.1011201.g005

However, Spoink insertions in D. melanogaster are nested within insertions from species of the willistoni group (Fig 5B). Our data thus suggest that, similar to the P-element invasion in D. melanogaster [27], the Spoink invasion in D. melanogaster was also triggered by horizontal transfer from a species of the willistoni group. The synonymous divergence of Spoink is lower than for any of 140 single copy orthologous genes shared between D. melanogaster and D. willistoni, further supporting the recent horizontal transfer of Spoink (S9 Fig) [20, 85, 86]. Species of the willistoni group are Neotropical, occurring throughout Central and South America [87–89]. Therefore horizontal transfer of Spoink only became feasible after D. melanogaster extended its habitat into the Americas approximately 200 years ago [90–92]. Insertions of D. cardini are next to species of the willistoni group, suggesting that D. cardini also acquired Spoink by horizontal transfer from the willistoni group, likely independent of D. melanogaster (Fig 5B). D. cardini is also a Neotropical species and its range overlaps many species of the willistoni group, thus horizontal transfer between the species is physically feasible [93, 94].

In summary, similarly to the P-element, horizontal transfer from a species of the willistoni group likely triggered the Spoink invasion in D. melanogaster.

Discussion

Here we suggest that the LTR-retrotransposon Spoink invaded D. melanogaster populations between 1983 and 1993, after the spread of the P-element. Similarly to the P-element, the Spoink invasion was likely triggered by horizontal transfer from a species in the willistoni group. Horizontal transfer of a TE is usually inferred from three lines of evidence: i) a patchy distribution of the TE among closely related species, ii) a phylogenetic discrepancy between the TE and the host species and iii) a high similarity between the TE of the donor and recipient species, which is frequently quantified by the synonymous divergence of the TE [95, 96]. All of these three lines of arguments support a horizontal transfer of Spoink in D. melanogaster, with a species of the willistoni group being the likely donor. First we found a patchy distribution among species of the melanogaster group (for D. simulans we even have a patchy distribution among different strains; Fig 5A). Second Spoink insertions of D. melanogaster (and other species that may have gotten Spoink recently) are nested within species of the willistoni group (Fig 5B), a clear phylogenetic discrepancy. Third we found that the synonymous divergence of Spoink is lower than for all orthologous genes in D. melanogaster and D. willistoni (S9 Fig). In addition to this classical but indirect lines of evidence, we have however more direct and thus more compelling evidence for the horizontal transfer of Spoink. Based on strains collected during the last hundred years from all major geographic regions we showed that Spoink insertions were absent in all strains collected before 1983 but present in all strains collected after 1993 (using Illumina short read data, long-read assemblies, and PCR/Sanger sequencing). This makes Spoink one of the best documented cases of a recent horizontal transfer of a TE, similarly to the P-element where also strains collected during the last 100 years support the recent horizontal transfer [28, 29].

The abundance of sequencing data from strains collected at different time points during the last century allowed us to pinpoint the timing of the invasion in a way that would not have been previously possible. Spoink appears to have rapidly spread throughout global populations of D. melanogaster between 1983 and 1993. The narrow time-window of 10 years is plausible as studies monitoring P-element invasions in experimental populations showed that the P-element can invade populations within 20–60 generations [65, 97, 98]. Assuming that natural D. melanogaster populations have about 15 generations per year [99], a TE could penetrate a natural D. melanogaster population within 1–3 years. Given this potential rapidness of TE invasions it is likely that Spoink spread quickly between 1983 and 1993. Since there is a gap between strains sampled at 1983 and 1993 we cannot further narrow down the timing of the invasion. Furthermore, the strains used for timing the invasions were sampled from diverse geographic regions and Spoink likely spread at different times in different geographic regions. If horizontal transfer from a willistoni species triggered the invasion, as suggested by our data, then Spoink will have first spread in D. melanogaster populations from South America (the habitat of willistoni species), followed by populations from North America and the other continents. It is also feasible that Spoink invaded D. melanogaster indirectly, for example using D. simulans as intermediate host, in which case the Spoink invasion in D. melanogaster may have been triggered in almost any geographic region (both, D. simulans and D. melanogaster, are cosmopolitan species [100]). Unfortunately, we cannot infer the timing of the geographic spread of the Spoink invasion in different continents as D. melanogaster strains were not sampled sufficiently densely from different regions. Our work thus highlights the importance of efforts such as DrosEU, GDL and DrosRTEC to densely sample Drosophila strains in time and space [51, 101, 102]. It is also interesting to ask as to which extent human activity (e.g. trafficking of goods) contributed to the rapid spread of Spoink. Given that our analysis of the Spoink composition shows that geographically distant populations (Bejing/Ithaca or Netherlands/Zimbabwe) cluster together, human activity may have played a role. Increasing human activity could also explain why Spoink (invasion 1983–1993) seems to have spread faster than the P-element (1950–1980).

Our investigation of Spoink insertions in different drosophilid species suggests that the Spoink invasion in D. melanogaster was triggered by horizontal transfer from a species of the willistoni group. Although it is possible that we did not analyse the true donor species, we consider it unlikely to be a species outside of the willistoni group given the wide distribution of Spoink in all species in the willistoni group. In addition, the phylogenetic tree of Spoink has deep branches within the willistoni group, suggesting that Spoink is ancestral in this group (S10 Fig).

A related open question is when Spoink first entered D. melanogaster populations. Since a TE may initially solely spread in some isolated subpopulations there could be a considerable lag time between the horizontal transfer of a TE and its spread in worldwide population. The presence of Spoink in a strain collected around 1979 in Providence (USA; Fig 3B) could be due to this lag time (or contamination). Nevertheless, the horizontal transfer of Spoink must have happened between the spread of D. melanogaster into the habitat of the willistoni group, about 200 years ago, and the invasion of Spoink in worldwide populations between 1983 and 1993. In addition to the P-element, Spoink is the second TE that invaded D. melanogaster populations following horizontal transfer from a species of the willistoni group. Species from the willistoni group are very distantly related with D. melanogaster (about 100my [103]) and we were thus wondering whether it is a coincidence that a species of the willistoni group is again acting as donor of a TE invasion in D. melanogaster. The recent habitat expansion of D. melanogaster into the Americas resulted in novel contacts with many species, in addition to species of the willistoni group, that might have acted as donors of novel TEs such as D. pseudoobscura or D. persimilis [104]. Why is again a species of the willistoni group and not one of these other species acting as donor of a novel TE? Apart from mere chance, there are several, not mutually exclusive, hypotheses for this observation. First, it is feasible TEs of the willistoni group are exceptionally compatible with D. melanogaster at a molecular level. Second, some parasites targeting both D. melanogaster and species of the willistoni group could be efficient vectors for horizontal transfer of TEs. Third, the physical contact between D. melanogaster and some species of the willistoni group might be unusually tight, facilitating horizontal transfer of TEs by an unknown vector. D. willistoni is a common drosophilid in South American forests [105]. Habitat fragmentation caused by human deforestation may thus generate intensive contacts between human commensal species, such as D. melanogaster, and abundant forest species like D. willistoni. Fourth, species of the willistoni group might be exceptionally numerous resulting in elevated probability for horizontal transfer of a TE.

The Spoink invasion is the eighth TE invasion in D. melanogaster that has occurred during the last 200 year. As we argued previously, such a high rate of TE invasions is likely unusual during the evolution of the D. melanogaster lineage since the number of TE families in D. melanogaster is much smaller than what would be expected if this rate of invasions would persist [21]. It is possible that the high rate of TE invasions continues beyond the past 200 years since many LTR transposons in D. melanogaster are likely of very recent origin (possibly < 16.000years [85, 106]). One possible explanation for this high rate of recent TE invasions is that human activity contributed to the habitat expansion of D. melanogaster. Due to this habitat expansion D. melanogaster spread into the habitat of D. willistoni which enabled the horizontal transfer of Spoink. This raises the possibility that other species with recent habitat expansions also experienced unusually high rates of TE invasions. It is also interesting to ask whether the rate of TE invasions differs among species. For example cosmopolitan species, such as D. melanogaster, may generally experience higher rates of horizontal transfer than more locally confined species. The cosmopolitan distribution will bring species into contact with many diverse species, thereby increasing the opportunities for horizontal transfer of a TE.

The Spoink invasions also opens up several novel opportunities for research. First, the broad availability of strains with and without Spoink will enable testing whether Spoink activity induces phenotypic effects, similarly to hybrid dysgenesis described for the P-element, I-element and hobo, but not for Tirant [31, 107–109]. Second, it will be interesting to investigate whether some Spoink insertions participated in rapid adaptation of D. melanogaster populations, similar to a P-element insertion which contribute to insecticide resistance [110]. Third, it will enable studying Spoink invasions in experimental populations, shedding light on the dynamics of TE invasions, much as other recent studies investigating the invasion dynamics of the P-element [97, 98, 111]. Fourth, investigation into the distribution of species that have been infected with Spoink will shed light on the networks of horizontal transfer in drosophilid species. Fifth, the Spoink invasion provides an opportunity to study the establishment of the piRNA-based host defence [similar to [24, 65]]. For example we found that none of the piRNA cluster insertions are shared between individuals, suggesting there is no or solely weak selection for piRNA cluster insertions. Furthermore we found an extremely heterogeneous abundance of Spoink insertions in piRNA clusters where we could not find a single cluster insertions of Spoink in several strains. It is an important open question whether such a heterogeneous distribution is compatible with the trap model [83]. One possibility is that a few cluster insertions in populations are sufficient to trigger the paramutation of regular (non-paramutated) Spoink insertions into piRNA producing loci [16, 112, 113]. These paramutated Spoink insertions may then compensate for the low number of Spoink insertions in piRNA-clusters [112]. Paramutations could thus explain why several studies found that stand-alone insertions of TEs can nucleate their own piRNA production [69, 83, 114, 115].

The war between transposons and their hosts is constantly raging, with potentially large fitness effects for the individuals in populations. Over the last two hundred years there have been at least eight invasions of TEs into D. melanogaster, each of which could disrupt fertility for example by inducing some form of hybrid dysgenesis. TEs are responsible for > 80% of visible spontaneous mutations in D. melanogaster, and produce more variation than all SNPs combined [116–118]. In the long read assemblies considered here, more than half of insertions of Spoink were into genes [40]. The recent Spoink invasion could thus have a significant impact on the evolution of D. melanogaster lineage.

Supporting information

S1 Fig. Abundance of Spoink and P-element insertions in different genomic features.

TE insertions were identified in 31 long-read assemblies of D. melanogaster [40] and the reference annotation was lifted to each assembly with liftoff [46, 47]. Note that the P-element has a pronounced insertion bias in promoters (defined as 1000bp upstream of the first exon) whereas Spoink insertions are largely found in introns and intergenic regions.

https://doi.org/10.1371/journal.pgen.1011201.s001

(AI)

S2 Fig. DeviaTE plots of six D. melanogaster strains collected during the last century.

The short reads were aligned to the consensus sequence of Spoink and the coverage was normalized to the the coverage of single-copy genes. The coverage was manually curbed at the poly-A track (indicated by dashed lines). Note that very few reads of old strains (≤ 1975) align to Spoink whereas a contiguous coverage of reads along Spoink is observed for more recently collected strains (≥ 1993).

https://doi.org/10.1371/journal.pgen.1011201.s002

(AI)

S3 Fig. Abundance of Spoink insertions in six long-read assemblies of D. melanogaster strains collected during the last century.

