Klebsiella pneumoniae and Proteus mirabilis correlate with the presence of colitis in TRUC mice

We also performed quantitative cultures to obtain independent verification of differences in bacterial burden for defined species and to have culturable isolates available for the purposes of testing Koch's postulates regarding specific effects of individual strains on disease initiation and progression. A total of 57 bacterial species were recovered and identified from fecal pellets obtained from 3 TRUC and 3 Rag2^−/− mice surveyed at 2, 4, 6, 8, and 10 weeks of age, and their mothers (Fig. 2A and Supplemental Table 2).

Open in a separate window

Fig 2

The presence of Klebsiella pneumoniae and Proteus mirabilis correlates with the presence of colitis in TRUC mice

(A) Culture-based identification of bacterial species present in fecal samples from the same animals and time points as analyzed in Fig. 1. Species observed in more than one animal or in one animal at more than one time point are shown. Inset is a summary of bacterial species-level differences in the fecal microbiota of TRUC versus Rag2−/− mice observed in 2A. (B) Upper panel: Histologic colitis scores demonstrate the in vivo antibiotic sensitivities of TRUC colitis. Each dot represents an individual mouse treated for four weeks with the indicated antibiotics dissolved in drinking water. VMNA refers to treatment with a combination of vancomycin, metronidazole, neomycin, and ampicillin. Horizontal bars represent the mean. p-value ≤0.0001 defined by Mann-Whitney test. Lower panel: Summary of in vitro antibiotic sensitivities for several species selectively detected in TRUC fecal microbiota. (C) Culture-based survey of Gram-negative aerobes present in fecal samples from TRUC (shaded circles) and Rag2^−/− (open circles) at 2-20 weeks of age. Fecal samples were collected and cultured twice at each time point from Rag2^−/− mice. (D) In vivo sensitivity of Klebsiella pneumoniae (squares) and Proteus mirabilis (circles), as defined by culture-base surveys of TRUC fecal samples collected 1d before (shaded symbol) and 1d after (open symbol) treatment with antibiotic. Each dot represents data from a fecal sample obtained from one mouse. Horizontal bars represent the mean value. (E) Fluorescence In Situ Hybridization using an Oregon-Green® 488 conjugated “Universal bacterial” 16S rRNA-directed oligonucleotide probe (EUB 338) demonstrates the presence of bacteria in the mucus layer and directly adjacent to the epithelium in TRUC mice. Upper panels: TRUC, lower panels: Rag2^−/−. A 10 micron scale bar for the panel is shown in the lower left of the first image. (F) Enterobacteriaceae (red), Klebsiella (red), and Proteus (red) were visualized adjacent to the epithelium in TRUC mice using fluor-conjugated 16S rRNA or 23S rRNA oligonucleotide probes [(pB-00914 (Enterobacteriaceae), pB-00352 (Klebsiella pneumoniae), pB-02110 (Proteus mirabilis)]. Sections were also hybridized with the EUB338 universal bacterial probe (green). Scale bars (10 micron) are shown for each image. (G) Enterobacteriaceae (red), Klebsiella (red), and Proteus (red) probe signals are seen adjacent to or along the epithelium in TRUC mice. Epithelial cell nuclei were stained with DAPI. White star symbols mark bacteria in (F) and (G). Scale bars (10 micron) are shown for each image.

Subsequent experiments administering oral antibiotics helped further refine potential classes of commensal organisms that contribute to the colitogenic phenotype. Orally administering gentamicin or metronidazole was highly effective in ameliorating TRUC colitis and resulted in clinically and statistically significant changes in colitis scores (mean colitis score 0.5±0.52, p<.0001 compared to water control). In contrast, mice treated with oral vancomycin still demonstrated clinically significant disease (mean colitis score 4.6±0.96, p<.0001 compared to gentamicin or metronidazole; p<.03 compared to water) (Fig. 2B). The ability of gentamicin or metronidazole to prevent the development of colitis in the TRUC mice suggested a role for Gram negative facultative organisms.

We next evaluated the in vitro antibiotic resistance profiles of the commensal strains selectively recovered from TRUC but not Rag2^−/− fecal samples (Fig. 2A, Fig. 2B lower panel). Susceptibility testing demonstrated that Klebsiella pneumoniae and Proteus mirabilis, both facultative enterics, were sensitive to gentamicin but, not surprisingly, were resistant to vancomycin (Fig. 2B lower panel). These results corresponded to the in vivo antibiotic sensitivity of the colitis (Fig. 2B upper panel).

We then performed a more extensive, culture-based survey of a larger number of TRUC and Rag2^−/− mice to determine if these bacteria were present in afflicted mice but absent from healthy mice. In our initial culture-based screen, Klebsiella pneumoniae counts were below our detection limit at a few time points sampled for the TRUC mice. We subsequently performed a more intensive analysis with more sample mass and found that Klebsiella pneumoniae and Proteus mirabilis were culturable in all TRUC mice tested (n = 126), at every time point examined (Fig. 2C). In contrast, both species were consistently below our limit of detection (4.4 log₁₀ CFU/g fecal material) in every Rag2^−/− mouse surveyed at each time point (Fig. 2C).