Note that all strains contain fragmented and diverged insertions of Spoink, while solely recently collected strains (≥2003) contain canonical Spoink insertions (i.e. full-length insertions with little divergence from the consensus sequence).

https://doi.org/10.1371/journal.pgen.1011201.s003

(AI)

S4 Fig. The Sanger sequence of the six PCR amplicons matches with the consensus sequence of Spoink.

The Sanger sequences of the amplicons of P1 (red) and P2 (green) have been aligned to the consensus sequence of Spoink (blue, top) and the coordinates of the alignments are indicated. The D. melanogaster strain and the sequence similarity between the Sanger sequence and the consensus sequence of Spoink are provided next to each matching region.

https://doi.org/10.1371/journal.pgen.1011201.s004

(SVG)

S5 Fig. Abundance and composition of Spoink insertions in the GDL.

A) Abundance of Spoink in the GDL. Note that one strain from Zimbabwe does not have any Spoink insertion. B) UMAP summarizing the composition of Spoink among the GDL. Note that Spoink shows a pronounced population structure, where three main clusters can be discerned: Tasmania, Bejing/Ithaca and Netherlands/Zimbabwe.

https://doi.org/10.1371/journal.pgen.1011201.s005

(SVG)

S6 Fig. A piRNA based defence against Spoink is active in the 10 GDL strains.

Two strains are analysed for each continent (Bxx Beijing/Asia, Ixx Ithaca/America, Nxx Netherlands/Europe, Txx Tasmania/Australia, ZWxx Zimbabwe/Africa; the second strain from Ithaca (I17) is shown in the main manuscript). A) piRNAs mapping to the sequence of Spoink. Solely the 5’ positions of piRNAs are shown and the piRNA abundance is normalized to one million piRNAs. Sense piRNAs are shown on the positive y-axis and antisense piRNAs on the negative y-axis. B) ping-pong signature of Spoink.

https://doi.org/10.1371/journal.pgen.1011201.s006

(SVG)

S7 Fig. Barplots show the similarity between the consensus sequence of Spoink and the best match in each of 99 long-read assemblies of diverse insect species.

As a reference, two D. melanogaster assemblies (red) were included, where D.mel.RAL176 has canonical Spoink insertions while D.mel.Iso1 solely has degraded fragments of sequences having some similarity with Spoink.

https://doi.org/10.1371/journal.pgen.1011201.s007

(AI)

S8 Fig. Star phylogeny of Spoink insertions in the different drosophilid species.

Only full-length insertions of Spoink (> 80% of the length) were considered.

https://doi.org/10.1371/journal.pgen.1011201.s008

(SVG)

S9 Fig. Distribution of synonymous divergence for Spoink and 140 single copy orthologous genes shared between D. melanogaster and D. willistoni (red).

For Spoink we used the shared part of the longest ORF (green). The red dashed line is the 2.5% quantile of nuclear genes [85]. Note that the dS of Spoink is lower than the dS of any of the orthologous genes shared between D. melanogaster and D. willistoni, consistent with a horizontal transfer of Spoink between the two species. The genes were obtained with the software BUSCO [119]. The predicted proteins were aligned using Clustal Omega [120]. The codons information from the protein alignment was used for the nucleotide alignment using PAL2NAL [121]. The dS was calculated using the software PAML.

https://doi.org/10.1371/journal.pgen.1011201.s009

(PNG)

S10 Fig. Average distance between 100 pairs of Spoink insertions randomly sampled within either the melanogaster group (i.e D. melanogaster, D. simulans, D. sechellia) or the willistoni group.

Distances within the willistoni group are significantly longer than the distances in the melanogaster group (t = −6.31, df = 193.88, p = 1.762e − 09). Note that this test accounts for the phylogenetic information of the tree using the distances of the insertions within the two groups.

https://doi.org/10.1371/journal.pgen.1011201.s010

(PNG)

S1 Table. Differences in the abundance of Gypsy_7_DEl between the reference genome Iso1 and a long-read assemblies from a more recently collected strain.

The best ten matches for Gypsy_7_DEl and the consensus sequence of Spoink are shown for both assemblies. Matches were identified with RepeatMasker [37]. Note that the discrepancy between Iso1 and TOM007 is more pronounced when the consensus sequence of Spoink is considered.

https://doi.org/10.1371/journal.pgen.1011201.s011

(XLSX)

S2 Table. Similarity between Spoink and other TEs in the different repeat libraries generated for D. melanogaster.

For each repeat library the best five hits are shown. Solely matches with a minimum overlap with Spoink of at least 30% are considered. subst. substitions in percent between Spoink and the TE, len. fraction of the length of a TE aligning with Spoink; a [40], b [43], c [5], d [69], e [70].

https://doi.org/10.1371/journal.pgen.1011201.s012

(XLSX)

S3 Table. Coordinates of Spoink insertions in the strains RAL091, RAL176 and RAL732 used for Fig 1A of the main manuscript.

https://doi.org/10.1371/journal.pgen.1011201.s013

(XLSX)

S4 Table. Identity of sequences in Oregon-R having some similarity with the consensus sequence of Spoink.

Solely sequences having a divergence of ≤25% and minimum overlap of at least 10% with Spoink are considered. The sequences were extracted from the assembly of Oregon-R (chromosome:start-end) and aligned against the TE library of D. melanogaster using blastn [43, 122]. Most of these sequences match TARTC and DMDM11.

https://doi.org/10.1371/journal.pgen.1011201.s014

(XLSX)

S5 Table. Overview of the short-read data analysed in this work.

Data are from [31, 40, 51–53]).

https://doi.org/10.1371/journal.pgen.1011201.s015

(XLSX)

S6 Table. Overview of the long-read assemblies of D. melanogaster strains analysed in this work.

For each strain we show the assembly ID, the strain, the sampling location and the sampling date. a [38, 39], b [48], c [56], d [40], e [123].

https://doi.org/10.1371/journal.pgen.1011201.s016

(XLSX)

S7 Table. Spoink insertions in piRNA clusters of long-read assemblies of different D. melanogaster strains [40].

Note that for several strains we could not find a single Spoink insertion in a piRNA cluster. On the other hand, some strains, like RAL176, have multiple Spoink insertions in piRNA clusters.

https://doi.org/10.1371/journal.pgen.1011201.s017

(XLSX)

S8 Table. Overview of the long-read assemblies of diverse insect species analysed in this work.

https://doi.org/10.1371/journal.pgen.1011201.s018

(XLSX)

Acknowledgments

We thank Matthew Beaumont for the idea to call the here described transposon Spoink. We thank Silke Jensen for comments. We thank Neda Barghi and Claudia Ramirez Lanzas for providing fly strains used for PCR. SS would like to thank J. B. Signor for helpful comments on the manuscript. RK, RP, and AS thank all members of the Institute of Population Genetics for feedback and support.

References

1. Schnable PS, Pasternak S, Liang C, Zhang J, Fulton L, Graves TA, et al. The B73 Maize Genome: Complexity, Diversity, and Dynamics. Science. 2009;326(5956):1112–1115. pmid:19965430
- View Article
- PubMed/NCBI
- Google Scholar
2. Kapitonov VV, Jurka J. Molecular paleontology of transposable elements in the Drosophila melanogaster genome. Proceedings of the National Academy of Sciences of the United States of America. 2003;100(11):6569–74. pmid:12743378
- View Article
- PubMed/NCBI
- Google Scholar
3. Finnegan DJ. Eukaryotic transposable elements and genome evolution. Trends in Genetics. 1989;5(4):103–107. pmid:2543105
- View Article
- PubMed/NCBI
- Google Scholar
4. Wicker T, Sabot F, Hua-Van A, Bennetzen JL, Capy P, Chalhoub B, et al. A unified classification system for eukaryotic transposable elements. Nature Reviews Genetics. 2007;8(12):973–982. pmid:17984973
- View Article
- PubMed/NCBI
- Google Scholar
5. Chakraborty M, Chang C, Khost D, Vedanayagam J A J, Liao Y, Montooth K, et al. Evolution of genome structure in the Drosophila simulans species complex. Genome Research. 2021;31:380–396. pmid:33563718
- View Article
- PubMed/NCBI
- Google Scholar
6. Eickbush DG, Eickbush TH. Vertical transmission of the retrotransposable elements R1 and R2 during the evolution of the Drosophila melanogaster species subgroup. Genetics. 1995;139(2):671–684. pmid:7713424
- View Article
- PubMed/NCBI
- Google Scholar
7. Nelson J, Slicko A, Yamashita Y. The retrotransposon R2 maintains Drosophila ribosomal DNA repeats. PNAS. 2023;120(23):e2221613120. pmid:37252996
- View Article
- PubMed/NCBI
- Google Scholar
8. Elena SF, Ekunwe L, Hajela N, Oden SA, Lenski RE. Distribution of fitness effects caused by random insertion mutations in Escherichia coli. Genetica. 1998;102-103:349–358. pmid:9720287
- View Article
- PubMed/NCBI
- Google Scholar
9. Pasyukova E, Nuzhdin S, Morozova T, Mackay T. Accumulation of transposable elements in the genome of Drosophila melanogaster is associated with a decrease in fitness. Journal of Heredity. 2004;95(4):284–290. pmid:15247307
- View Article
- PubMed/NCBI
- Google Scholar
10. Sarkies P, Selkirk ME, Jones JT, Blok V, Boothby T, Goldstein B, et al. Ancient and Novel Small RNA Pathways Compensate for the Loss of piRNAs in Multiple Independent Nematode Lineages. PLoS Biol. 2015;13(2):1–20. pmid:25668728
- View Article
- PubMed/NCBI
- Google Scholar
11. Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 2007;128(6):1089–1103. pmid:17346786
- View Article
- PubMed/NCBI
- Google Scholar
12. Gunawardane LS, Saito K, Nishida KM, Miyoshi K, Kawamura Y, Nagami T, et al. A slicer-mediated mechanism for repeat-associated siRNA 5’ end formation in Drosophila. Science. 2007;315(5818):1587–1590. pmid:17322028
- View Article
- PubMed/NCBI
- Google Scholar
13. Brennecke J, Malone CD, Aravin AA, Sachidanandam R, Stark A, Hannon GJ. An epigenetic role for maternally inherited piRNAs in transposon silencing. Science. 2008;322(5906):1387–1392. pmid:19039138
- View Article
- PubMed/NCBI
- Google Scholar
14. Le Thomas A, Rogers AK, Webster A, Marinov GK, Liao SE, Perkins EM, et al. Piwi induces piRNA-guided transcriptional silencing and establishment of a repressive chromatin state. Genes and Development. 2013;27(4):390–399. pmid:23392610
- View Article
- PubMed/NCBI
- Google Scholar
15. Le Thomas A, Marinov GK, Aravin AA. A transgenerational process defines piRNA biogenesis in Drosophila virilis. Cell Reports. 2014;8(6):1617–1623. pmid:25199836
- View Article
- PubMed/NCBI
- Google Scholar
16. Le Thomas A, Stuwe E, Li S, Du J, Marinov G, Rozhkov N, et al. Transgenerationally inherited piRNAs trigger piRNA biogenesis by changing the chromatin of piRNA clusters and inducing precursor processing. Genes and Development. 2014;28(15):1667–1680. pmid:25085419
- View Article
- PubMed/NCBI
- Google Scholar
17. Yamanaka S, Siomi MC, Siomi H. piRNA clusters and open chromatin structure. Mobile DNA. 2014;5(1):22. pmid:25126116
- View Article
- PubMed/NCBI
- Google Scholar
18. Andreev VI, Yu C, Wang ea J. Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery. Nat Struct Mol Biol. 2022;29:130–142. pmid:35173350
- View Article
- PubMed/NCBI
- Google Scholar
19. Rangan P, Malone CD, Navarro C, Newbold SP, Hayes PS, Sachidanandam R, et al. piRNA production requires heterochromatin formation in Drosophila. Current Biology. 2011;21(16):1373–1379. pmid:21820311
- View Article
- PubMed/NCBI
- Google Scholar
20. Peccoud J, Loiseau V, Cordaux , Gilbert C. Massive horizontal transfer of transposable elements in insects. Proc Natl Acad Sci U S A. 2017;114(18):4721–26. pmid:28416702
- View Article
- PubMed/NCBI
- Google Scholar
21. Scarpa A, Pianezza R, Wierzbicki F, Kofler R. Genomes of historical specimens reveal multiple invasions of LTR retrotransposons in Drosophila melanogaster populations during the 19th century. PNAS (in press). 2023.
- View Article
- Google Scholar
22. Kofler R, Hill T, Nolte V, Betancourt A, Schlötterer C. The recent invasion of natural Drosophila simulans populations by the P-element. PNAS. 2015;112(21):6659–6663. pmid:25964349
- View Article
- PubMed/NCBI
- Google Scholar
23. Signor S, Vedanayagam J, Kim BY, Wierzbicki F, Kofler R, Lai EC. Rapid evolutionary diversification of the flamenco locus across simulans clade Drosophila species. PloS Genetics. 2023;19(8):e1010914. pmid:37643184
- View Article
- PubMed/NCBI
- Google Scholar
24. Zhang S, Pointer B, Kelleher ES. Rapid evolution of piRNA-mediated silencing of an invading transposable element was driven by abundant de novo mutations. Genome Research. 2020;30(4):566–575. pmid:32238416
- View Article
- PubMed/NCBI
- Google Scholar
25. Zanni V, Eymery A, Coiffet M, Zytnicki M, Luyten I, Quesneville H, et al. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters. Proceedings of the National Academy of Sciences. 2013;110(49):19842–19847. pmid:24248389
- View Article
- PubMed/NCBI
- Google Scholar
26. Schaack S, Gilbert C, Feschotte C. Promiscuous DNA: horizontal transfer of transposable elements and why it matters for eukaryotic evolution. Trends in ecology & evolution. 2010;25(9):537–46. pmid:20591532
- View Article
- PubMed/NCBI
- Google Scholar
27. Daniels SB, Peterson KR, Strausbaugh LD, Kidwell MG, Chovnick A. Evidence for horizontal transmission of the P transposable element between Drosophila species. Genetics. 1990;124(2):339–55. pmid:2155157
- View Article
- PubMed/NCBI
- Google Scholar
28. Anxolabéhère D, Kidwell MG, Periquet G. Molecular characteristics of diverse populations are consistent with the hypothesis of a recent invasion of Drosophila melanogaster by mobile P elements. Molecular Biology and Evolution. 1988;5(3):252–269. pmid:2838720
- View Article
- PubMed/NCBI
- Google Scholar
29. Kidwell MG. Evolution of hybrid dysgenesis determinants in Drosophila melanogaster. Proceedings of the National Academy of Sciences. 1983;80(6):1655–1659. pmid:6300863
- View Article
- PubMed/NCBI
- Google Scholar
30. Periquet G, Hamelin MH, Bigot Y, Lepissier A. Geographical and historical patterns of distribution of hobo elements in Drosophila melanogaster populations. Journal of Evolutionary Biology. 1989;2(3):223–229.
- View Article
- Google Scholar
31. Schwarz F, Wierzbicki F, Senti KA, Kofler R. Tirant Stealthily Invaded Natural Drosophila melanogaster Populations during the Last Century. Molecular Biology and Evolution. 2021;38(4):1482–1497. pmid:33247725
- View Article
- PubMed/NCBI
- Google Scholar
32. Loreto ELS, Carareto CMA, Capy P. Revisiting horizontal transfer of transposable elements in Drosophila. Heredity. 2008;100(6):545–54. pmid:18431403
- View Article
- PubMed/NCBI
- Google Scholar
33. Simmons G. Horizontal transfer of hobo transposable elements within the Drosophila melanogaster species complex: evidence from DNA sequencing. Molecular biology and evolution. 1992;9(6):1050–1060. pmid:1331701
- View Article
- PubMed/NCBI
- Google Scholar
34. Blumenstiel JP. Birth, school, work, death, and resurrection: The life stages and dynamics of transposable element proliferation. Genes. 2019;10(5):336. pmid:31058854
- View Article
- PubMed/NCBI
- Google Scholar
35. Anxolabéhère D, Nouaud D, Périquet G, Tchen P. P-element distribution in Eurasian populations of Drosophila melanogaster: a genetic and molecular analysis. Proceedings of the National Academy of Sciences. 1985;82(16):5418–5422. pmid:16593591
- View Article
- PubMed/NCBI
- Google Scholar
36. Bonnivard E, Higuet D. Stability of European natural populations of Drosophila melanogaster with regard to the P-M system: a buffer zone made up of Q populations. Journal of Evolutionary Biology. 1999;12(4):633–647.
- View Article
- Google Scholar
37. Smit AFA, Hubley R, Green P. RepeatMasker Open-3.0; 1996-2010. Available from: http://www.repeatmasker.org.
38. King EG, Merkes CM, McNeil CL, Hoofer SR, Sen S, Broman KW, et al. Genetic dissection of a model complex trait using the Drosophila Synthetic Population Resource. Genome Research. 2012;22(8):1558–1566. pmid:22496517
- View Article
- PubMed/NCBI
- Google Scholar
39. Chakraborty M, Emerson JJ, Macdonald SJ, Long AD. Structural variants exhibit widespread allelic heterogeneity and shape variation in complex traits. Nature Communications. 2019;10(1):4872. pmid:31653862
- View Article
- PubMed/NCBI
- Google Scholar
40. Rech GE, Radío S, Guirao-Rico S, Aguilera L, Horvath V, Green L, et al. Population-scale long-read sequencing uncovers transposable elements associated with gene expression variation and adaptive signatures in Drosophila. Nature Communications. 2022;13(1):1948. pmid:35413957
- View Article
- PubMed/NCBI
- Google Scholar
41. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic acids research. 2004;32(5):1792–1797. pmid:15034147
- View Article
- PubMed/NCBI
- Google Scholar
42. Steinbiss S, Willhoeft U, Gremme G, Kurtz S. Fine-grained annotation and classification of de novo predicted LTR retrotransposons. Nucleic acids research. 2009;37(21):7002–7013. pmid:19786494
- View Article
- PubMed/NCBI
- Google Scholar
43. Quesneville H, Bergman CM, Andrieu O, Autard D, Nouaud D, Ashburner M, et al. Combined evidence annotation of transposable elements in genome sequences. PLoS Computational Biology. 2005;1(2):166–175. pmid:16110336
- View Article
- PubMed/NCBI
- Google Scholar
44. Wheeler DL, Barrett T, Benson DA, Bryant SH, Canese K, Chetvernin V, et al. Database resources of the national center for biotechnology information. Nucleic acids research. 2007;35(suppl_1):D5–D12. pmid:17170002
- View Article
- PubMed/NCBI
- Google Scholar
45. Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, Gavryushkina A, et al. BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLOS Computational Biology. 2019;15(4):e1006650. pmid:30958812
- View Article
- PubMed/NCBI
- Google Scholar
46. Shumate A, Salzberg S. Liftoff: accurate mapping of gene annotations. Bioinformatics. 2021;37(12):1639–1643. pmid:33320174
- View Article
- PubMed/NCBI
- Google Scholar
47. Gramates LS, Agapite J, Attrill H, Calvi BR, Crosby MA, Dos Santos G, et al. FlyBase: a guided tour of highlighted features. Genetics. 2022;220(4):iyac035. pmid:35266522
- View Article
- PubMed/NCBI
- Google Scholar
48. Wierzbicki F, Schwarz F, Cannalonga O, Kofler R. Novel quality metrics allow identifying and generating high-quality assemblies of piRNA clusters. Molecular Ecology Resources. 2021. pmid:34181811
- View Article
- PubMed/NCBI
- Google Scholar
49. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics (Oxford, England). 2010;26(6):841–842. pmid:20110278
- View Article
- PubMed/NCBI
- Google Scholar
50. Wierzbicki F, Kofler R, Signor S. Evolutionary dynamics of piRNA clusters in Drosophila. Molecular Ecology. 2023;32(6):1306–1322. pmid:34878692
- View Article
- PubMed/NCBI
- Google Scholar
51. Grenier JK, Arguello JR, Moreira MC, Gottipati S, Mohammed J, Hackett SR, et al. Global diversity lines–a five-continent reference panel of sequenced Drosophila melanogaster strains. G3: Genes, Genomes, Genetics. 2015;5(4):593–603. pmid:25673134
- View Article
- PubMed/NCBI
- Google Scholar
52. Long Q, Rabanal FA, Meng D, Huber CD, Farlow A, Platzer A, et al. Massive genomic variation and strong selection in Arabidopsis thaliana lines from Sweden. Nature genetics. 2013;45(8):884–890. pmid:23793030
- View Article
- PubMed/NCBI
- Google Scholar
53. Lange JD, Bastide H, Lack JB, Pool JE. A Population Genomic Assessment of Three Decades of Evolution in a Natural Drosophila Population. Molecular Biology and Evolution. 2021;39(2).
- View Article
- Google Scholar
54. Li H, Durbin R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics. 2009;25(14):1754–1760. pmid:19451168
- View Article
- PubMed/NCBI
- Google Scholar
55. Weilguny L, Kofler R. DeviaTE: Assembly-free analysis and visualization of mobile genetic element composition. Molecular Ecology Resources. 2019;19(5):1346–1354. pmid:31056858
- View Article
- PubMed/NCBI
- Google Scholar
56. Hoskins RA, Carlson JW, Wan KH, Park S, Mendez I, Galle SE, et al. The Release 6 reference sequence of the Drosophila melanogaster genome. Genome Research. 2015;25(3):445–458. pmid:25589440
- View Article
- PubMed/NCBI
- Google Scholar
57. Shen W, Le S, Li Y, Hu F. SeqKit: A Cross-Platform and Ultrafast Toolkit for FASTA/Q File Manipulation. PLOS ONE. 2016;11(10):1–10. pmid:27706213
- View Article
- PubMed/NCBI
- Google Scholar
58. Li H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. 2018;34(18):3094–3100. pmid:29750242
- View Article
- PubMed/NCBI
- Google Scholar
59. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–140. pmid:19910308
- View Article
- PubMed/NCBI
- Google Scholar
60. Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics. 2012;. pmid:22517427
- View Article
- PubMed/NCBI
- Google Scholar
61. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic acids research. 1988;16(3):1215. pmid:3344216
- View Article
- PubMed/NCBI
- Google Scholar
62. Luo S, Zhang H, Duan Y, Yao X, Clark AG, Lu J. The evolutionary arms race between transposable elements and piRNAs in Drosophila melanogaster. BMC Evolutionary Biology. 2020;20(1):1–18. pmid:31992188
- View Article
- PubMed/NCBI
- Google Scholar
63. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet journal. 2011;17(1):10–12.
- View Article
- Google Scholar
64. Thurmond J, Goodman JL, Strelets VB, Attrill H, Gramates LS, Marygold SJ, et al. FlyBase 2.0: the next generation. Nucleic acids research. 2019;47(D1):D759–D765. pmid:30364959
- View Article
- PubMed/NCBI
- Google Scholar
65. Selvaraju D, Wierzbicki F, Kofler R. P-element invasions in Drosophila erecta shed light on the establishment of host control over a transposable element. bioRxiv. 2022;.
- View Article
- Google Scholar
66. McInnes L, Healy J, Melville J. Umap: Uniform manifold approximation and projection for dimension reduction. arXiv preprint arXiv:180203426. 2018;.
67. Kim BY, Wang JR, Miller DE, Barmina O, Delaney E, Thompson A, et al. Highly contiguous assemblies of 101 drosophilid genomes. eLife. 2021;10:e66405. pmid:34279216
- View Article
- PubMed/NCBI
- Google Scholar
68. Hotaling S, Sproul JS, Heckenhauer J, Powell A, Larracuente AM, Pauls SU, et al. Long Reads Are Revolutionizing 20 Years of Insect Genome Sequencing. Genome Biology and Evolution. 2021;13(8):evab138. pmid:34152413
- View Article
- PubMed/NCBI
- Google Scholar
69. Srivastav S, Feschotte C, Clark AG. Rapid evolution of piRNA clusters in the Drosophila melanogaster ovary. bioRxiv. 2023;. pmid:37214865
- View Article
- PubMed/NCBI
- Google Scholar
70. Ellison CE, Cao W. Nanopore sequencing and Hi-C scaffolding provide insight into the evolutionary dynamics of transposable elements and piRNA production in wild strains of Drosophila melanogaster. Nucleic Acids Research. 2020;48(1):1–14. pmid:31754714
- View Article
- PubMed/NCBI
- Google Scholar
71. Wang J, Chitsaz F, Derbyshire MK, Gonzales NR, Gwadz M, Lu S, et al. The conserved domain database in 2023. Nucleic Acids Research. 2023;51(D1):D384–D388. pmid:36477806
- View Article
- PubMed/NCBI
- Google Scholar
72. Eickbush TH, Malik HS. Origins and evolution of retrotransposons. vol. 93. ASM Press; 2002.
73. Linheiro RS, Bergman CM. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster. PloS one. 2012;7(2):e30008. pmid:22347367
- View Article
- PubMed/NCBI
- Google Scholar
74. Neumann P, Novák P, Hoštáková N, Macas J. Systematic survey of plant LTR-retrotransposons elucidates phylogenetic relationships of their polyprotein domains and provides a reference for element classification. Mobile DNA. 2019;10:1–17. pmid:30622655
- View Article
- PubMed/NCBI
- Google Scholar
75. Wells JN, Feschotte C. A field guide to eukaryotic transposable elements. Annual review of genetics. 2020;54:539–561. pmid:32955944
- View Article
- PubMed/NCBI
- Google Scholar
76. Diaz-Papkovich A, Anderson-Trocmé L, Gravel S. A review of UMAP in population genetics. Journal of Human Genetics. 2021;66(1):85–91. pmid:33057159
- View Article
- PubMed/NCBI
- Google Scholar
77. Sienski G, Dönertas D, Brennecke J. Transcriptional silencing of transposons by Piwi and maelstrom and its impact on chromatin state and gene expression. Cell. 2012;151(5):964–980. pmid:23159368
- View Article
- PubMed/NCBI
- Google Scholar
78. Lindsley DH, Grell EH. Genetic variations of Drosophila melanogaster. Carnegie Institute of Washington Publication; 1968.
79. Bergman CM, Quesneville H, Anxolabéhère D, Ashburner M. Recurrent insertion and duplication generate networks of transposable element sequences in the Drosophila melanogaster genome. Genome Biology. 2006;7(11):R112. pmid:17134480
- View Article
- PubMed/NCBI
- Google Scholar
80. Malone CD, Hannon GJ. Small RNAs as Guardians of the Genome. Cell. 2009;136(4):656–668. pmid:19239887
- View Article
- PubMed/NCBI
- Google Scholar
81. Goriaux C, Théron E, Brasset E, Vaury C. History of the discovery of a master locus producing piRNAs: The flamenco/COM locus in Drosophila melanogaster. Frontiers in Genetics. 2014;5:257. pmid:25136352
- View Article
- PubMed/NCBI
- Google Scholar
82. Kofler R. Dynamics of Transposable Element Invasions with piRNA Clusters. Molecular Biology and Evolution. 2019;36(7):1457–1472. pmid:30968135
- View Article
- PubMed/NCBI
- Google Scholar
83. Wierzbicki F, Kofler R. The composition of piRNA clusters in Drosophila melanogaster deviates from expectations under the trap model. BMC Biology. 2023;. pmid:37858221
- View Article
- PubMed/NCBI
- Google Scholar
84. Bao W, Kojima KK, Kohany O. RepBase Update, a database of repetitive elements in eukaryotic genomes. Mobile Dna. 2015;6:1–6. pmid:26045719
- View Article
- PubMed/NCBI
- Google Scholar
85. Bartolomé C, Bello X, Maside X. Widespread evidence for horizontal transfer of transposable elements across Drosophila genomes. Genome biology. 2009;10(2):R22. pmid:19226459
- View Article
- PubMed/NCBI
- Google Scholar
86. Wallau GL, Ortiz MF, Loreto ELS. Horizontal transposon transfer in eukarya: detection, bias, and perspectives. Genome Biology and Evolution. 2012;4(8):801–811.
- View Article
- Google Scholar
87. Burla H, da Cunha AB, Cordeiro AR, Dobzhansky T, Malogolowkin C, Pavan C. The Willistoni Group of Sibling Species of Drosophila. Evolution. 1949;3(4):300–314. pmid:15396748
- View Article
- PubMed/NCBI
- Google Scholar
88. Spassky B, Richmond RC, Perez-Salas S, Pavlovsky O, Mourao CA, Hunter AS, et al. Geography of the Sibling Species Related to Drosophila willistoni, and of the Semispecies of the Drosophila Paulistorum Complex. Evolution. 1971;25(1):129–143. pmid:28562939
- View Article
- PubMed/NCBI
- Google Scholar
89. Zanini R, Deprá M, Valante V. On the geographic distribution of the Drosophila willistoni group (Diptera, Drosophilidae)—updated geographic distribution of the Neotropical willistoni subgroup. Drosophila Information Service. 2015;98:39–43.
- View Article
- Google Scholar
90. Sturtevant AH. The North American species of Drosophila. Nature. 1921;107:1476–4687.
- View Article
- Google Scholar
91. Johnson CW. The distribution of some species of Drosophila. Psyche. 1913;20:202–205.
- View Article
- Google Scholar
92. Bock IR, Parsons PA. Species of Australia and New Zealand. In: Ashburner M, Carson LH, Thompson JHJ, editors. The genetics and biology of Drosophila. vol. 3a. Oxford: Academic Press; 1981. p. 349–393.
93. Heed WB, Russell JS. Phylogeny and population structure in island and continental species of the cardini group of Drosophila studied by inversion analysis. Stud Genet. 1971;.
- View Article
- Google Scholar
94. Brisson JA, Wilder J, Hollocher H. Phylogenetic analysis of the cardini group of Drosophila with respect to changes in pigmentation. Evolution. 2006;60(6):1228–1241. pmid:16892973
- View Article
- PubMed/NCBI
- Google Scholar
95. Peccoud J, Cordaux R, Gilbert C. Analyzing Horizontal Transfer of Transposable Elements on a Large Scale: Challenges and Prospects. Bioessays. 2018;40(2). pmid:29283188
- View Article
- PubMed/NCBI
- Google Scholar
96. Wallau GL, Ortiz MF, Loreto ELS. Horizontal transposon transfer in eukarya: detection, bias, and perspectives. Genome Biol Evol. 2012;4(8):689–699. pmid:22798449
- View Article
- PubMed/NCBI
- Google Scholar
97. Kofler R, Senti KA, Nolte V, Tobler R, Schlötterer C. Molecular dissection of a natural transposable element invasion. Genome Research. 2018;28(6):824–835. pmid:29712752
- View Article
- PubMed/NCBI
- Google Scholar
98. Kofler R, Nolte V, Schlötterer C. The Transposition Rate Has Little Influence on the Plateauing Level of the P-element. Molecular Biology and Evolution. 2022;39(7):msac141. pmid:35731857
- View Article
- PubMed/NCBI
- Google Scholar
99. Pool JE. The Mosaic Ancestry of the Drosophila Genetic Reference Panel and the D. melanogaster Reference Genome Reveals a Network of Epistatic Fitness Interactions. Molecular biology and evolution. 2015; p. msv194.
- View Article
- Google Scholar
100. Capy P, Gibert P. Drosophila melanogaster, Drosophila simulans: so similar yet so different. Genetica. 2004;120(1-3):5–16. pmid:15088643
- View Article
- PubMed/NCBI
- Google Scholar
101. Kapun M, Barrón MG, Staubach F, Obbard DJ, Wiberg RAW, Vieira J, et al. Genomic analysis of European Drosophila melanogaster populations reveals longitudinal structure, continent-wide selection, and previously unknown DNA viruses. Molecular Biology and Evolution. 2020;37(9):2661–2678. pmid:32413142
- View Article
- PubMed/NCBI
- Google Scholar
102. Machado HE, Bergland AO, Taylor R, Tilk S, Behrman E, Dyer K, et al. Broad geographic sampling reveals the shared basis and environmental correlates of seasonal adaptation in Drosophila. Elife. 2021;10:e67577. pmid:34155971
- View Article
- PubMed/NCBI
- Google Scholar
103. Obbard DJ, Maclennan J, Kim KW, Rambaut A, O’Grady PM, Jiggins FM. Estimating Divergence Dates and Substitution Rates in the Drosophila Phylogeny. Molecular Biology and Evolution. 2012;29(11):3459–3473. pmid:22683811
- View Article
- PubMed/NCBI
- Google Scholar
104. Prakash S. Genetic divergence in closely related sibling species Drosophila pseudoobscura, Drosophila persimilis and Drosophila miranda. Evolution. 1977; p. 14–23. pmid:28567734
- View Article
- PubMed/NCBI
- Google Scholar
105. Regner L, Pereira M, Alonso C, Abdelhay E, Valente V. Genomic distribution of P elements in Drosophila willistoni and a search for their relationship with chromosomal inversions. Journal of Heredity. 1996;87(3):191–198. pmid:8683096
- View Article
- PubMed/NCBI
- Google Scholar
106. Bergman CM, Bensasson D. Recent LTR retrotransposon insertion contrasts with waves of non-LTR insertion since speciation in Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America. 2007;104(27):11340–5. pmid:17592135
- View Article
- PubMed/NCBI
- Google Scholar
107. Bucheton A, Lavige J, Picard G, L’heritier P. Non-mendelian female sterility in Drosophila melanogaster: quantitative variations in the efficiency of inducer and reactive strains. Heredity. 1976;36(3):305–314. pmid:819401
- View Article
- PubMed/NCBI
- Google Scholar
108. Kidwell MG, Kidwell JF, Sved JA. Hybrid dysgenesis in Drosophila melanogaster: A syndrome of aberrant traits including mutations, sterility and male recombination. Genetics. 1977;86(4):813–833. pmid:17248751
- View Article
- PubMed/NCBI
- Google Scholar
109. Blackman RK, Grimaila R, Macy M, Koehler D, Gelbart WM. Mobilization of hobo elements residing within the decapentaplegic gene complex: Suggestion of a new hybrid dysgenesis system in Drosophila melanogaster. Cell. 1987;49(4):497–505. pmid:3032458
- View Article
- PubMed/NCBI
- Google Scholar
110. Schmidt JM, Good RT, Appleton B, Sherrard J, Raymant GC, Bogwitz MR, et al. Copy number variation and transposable elements feature in recent, ongoing adaptation at the Cyp6g1 locus. PLoS genetics. 2010;6(6):e1000998. pmid:20585622
- View Article
- PubMed/NCBI
- Google Scholar
111. Wang L, Zhang S, Hadjipanteli S, Saiz L, Nguyen L, Silva E, et al. P-element invasion fuels molecular adaptation in laboratory populations of Drosophila melanogaster. Evolution. 2023;77(4):980–994. pmid:36749648
- View Article
- PubMed/NCBI
- Google Scholar
112. Scarpa A, Kofler R. The impact of paramutations on the invasion dynamics of transposable elements. Genetics. 2023; p. iyad181. pmid:37819004
- View Article
- PubMed/NCBI
- Google Scholar
113. Hermant C, Boivin A, Teysset L, Delmarre V, Asif-Laidin A, Van Den Beek M, et al. Paramutation in Drosophila requires both nuclear and cytoplasmic actors of the piRNA pathway and induces cis-spreading of piRNA production. Genetics. 2015;201(4):1381–1396. pmid:26482790
- View Article
- PubMed/NCBI
- Google Scholar
114. Shpiz S, Ryazansky S, Olovnikov I, Abramov Y, Kalmykova A. Euchromatic transposon insertions trigger production of novel pi-and endo-siRNAs at the target sites in the Drosophila germline. PLoS Genetics. 2014;10(2):e1004138. pmid:24516406
- View Article
- PubMed/NCBI
- Google Scholar
115. Mohn F, Sienski G, Handler D, Brennecke J. The rhino-deadlock-cutoff complex licenses noncanonical transcription of dual-strand piRNA clusters in Drosophila. Cell. 2014;157(6):1364–1379. pmid:24906153
- View Article
- PubMed/NCBI
- Google Scholar
116. Ashburner M, Bergman CM. Drosophila melanogaster: A case study of a model genomic sequence and its consequences. Cold Spring Harbor perspectives in biology. 2005;15:1661–1667.
- View Article
- Google Scholar
117. Green MM. Mobile DNA elements and spontaneous gene mutation. Banbury Rep. 1988;30:41–50.
- View Article
- Google Scholar
118. Sankaranarayanan K. Mobile genetic elements, spontaneous mutations, and the assessment of genetic radiation hazards in man. Cold Spring Harbor; 1988.
119. Manni M, Berkeley MR, Seppey M, Simão FA, Zdobnov EM. BUSCO update: novel and streamlined workflows along with broader and deeper phylogenetic coverage for scoring of eukaryotic, prokaryotic, and viral genomes. Molecular biology and evolution. 2021;38(10):4647–4654. pmid:34320186
- View Article
- PubMed/NCBI
- Google Scholar
120. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular systems biology. 2011;7(1):539. pmid:21988835
- View Article
- PubMed/NCBI
- Google Scholar
121. Suyama M, Torrents D, Bork P. PAL2NAL: robust conversion of protein sequence alignments into the corresponding codon alignments. Nucleic acids research. 2006;34(suppl_2):W609–W612. pmid:16845082
- View Article
- PubMed/NCBI
- Google Scholar
122. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology. 1990;215(3):403–410. pmid:2231712
- View Article
- PubMed/NCBI
- Google Scholar
123. Mackay TF, Richards S, Stone EA, Barbadilla A, Ayroles JF, Zhu D, et al. The Drosophila melanogaster genetic reference panel. Nature. 2012;482(7384):173–178. pmid:22318601
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Schnable PS, Pasternak S, Liang C, Zhang J, Fulton L, Graves TA, et al. The B73 Maize Genome: Complexity, Diversity, and Dynamics. Science. 2009;326(5956):1112–1115. pmid:19965430
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Kapitonov VV, Jurka J. Molecular paleontology of transposable elements in the Drosophila melanogaster genome. Proceedings of the National Academy of Sciences of the United States of America. 2003;100(11):6569–74. pmid:12743378
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Finnegan DJ. Eukaryotic transposable elements and genome evolution. Trends in Genetics. 1989;5(4):103–107. pmid:2543105
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Wicker T, Sabot F, Hua-Van A, Bennetzen JL, Capy P, Chalhoub B, et al. A unified classification system for eukaryotic transposable elements. Nature Reviews Genetics. 2007;8(12):973–982. pmid:17984973
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Chakraborty M, Chang C, Khost D, Vedanayagam J A J, Liao Y, Montooth K, et al. Evolution of genome structure in the Drosophila simulans species complex. Genome Research. 2021;31:380–396. pmid:33563718
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Eickbush DG, Eickbush TH. Vertical transmission of the retrotransposable elements R1 and R2 during the evolution of the Drosophila melanogaster species subgroup. Genetics. 1995;139(2):671–684. pmid:7713424
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Nelson J, Slicko A, Yamashita Y. The retrotransposon R2 maintains Drosophila ribosomal DNA repeats. PNAS. 2023;120(23):e2221613120. pmid:37252996
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Elena SF, Ekunwe L, Hajela N, Oden SA, Lenski RE. Distribution of fitness effects caused by random insertion mutations in Escherichia coli. Genetica. 1998;102-103:349–358. pmid:9720287
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Pasyukova E, Nuzhdin S, Morozova T, Mackay T. Accumulation of transposable elements in the genome of Drosophila melanogaster is associated with a decrease in fitness. Journal of Heredity. 2004;95(4):284–290. pmid:15247307
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Sarkies P, Selkirk ME, Jones JT, Blok V, Boothby T, Goldstein B, et al. Ancient and Novel Small RNA Pathways Compensate for the Loss of piRNAs in Multiple Independent Nematode Lineages. PLoS Biol. 2015;13(2):1–20. pmid:25668728
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 2007;128(6):1089–1103. pmid:17346786
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Gunawardane LS, Saito K, Nishida KM, Miyoshi K, Kawamura Y, Nagami T, et al. A slicer-mediated mechanism for repeat-associated siRNA 5’ end formation in Drosophila. Science. 2007;315(5818):1587–1590. pmid:17322028
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Brennecke J, Malone CD, Aravin AA, Sachidanandam R, Stark A, Hannon GJ. An epigenetic role for maternally inherited piRNAs in transposon silencing. Science. 2008;322(5906):1387–1392. pmid:19039138
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Le Thomas A, Rogers AK, Webster A, Marinov GK, Liao SE, Perkins EM, et al. Piwi induces piRNA-guided transcriptional silencing and establishment of a repressive chromatin state. Genes and Development. 2013;27(4):390–399. pmid:23392610
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Le Thomas A, Marinov GK, Aravin AA. A transgenerational process defines piRNA biogenesis in Drosophila virilis. Cell Reports. 2014;8(6):1617–1623. pmid:25199836
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. Le Thomas A, Stuwe E, Li S, Du J, Marinov G, Rozhkov N, et al. Transgenerationally inherited piRNAs trigger piRNA biogenesis by changing the chromatin of piRNA clusters and inducing precursor processing. Genes and Development. 2014;28(15):1667–1680. pmid:25085419
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Yamanaka S, Siomi MC, Siomi H. piRNA clusters and open chromatin structure. Mobile DNA. 2014;5(1):22. pmid:25126116
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Andreev VI, Yu C, Wang ea J. Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery. Nat Struct Mol Biol. 2022;29:130–142. pmid:35173350
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Rangan P, Malone CD, Navarro C, Newbold SP, Hayes PS, Sachidanandam R, et al. piRNA production requires heterochromatin formation in Drosophila. Current Biology. 2011;21(16):1373–1379. pmid:21820311
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. Peccoud J, Loiseau V, Cordaux , Gilbert C. Massive horizontal transfer of transposable elements in insects. Proc Natl Acad Sci U S A. 2017;114(18):4721–26. pmid:28416702
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Scarpa A, Pianezza R, Wierzbicki F, Kofler R. Genomes of historical specimens reveal multiple invasions of LTR retrotransposons in Drosophila melanogaster populations during the 19th century. PNAS (in press). 2023.
View Article
Google Scholar

[82] View Article

[83] Google Scholar

[ref22] 22. Kofler R, Hill T, Nolte V, Betancourt A, Schlötterer C. The recent invasion of natural Drosophila simulans populations by the P-element. PNAS. 2015;112(21):6659–6663. pmid:25964349
View Article
PubMed/NCBI
Google Scholar

[85] View Article

[86] PubMed/NCBI

[87] Google Scholar

[ref23] 23. Signor S, Vedanayagam J, Kim BY, Wierzbicki F, Kofler R, Lai EC. Rapid evolutionary diversification of the flamenco locus across simulans clade Drosophila species. PloS Genetics. 2023;19(8):e1010914. pmid:37643184
View Article
PubMed/NCBI
Google Scholar

[89] View Article

[90] PubMed/NCBI

[91] Google Scholar

[ref24] 24. Zhang S, Pointer B, Kelleher ES. Rapid evolution of piRNA-mediated silencing of an invading transposable element was driven by abundant de novo mutations. Genome Research. 2020;30(4):566–575. pmid:32238416
View Article
PubMed/NCBI
Google Scholar

[93] View Article

[94] PubMed/NCBI

[95] Google Scholar

[ref25] 25. Zanni V, Eymery A, Coiffet M, Zytnicki M, Luyten I, Quesneville H, et al. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters. Proceedings of the National Academy of Sciences. 2013;110(49):19842–19847. pmid:24248389
View Article
PubMed/NCBI
Google Scholar

[97] View Article

[98] PubMed/NCBI

[99] Google Scholar

[ref26] 26. Schaack S, Gilbert C, Feschotte C. Promiscuous DNA: horizontal transfer of transposable elements and why it matters for eukaryotic evolution. Trends in ecology & evolution. 2010;25(9):537–46. pmid:20591532
View Article
PubMed/NCBI
Google Scholar

[101] View Article

[102] PubMed/NCBI

[103] Google Scholar

[ref27] 27. Daniels SB, Peterson KR, Strausbaugh LD, Kidwell MG, Chovnick A. Evidence for horizontal transmission of the P transposable element between Drosophila species. Genetics. 1990;124(2):339–55. pmid:2155157
View Article
PubMed/NCBI
Google Scholar

[105] View Article

[106] PubMed/NCBI

[107] Google Scholar

[ref28] 28. Anxolabéhère D, Kidwell MG, Periquet G. Molecular characteristics of diverse populations are consistent with the hypothesis of a recent invasion of Drosophila melanogaster by mobile P elements. Molecular Biology and Evolution. 1988;5(3):252–269. pmid:2838720
View Article
PubMed/NCBI
Google Scholar

[109] View Article

[110] PubMed/NCBI

[111] Google Scholar

[ref29] 29. Kidwell MG. Evolution of hybrid dysgenesis determinants in Drosophila melanogaster. Proceedings of the National Academy of Sciences. 1983;80(6):1655–1659. pmid:6300863
View Article
PubMed/NCBI
Google Scholar

[113] View Article

[114] PubMed/NCBI

[115] Google Scholar

[ref30] 30. Periquet G, Hamelin MH, Bigot Y, Lepissier A. Geographical and historical patterns of distribution of hobo elements in Drosophila melanogaster populations. Journal of Evolutionary Biology. 1989;2(3):223–229.
View Article
Google Scholar

[117] View Article

[118] Google Scholar

[ref31] 31. Schwarz F, Wierzbicki F, Senti KA, Kofler R. Tirant Stealthily Invaded Natural Drosophila melanogaster Populations during the Last Century. Molecular Biology and Evolution. 2021;38(4):1482–1497. pmid:33247725
View Article
PubMed/NCBI
Google Scholar

[120] View Article

[121] PubMed/NCBI

[122] Google Scholar

[ref32] 32. Loreto ELS, Carareto CMA, Capy P. Revisiting horizontal transfer of transposable elements in Drosophila. Heredity. 2008;100(6):545–54. pmid:18431403
View Article
PubMed/NCBI
Google Scholar

[124] View Article

[125] PubMed/NCBI

[126] Google Scholar

[ref33] 33. Simmons G. Horizontal transfer of hobo transposable elements within the Drosophila melanogaster species complex: evidence from DNA sequencing. Molecular biology and evolution. 1992;9(6):1050–1060. pmid:1331701
View Article
PubMed/NCBI
Google Scholar

[128] View Article

[129] PubMed/NCBI

[130] Google Scholar

[ref34] 34. Blumenstiel JP. Birth, school, work, death, and resurrection: The life stages and dynamics of transposable element proliferation. Genes. 2019;10(5):336. pmid:31058854
View Article
PubMed/NCBI
Google Scholar

[132] View Article

[133] PubMed/NCBI

[134] Google Scholar

[ref35] 35. Anxolabéhère D, Nouaud D, Périquet G, Tchen P. P-element distribution in Eurasian populations of Drosophila melanogaster: a genetic and molecular analysis. Proceedings of the National Academy of Sciences. 1985;82(16):5418–5422. pmid:16593591
View Article
PubMed/NCBI
Google Scholar

[136] View Article

[137] PubMed/NCBI

[138] Google Scholar

[ref36] 36. Bonnivard E, Higuet D. Stability of European natural populations of Drosophila melanogaster with regard to the P-M system: a buffer zone made up of Q populations. Journal of Evolutionary Biology. 1999;12(4):633–647.
View Article
Google Scholar

[140] View Article

[141] Google Scholar

[ref37] 37. Smit AFA, Hubley R, Green P. RepeatMasker Open-3.0; 1996-2010. Available from: http://www.repeatmasker.org.

[ref38] 38. King EG, Merkes CM, McNeil CL, Hoofer SR, Sen S, Broman KW, et al. Genetic dissection of a model complex trait using the Drosophila Synthetic Population Resource. Genome Research. 2012;22(8):1558–1566. pmid:22496517
View Article
PubMed/NCBI
Google Scholar

[144] View Article

[145] PubMed/NCBI

[146] Google Scholar

[ref39] 39. Chakraborty M, Emerson JJ, Macdonald SJ, Long AD. Structural variants exhibit widespread allelic heterogeneity and shape variation in complex traits. Nature Communications. 2019;10(1):4872. pmid:31653862
View Article
PubMed/NCBI
Google Scholar

[148] View Article

[149] PubMed/NCBI

[150] Google Scholar

[ref40] 40. Rech GE, Radío S, Guirao-Rico S, Aguilera L, Horvath V, Green L, et al. Population-scale long-read sequencing uncovers transposable elements associated with gene expression variation and adaptive signatures in Drosophila. Nature Communications. 2022;13(1):1948. pmid:35413957
View Article
PubMed/NCBI
Google Scholar

[152] View Article

[153] PubMed/NCBI

[154] Google Scholar

[ref41] 41. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic acids research. 2004;32(5):1792–1797. pmid:15034147
View Article
PubMed/NCBI
Google Scholar

[156] View Article

[157] PubMed/NCBI

[158] Google Scholar

[ref42] 42. Steinbiss S, Willhoeft U, Gremme G, Kurtz S. Fine-grained annotation and classification of de novo predicted LTR retrotransposons. Nucleic acids research. 2009;37(21):7002–7013. pmid:19786494
View Article
PubMed/NCBI
Google Scholar

[160] View Article

[161] PubMed/NCBI

[162] Google Scholar

[ref43] 43. Quesneville H, Bergman CM, Andrieu O, Autard D, Nouaud D, Ashburner M, et al. Combined evidence annotation of transposable elements in genome sequences. PLoS Computational Biology. 2005;1(2):166–175. pmid:16110336
View Article
PubMed/NCBI
Google Scholar

[164] View Article

[165] PubMed/NCBI

[166] Google Scholar

[ref44] 44. Wheeler DL, Barrett T, Benson DA, Bryant SH, Canese K, Chetvernin V, et al. Database resources of the national center for biotechnology information. Nucleic acids research. 2007;35(suppl_1):D5–D12. pmid:17170002
View Article
PubMed/NCBI
Google Scholar

[168] View Article

[169] PubMed/NCBI

[170] Google Scholar

[ref45] 45. Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, Gavryushkina A, et al. BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLOS Computational Biology. 2019;15(4):e1006650. pmid:30958812
View Article
PubMed/NCBI
Google Scholar

[172] View Article

[173] PubMed/NCBI

[174] Google Scholar

[ref46] 46. Shumate A, Salzberg S. Liftoff: accurate mapping of gene annotations. Bioinformatics. 2021;37(12):1639–1643. pmid:33320174
View Article
PubMed/NCBI
Google Scholar

[176] View Article

[177] PubMed/NCBI

[178] Google Scholar

[ref47] 47. Gramates LS, Agapite J, Attrill H, Calvi BR, Crosby MA, Dos Santos G, et al. FlyBase: a guided tour of highlighted features. Genetics. 2022;220(4):iyac035. pmid:35266522
View Article
PubMed/NCBI
Google Scholar

[180] View Article

[181] PubMed/NCBI

[182] Google Scholar

[ref48] 48. Wierzbicki F, Schwarz F, Cannalonga O, Kofler R. Novel quality metrics allow identifying and generating high-quality assemblies of piRNA clusters. Molecular Ecology Resources. 2021. pmid:34181811
View Article
PubMed/NCBI
Google Scholar

[184] View Article

[185] PubMed/NCBI

[186] Google Scholar

[ref49] 49. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics (Oxford, England). 2010;26(6):841–842. pmid:20110278
View Article
PubMed/NCBI
Google Scholar

[188] View Article

[189] PubMed/NCBI

[190] Google Scholar

[ref50] 50. Wierzbicki F, Kofler R, Signor S. Evolutionary dynamics of piRNA clusters in Drosophila. Molecular Ecology. 2023;32(6):1306–1322. pmid:34878692
View Article
PubMed/NCBI
Google Scholar

[192] View Article

[193] PubMed/NCBI

[194] Google Scholar

[ref51] 51. Grenier JK, Arguello JR, Moreira MC, Gottipati S, Mohammed J, Hackett SR, et al. Global diversity lines–a five-continent reference panel of sequenced Drosophila melanogaster strains. G3: Genes, Genomes, Genetics. 2015;5(4):593–603. pmid:25673134
View Article
PubMed/NCBI
Google Scholar

[196] View Article

[197] PubMed/NCBI

[198] Google Scholar

[ref52] 52. Long Q, Rabanal FA, Meng D, Huber CD, Farlow A, Platzer A, et al. Massive genomic variation and strong selection in Arabidopsis thaliana lines from Sweden. Nature genetics. 2013;45(8):884–890. pmid:23793030
View Article
PubMed/NCBI
Google Scholar

[200] View Article

[201] PubMed/NCBI

[202] Google Scholar

[ref53] 53. Lange JD, Bastide H, Lack JB, Pool JE. A Population Genomic Assessment of Three Decades of Evolution in a Natural Drosophila Population. Molecular Biology and Evolution. 2021;39(2).
View Article
Google Scholar

[204] View Article

[205] Google Scholar

[ref54] 54. Li H, Durbin R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics. 2009;25(14):1754–1760. pmid:19451168
View Article
PubMed/NCBI
Google Scholar

[207] View Article

[208] PubMed/NCBI

[209] Google Scholar

[ref55] 55. Weilguny L, Kofler R. DeviaTE: Assembly-free analysis and visualization of mobile genetic element composition. Molecular Ecology Resources. 2019;19(5):1346–1354. pmid:31056858
View Article
PubMed/NCBI
Google Scholar

[211] View Article

[212] PubMed/NCBI

[213] Google Scholar

[ref56] 56. Hoskins RA, Carlson JW, Wan KH, Park S, Mendez I, Galle SE, et al. The Release 6 reference sequence of the Drosophila melanogaster genome. Genome Research. 2015;25(3):445–458. pmid:25589440
View Article
PubMed/NCBI
Google Scholar

[215] View Article

[216] PubMed/NCBI

[217] Google Scholar

[ref57] 57. Shen W, Le S, Li Y, Hu F. SeqKit: A Cross-Platform and Ultrafast Toolkit for FASTA/Q File Manipulation. PLOS ONE. 2016;11(10):1–10. pmid:27706213
View Article
PubMed/NCBI
Google Scholar

[219] View Article

[220] PubMed/NCBI

[221] Google Scholar

[ref58] 58. Li H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. 2018;34(18):3094–3100. pmid:29750242
View Article
PubMed/NCBI
Google Scholar

[223] View Article

[224] PubMed/NCBI

[225] Google Scholar

[ref59] 59. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–140. pmid:19910308
View Article
PubMed/NCBI
Google Scholar

[227] View Article

[228] PubMed/NCBI

[229] Google Scholar

[ref60] 60. Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics. 2012;. pmid:22517427
View Article
PubMed/NCBI
Google Scholar

[231] View Article

[232] PubMed/NCBI

[233] Google Scholar

[ref61] 61. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic acids research. 1988;16(3):1215. pmid:3344216
View Article
PubMed/NCBI
Google Scholar

[235] View Article

[236] PubMed/NCBI

[237] Google Scholar

[ref62] 62. Luo S, Zhang H, Duan Y, Yao X, Clark AG, Lu J. The evolutionary arms race between transposable elements and piRNAs in Drosophila melanogaster. BMC Evolutionary Biology. 2020;20(1):1–18. pmid:31992188
View Article
PubMed/NCBI
Google Scholar

[239] View Article

[240] PubMed/NCBI

[241] Google Scholar

[ref63] 63. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet journal. 2011;17(1):10–12.
View Article
Google Scholar

[243] View Article

[244] Google Scholar

[ref64] 64. Thurmond J, Goodman JL, Strelets VB, Attrill H, Gramates LS, Marygold SJ, et al. FlyBase 2.0: the next generation. Nucleic acids research. 2019;47(D1):D759–D765. pmid:30364959
View Article
PubMed/NCBI
Google Scholar

[246] View Article

[247] PubMed/NCBI

[248] Google Scholar

[ref65] 65. Selvaraju D, Wierzbicki F, Kofler R. P-element invasions in Drosophila erecta shed light on the establishment of host control over a transposable element. bioRxiv. 2022;.
View Article
Google Scholar

[250] View Article

[251] Google Scholar

[ref66] 66. McInnes L, Healy J, Melville J. Umap: Uniform manifold approximation and projection for dimension reduction. arXiv preprint arXiv:180203426. 2018;.

[ref67] 67. Kim BY, Wang JR, Miller DE, Barmina O, Delaney E, Thompson A, et al. Highly contiguous assemblies of 101 drosophilid genomes. eLife. 2021;10:e66405. pmid:34279216
View Article
PubMed/NCBI
Google Scholar

[254] View Article

[255] PubMed/NCBI

[256] Google Scholar

[ref68] 68. Hotaling S, Sproul JS, Heckenhauer J, Powell A, Larracuente AM, Pauls SU, et al. Long Reads Are Revolutionizing 20 Years of Insect Genome Sequencing. Genome Biology and Evolution. 2021;13(8):evab138. pmid:34152413
View Article
PubMed/NCBI
Google Scholar

[258] View Article

[259] PubMed/NCBI

[260] Google Scholar

[ref69] 69. Srivastav S, Feschotte C, Clark AG. Rapid evolution of piRNA clusters in the Drosophila melanogaster ovary. bioRxiv. 2023;. pmid:37214865
View Article
PubMed/NCBI
Google Scholar

[262] View Article

[263] PubMed/NCBI

[264] Google Scholar

[ref70] 70. Ellison CE, Cao W. Nanopore sequencing and Hi-C scaffolding provide insight into the evolutionary dynamics of transposable elements and piRNA production in wild strains of Drosophila melanogaster. Nucleic Acids Research. 2020;48(1):1–14. pmid:31754714
View Article
PubMed/NCBI
Google Scholar

[266] View Article

[267] PubMed/NCBI

[268] Google Scholar

[ref71] 71. Wang J, Chitsaz F, Derbyshire MK, Gonzales NR, Gwadz M, Lu S, et al. The conserved domain database in 2023. Nucleic Acids Research. 2023;51(D1):D384–D388. pmid:36477806
View Article
PubMed/NCBI
Google Scholar

[270] View Article

[271] PubMed/NCBI

[272] Google Scholar

[ref72] 72. Eickbush TH, Malik HS. Origins and evolution of retrotransposons. vol. 93. ASM Press; 2002.

[ref73] 73. Linheiro RS, Bergman CM. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster. PloS one. 2012;7(2):e30008. pmid:22347367
View Article
PubMed/NCBI
Google Scholar

[275] View Article

[276] PubMed/NCBI

[277] Google Scholar

[ref74] 74. Neumann P, Novák P, Hoštáková N, Macas J. Systematic survey of plant LTR-retrotransposons elucidates phylogenetic relationships of their polyprotein domains and provides a reference for element classification. Mobile DNA. 2019;10:1–17. pmid:30622655
View Article
PubMed/NCBI
Google Scholar

[279] View Article

[280] PubMed/NCBI

[281] Google Scholar

[ref75] 75. Wells JN, Feschotte C. A field guide to eukaryotic transposable elements. Annual review of genetics. 2020;54:539–561. pmid:32955944
View Article
PubMed/NCBI
Google Scholar

[283] View Article

[284] PubMed/NCBI

[285] Google Scholar

[ref76] 76. Diaz-Papkovich A, Anderson-Trocmé L, Gravel S. A review of UMAP in population genetics. Journal of Human Genetics. 2021;66(1):85–91. pmid:33057159
View Article
PubMed/NCBI
Google Scholar

[287] View Article

[288] PubMed/NCBI

[289] Google Scholar

[ref77] 77. Sienski G, Dönertas D, Brennecke J. Transcriptional silencing of transposons by Piwi and maelstrom and its impact on chromatin state and gene expression. Cell. 2012;151(5):964–980. pmid:23159368
View Article
PubMed/NCBI
Google Scholar

[291] View Article

[292] PubMed/NCBI

[293] Google Scholar

[ref78] 78. Lindsley DH, Grell EH. Genetic variations of Drosophila melanogaster. Carnegie Institute of Washington Publication; 1968.

[ref79] 79. Bergman CM, Quesneville H, Anxolabéhère D, Ashburner M. Recurrent insertion and duplication generate networks of transposable element sequences in the Drosophila melanogaster genome. Genome Biology. 2006;7(11):R112. pmid:17134480
View Article
PubMed/NCBI
Google Scholar

[296] View Article

[297] PubMed/NCBI

[298] Google Scholar

[ref80] 80. Malone CD, Hannon GJ. Small RNAs as Guardians of the Genome. Cell. 2009;136(4):656–668. pmid:19239887
View Article
PubMed/NCBI
Google Scholar

[300] View Article

[301] PubMed/NCBI

[302] Google Scholar

[ref81] 81. Goriaux C, Théron E, Brasset E, Vaury C. History of the discovery of a master locus producing piRNAs: The flamenco/COM locus in Drosophila melanogaster. Frontiers in Genetics. 2014;5:257. pmid:25136352
View Article
PubMed/NCBI
Google Scholar

[304] View Article

[305] PubMed/NCBI

[306] Google Scholar

[ref82] 82. Kofler R. Dynamics of Transposable Element Invasions with piRNA Clusters. Molecular Biology and Evolution. 2019;36(7):1457–1472. pmid:30968135
View Article
PubMed/NCBI
Google Scholar

[308] View Article

[309] PubMed/NCBI

[310] Google Scholar

[ref83] 83. Wierzbicki F, Kofler R. The composition of piRNA clusters in Drosophila melanogaster deviates from expectations under the trap model. BMC Biology. 2023;. pmid:37858221
View Article
PubMed/NCBI
Google Scholar

[312] View Article

[313] PubMed/NCBI

[314] Google Scholar

[ref84] 84. Bao W, Kojima KK, Kohany O. RepBase Update, a database of repetitive elements in eukaryotic genomes. Mobile Dna. 2015;6:1–6. pmid:26045719
View Article
PubMed/NCBI
Google Scholar

[316] View Article

[317] PubMed/NCBI

[318] Google Scholar

[ref85] 85. Bartolomé C, Bello X, Maside X. Widespread evidence for horizontal transfer of transposable elements across Drosophila genomes. Genome biology. 2009;10(2):R22. pmid:19226459
View Article
PubMed/NCBI
Google Scholar

[320] View Article

[321] PubMed/NCBI

[322] Google Scholar

[ref86] 86. Wallau GL, Ortiz MF, Loreto ELS. Horizontal transposon transfer in eukarya: detection, bias, and perspectives. Genome Biology and Evolution. 2012;4(8):801–811.
View Article
Google Scholar

[324] View Article

[325] Google Scholar

[ref87] 87. Burla H, da Cunha AB, Cordeiro AR, Dobzhansky T, Malogolowkin C, Pavan C. The Willistoni Group of Sibling Species of Drosophila. Evolution. 1949;3(4):300–314. pmid:15396748
View Article
PubMed/NCBI
Google Scholar

[327] View Article

[328] PubMed/NCBI

[329] Google Scholar

[ref88] 88. Spassky B, Richmond RC, Perez-Salas S, Pavlovsky O, Mourao CA, Hunter AS, et al. Geography of the Sibling Species Related to Drosophila willistoni, and of the Semispecies of the Drosophila Paulistorum Complex. Evolution. 1971;25(1):129–143. pmid:28562939
View Article
PubMed/NCBI
Google Scholar

[331] View Article

[332] PubMed/NCBI

[333] Google Scholar

[ref89] 89. Zanini R, Deprá M, Valante V. On the geographic distribution of the Drosophila willistoni group (Diptera, Drosophilidae)—updated geographic distribution of the Neotropical willistoni subgroup. Drosophila Information Service. 2015;98:39–43.
View Article
Google Scholar

[335] View Article

[336] Google Scholar

[ref90] 90. Sturtevant AH. The North American species of Drosophila. Nature. 1921;107:1476–4687.
View Article
Google Scholar

[338] View Article

[339] Google Scholar

[ref91] 91. Johnson CW. The distribution of some species of Drosophila. Psyche. 1913;20:202–205.
View Article
Google Scholar

[341] View Article

[342] Google Scholar

[ref92] 92. Bock IR, Parsons PA. Species of Australia and New Zealand. In: Ashburner M, Carson LH, Thompson JHJ, editors. The genetics and biology of Drosophila. vol. 3a. Oxford: Academic Press; 1981. p. 349–393.

[ref93] 93. Heed WB, Russell JS. Phylogeny and population structure in island and continental species of the cardini group of Drosophila studied by inversion analysis. Stud Genet. 1971;.
View Article
Google Scholar

[345] View Article

[346] Google Scholar

[ref94] 94. Brisson JA, Wilder J, Hollocher H. Phylogenetic analysis of the cardini group of Drosophila with respect to changes in pigmentation. Evolution. 2006;60(6):1228–1241. pmid:16892973
View Article
PubMed/NCBI
Google Scholar

[348] View Article

[349] PubMed/NCBI

[350] Google Scholar

[ref95] 95. Peccoud J, Cordaux R, Gilbert C. Analyzing Horizontal Transfer of Transposable Elements on a Large Scale: Challenges and Prospects. Bioessays. 2018;40(2). pmid:29283188
View Article
PubMed/NCBI
Google Scholar

[352] View Article

[353] PubMed/NCBI

[354] Google Scholar

[ref96] 96. Wallau GL, Ortiz MF, Loreto ELS. Horizontal transposon transfer in eukarya: detection, bias, and perspectives. Genome Biol Evol. 2012;4(8):689–699. pmid:22798449
View Article
PubMed/NCBI
Google Scholar

[356] View Article

[357] PubMed/NCBI

[358] Google Scholar

[ref97] 97. Kofler R, Senti KA, Nolte V, Tobler R, Schlötterer C. Molecular dissection of a natural transposable element invasion. Genome Research. 2018;28(6):824–835. pmid:29712752
View Article
PubMed/NCBI
Google Scholar

[360] View Article

[361] PubMed/NCBI

[362] Google Scholar

[ref98] 98. Kofler R, Nolte V, Schlötterer C. The Transposition Rate Has Little Influence on the Plateauing Level of the P-element. Molecular Biology and Evolution. 2022;39(7):msac141. pmid:35731857
View Article
PubMed/NCBI
Google Scholar

[364] View Article

[365] PubMed/NCBI

[366] Google Scholar

[ref99] 99. Pool JE. The Mosaic Ancestry of the Drosophila Genetic Reference Panel and the D. melanogaster Reference Genome Reveals a Network of Epistatic Fitness Interactions. Molecular biology and evolution. 2015; p. msv194.
View Article
Google Scholar

[368] View Article

[369] Google Scholar

[ref100] 100. Capy P, Gibert P. Drosophila melanogaster, Drosophila simulans: so similar yet so different. Genetica. 2004;120(1-3):5–16. pmid:15088643
View Article
PubMed/NCBI
Google Scholar

[371] View Article

[372] PubMed/NCBI

[373] Google Scholar

[ref101] 101. Kapun M, Barrón MG, Staubach F, Obbard DJ, Wiberg RAW, Vieira J, et al. Genomic analysis of European Drosophila melanogaster populations reveals longitudinal structure, continent-wide selection, and previously unknown DNA viruses. Molecular Biology and Evolution. 2020;37(9):2661–2678. pmid:32413142
View Article
PubMed/NCBI
Google Scholar

[375] View Article

[376] PubMed/NCBI

[377] Google Scholar

[ref102] 102. Machado HE, Bergland AO, Taylor R, Tilk S, Behrman E, Dyer K, et al. Broad geographic sampling reveals the shared basis and environmental correlates of seasonal adaptation in Drosophila. Elife. 2021;10:e67577. pmid:34155971
View Article
PubMed/NCBI
Google Scholar

[379] View Article

[380] PubMed/NCBI

[381] Google Scholar

[ref103] 103. Obbard DJ, Maclennan J, Kim KW, Rambaut A, O’Grady PM, Jiggins FM. Estimating Divergence Dates and Substitution Rates in the Drosophila Phylogeny. Molecular Biology and Evolution. 2012;29(11):3459–3473. pmid:22683811
View Article
PubMed/NCBI
Google Scholar

[383] View Article

[384] PubMed/NCBI

[385] Google Scholar

[ref104] 104. Prakash S. Genetic divergence in closely related sibling species Drosophila pseudoobscura, Drosophila persimilis and Drosophila miranda. Evolution. 1977; p. 14–23. pmid:28567734
View Article
PubMed/NCBI
Google Scholar

[387] View Article

[388] PubMed/NCBI

[389] Google Scholar

[ref105] 105. Regner L, Pereira M, Alonso C, Abdelhay E, Valente V. Genomic distribution of P elements in Drosophila willistoni and a search for their relationship with chromosomal inversions. Journal of Heredity. 1996;87(3):191–198. pmid:8683096
View Article
PubMed/NCBI
Google Scholar

[391] View Article

[392] PubMed/NCBI

[393] Google Scholar

[ref106] 106. Bergman CM, Bensasson D. Recent LTR retrotransposon insertion contrasts with waves of non-LTR insertion since speciation in Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America. 2007;104(27):11340–5. pmid:17592135
View Article
PubMed/NCBI
Google Scholar

[395] View Article

[396] PubMed/NCBI

[397] Google Scholar

[ref107] 107. Bucheton A, Lavige J, Picard G, L’heritier P. Non-mendelian female sterility in Drosophila melanogaster: quantitative variations in the efficiency of inducer and reactive strains. Heredity. 1976;36(3):305–314. pmid:819401
View Article
PubMed/NCBI
Google Scholar

[399] View Article

[400] PubMed/NCBI

[401] Google Scholar

[ref108] 108. Kidwell MG, Kidwell JF, Sved JA. Hybrid dysgenesis in Drosophila melanogaster: A syndrome of aberrant traits including mutations, sterility and male recombination. Genetics. 1977;86(4):813–833. pmid:17248751
View Article
PubMed/NCBI
Google Scholar

[403] View Article

[404] PubMed/NCBI

[405] Google Scholar

[ref109] 109. Blackman RK, Grimaila R, Macy M, Koehler D, Gelbart WM. Mobilization of hobo elements residing within the decapentaplegic gene complex: Suggestion of a new hybrid dysgenesis system in Drosophila melanogaster. Cell. 1987;49(4):497–505. pmid:3032458
View Article
PubMed/NCBI
Google Scholar

[407] View Article

[408] PubMed/NCBI

[409] Google Scholar

[ref110] 110. Schmidt JM, Good RT, Appleton B, Sherrard J, Raymant GC, Bogwitz MR, et al. Copy number variation and transposable elements feature in recent, ongoing adaptation at the Cyp6g1 locus. PLoS genetics. 2010;6(6):e1000998. pmid:20585622
View Article
PubMed/NCBI
Google Scholar

[411] View Article

[412] PubMed/NCBI

[413] Google Scholar

[ref111] 111. Wang L, Zhang S, Hadjipanteli S, Saiz L, Nguyen L, Silva E, et al. P-element invasion fuels molecular adaptation in laboratory populations of Drosophila melanogaster. Evolution. 2023;77(4):980–994. pmid:36749648
View Article
PubMed/NCBI
Google Scholar

[415] View Article

[416] PubMed/NCBI

[417] Google Scholar

[ref112] 112. Scarpa A, Kofler R. The impact of paramutations on the invasion dynamics of transposable elements. Genetics. 2023; p. iyad181. pmid:37819004
View Article
PubMed/NCBI
Google Scholar

[419] View Article

[420] PubMed/NCBI

[421] Google Scholar

[ref113] 113. Hermant C, Boivin A, Teysset L, Delmarre V, Asif-Laidin A, Van Den Beek M, et al. Paramutation in Drosophila requires both nuclear and cytoplasmic actors of the piRNA pathway and induces cis-spreading of piRNA production. Genetics. 2015;201(4):1381–1396. pmid:26482790
View Article
PubMed/NCBI
Google Scholar

[423] View Article

[424] PubMed/NCBI

[425] Google Scholar

[ref114] 114. Shpiz S, Ryazansky S, Olovnikov I, Abramov Y, Kalmykova A. Euchromatic transposon insertions trigger production of novel pi-and endo-siRNAs at the target sites in the Drosophila germline. PLoS Genetics. 2014;10(2):e1004138. pmid:24516406
View Article
PubMed/NCBI
Google Scholar

[427] View Article

[428] PubMed/NCBI

[429] Google Scholar

[ref115] 115. Mohn F, Sienski G, Handler D, Brennecke J. The rhino-deadlock-cutoff complex licenses noncanonical transcription of dual-strand piRNA clusters in Drosophila. Cell. 2014;157(6):1364–1379. pmid:24906153
View Article
PubMed/NCBI
Google Scholar

[431] View Article

[432] PubMed/NCBI

[433] Google Scholar

[ref116] 116. Ashburner M, Bergman CM. Drosophila melanogaster: A case study of a model genomic sequence and its consequences. Cold Spring Harbor perspectives in biology. 2005;15:1661–1667.
View Article
Google Scholar

[435] View Article

[436] Google Scholar

[ref117] 117. Green MM. Mobile DNA elements and spontaneous gene mutation. Banbury Rep. 1988;30:41–50.
View Article
Google Scholar

[438] View Article

[439] Google Scholar

[ref118] 118. Sankaranarayanan K. Mobile genetic elements, spontaneous mutations, and the assessment of genetic radiation hazards in man. Cold Spring Harbor; 1988.

[ref119] 119. Manni M, Berkeley MR, Seppey M, Simão FA, Zdobnov EM. BUSCO update: novel and streamlined workflows along with broader and deeper phylogenetic coverage for scoring of eukaryotic, prokaryotic, and viral genomes. Molecular biology and evolution. 2021;38(10):4647–4654. pmid:34320186
View Article
PubMed/NCBI
Google Scholar

[442] View Article

[443] PubMed/NCBI

[444] Google Scholar

[ref120] 120. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular systems biology. 2011;7(1):539. pmid:21988835
View Article
PubMed/NCBI
Google Scholar

[446] View Article

[447] PubMed/NCBI

[448] Google Scholar

[ref121] 121. Suyama M, Torrents D, Bork P. PAL2NAL: robust conversion of protein sequence alignments into the corresponding codon alignments. Nucleic acids research. 2006;34(suppl_2):W609–W612. pmid:16845082
View Article
PubMed/NCBI
Google Scholar

[450] View Article

[451] PubMed/NCBI

[452] Google Scholar

[ref122] 122. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology. 1990;215(3):403–410. pmid:2231712
View Article
PubMed/NCBI
Google Scholar

[454] View Article

[455] PubMed/NCBI

[456] Google Scholar

[ref123] 123. Mackay TF, Richards S, Stone EA, Barbadilla A, Ayroles JF, Zhu D, et al. The Drosophila melanogaster genetic reference panel. Nature. 2012;482(7384):173–178. pmid:22318601
View Article
PubMed/NCBI
Google Scholar

[458] View Article

[459] PubMed/NCBI

[460] Google Scholar

Figures

Abstract

Author summary

Introduction

Materials and methods

Discovery of the recent Spoink invasion

Structure and classification of Spoink

Distribution of Spoink insertions

Abundance of Spoink insertions in different D. melanogaster strains

Population frequency of Spoink insertions

PCR

Small RNAs

UMAP

Origin of horizontal transfer

Results

Spoink recently invaded worldwide D. melanogaster populations

Timing the Spoink invasion

Geographic heterogeneity in the Spoink sequence variation

Spoink is silenced by the piRNA pathway in natural populations

Origin of Spoink

Discussion

Supporting information

S1 Fig. Abundance of Spoink and P-element insertions in different genomic features.

S2 Fig. DeviaTE plots of six D. melanogaster strains collected during the last century.

S3 Fig. Abundance of Spoink insertions in six long-read assemblies of D. melanogaster strains collected during the last century.

S4 Fig. The Sanger sequence of the six PCR amplicons matches with the consensus sequence of Spoink.

S5 Fig. Abundance and composition of Spoink insertions in the GDL.

S6 Fig. A piRNA based defence against Spoink is active in the 10 GDL strains.

S7 Fig. Barplots show the similarity between the consensus sequence of Spoink and the best match in each of 99 long-read assemblies of diverse insect species.

S8 Fig. Star phylogeny of Spoink insertions in the different drosophilid species.

S9 Fig. Distribution of synonymous divergence for Spoink and 140 single copy orthologous genes shared between D. melanogaster and D. willistoni (red).

S10 Fig. Average distance between 100 pairs of Spoink insertions randomly sampled within either the melanogaster group (i.e D. melanogaster, D. simulans, D. sechellia) or the willistoni group.

S1 Table. Differences in the abundance of Gypsy_7_DEl between the reference genome Iso1 and a long-read assemblies from a more recently collected strain.

S2 Table. Similarity between Spoink and other TEs in the different repeat libraries generated for D. melanogaster.

S3 Table. Coordinates of Spoink insertions in the strains RAL091, RAL176 and RAL732 used for Fig 1A of the main manuscript.

S4 Table. Identity of sequences in Oregon-R having some similarity with the consensus sequence of Spoink.

S5 Table. Overview of the short-read data analysed in this work.

S6 Table. Overview of the long-read assemblies of D. melanogaster strains analysed in this work.

S7 Table. Spoink insertions in piRNA clusters of long-read assemblies of different D. melanogaster strains [40].

S8 Table. Overview of the long-read assemblies of diverse insect species analysed in this work.

Acknowledgments

References