We treated 4-week old TRUC mice with antibiotics using the protocol shown previously to ameliorate colitis, and cultured feces obtained 1d before and 1d after antibiotic administration. After treatment with gentamicin or metronidazole, fecal levels of K. pneumoniae and P. mirabilis fell below our limit of detection (Fig. 2D). In contrast, treatment with vancomycin neither abolished colitis nor reduced levels of K. pneumoniae and P. mirabilis (Fig 2D).

These two findings suggested that K. pneumoniae and P. mirabilis may play a role in the disease pathogenesis of TRUC. To evaluate this hypothesis, we first determined the physical location of these species using 16S and 23S rDNA fluorescence in situ hybridization (FISH) oligonucleotide probes on whole colonic sections, with a focus on the degree of colonization in the lumen, mucus layer over the epithelium, and the mucosa. As has been reported in inflammatory bowel disease patients using a universal bacterial 16S rRNA FISH probe (Swidsinski et al., 2005), we observed that the colonic mucus of colitic TRUC mice harbored numerous bacteria and that there was a consistent loss of a ‘bacterial-free zone’ adjacent to the colonic epithelium (Fig. 2E). Healthy (non-colitic) Rag2^−/− mice did not exhibit any of these phenotypes (Fig. 2E). We subsequently employed a set of probeBase consortium 23S and 16S rDNA probes to detect K. pneumoniae and P. mirabilis (Loy A et al., 2007). We were able to visualize a small number of organisms that reacted with these reagents adjacent to the epithelium (Fig. 2F and G). These data suggested that K. pneumonia and P. mirabilis may have invasive potential or that the proximity of their bacterial products to the apical epithelial surface may trigger inflammatory responses in the absence of frank invasion. Either could explain their role in TRUC colitis as access to the mucosa would increase the opportunity for eliciting a host pro-inflammatory response.

Klebsiella pneumoniae and Proteus mirabilis elicit colitis but require a maternally-transmitted endogenous microbial community for maximal intestinal inflammation

To further evaluate the relevance of K. pneumoniae and P. mirabilis, we took advantage of a transmissible model of TRUC (Garrett et al., 2007). Following postnatal exposure to a TRUC dam, wild-type (WT) and Rag2^−/− mice develop histopathologic features of colitis (penetrance of phenotype: 94% at 8 weeks of age) (Garrett et al., 2007). We first asked if this maternally transmitted disease had a pattern of antibiotic sensitivity that was similar to spontaneous TRUC colitis. Therefore, we cross-fostered TRUC, Rag2−/−, and WT pups on TRUC mothers who received water, gentamicin, metronidazole, or vancomycin from pre-conception through weaning. Gentamicin and metronidazole markedly improved the colitis score for all mice in a statistically significant fashion while vancomycin did not-- similar to what we observed in spontaneous TRUC colitis [n = 2 foster mothers/genotype; 2-4 pups per litter surveyed] (Fig 3A).

Open in a separate window

Fig 3

Klebsiella pneumoniae and Proteus mirabilis elicit colitis but require a maternally-transmitted endogenous microbial community for maximal intestinal inflammation

(A) The antibiotic sensitivities of colitis transmitted via TRUC cross-fostering are the same as spontaneous TRUC colitis. Antibiotic-treated pregnant TRUC females were used as foster mothers and treated with antibiotics in their water until weaning. Histologic colitis scores are shown for the fostered mice at 8 weeks of age. (B) Klebsiella pneumoniae (squares) and Proteus mirabilis (circles) are detected in the fecal microbiota of TRUC cross-fostered Rag2^−/− and WT mice at 8 weeks of age but not in 8 week old TRUC mice fostered by Rag2^−/− or WT mice. TRUC-fostered TRUC, Rag2^−/−-fostered Rag2^−/−, and WT-fostered WT are shown as controls. Limits of detection; 10^4.4 cfu/g dry weight of feces. Each filled square or circle represents a fecal sample from a different animal. (C) Left panel: Fecal bacterial counts for co-colonized gnotobiotic TRUC mice. Mean values ±1 S.D. are shown for Klebsiella pneumoniae (squares) and Proteus mirabilis (circles) (n=5 mice). Right panel: Histologic colitis scores of germ-free TRUC and germ-free TRUC mice co-colonized with Klebsiella pneumoniae and Proteus mirabilis from the TRUC mother in Fig. 1. (D) Left panel: Klebsiellapneumoniae and Proteus mirabilis fecal cfu in Rag2^−/− and WT mice treated every other day from 2-10 weeks of age with 10⁷ cfu of E. coli, Proteus mirabilis, Klebsiella pneumoniae, or a combination of both added to their drinking water (all strains isolated from the TRUC mother in Fig. 1). Right panel: Histologic scores for colitis as assayed at sacrifice at 10 weeks of age. Each filled circle represents a separate animal in the treatment group. p-values shown were calculated using the Mann-Whitney test.

We cultured fecal samples obtained from WT and Rag2^−/− mice that developed colitis as a result of TRUC cross-fostering (Fig. 3B). K. pneumoniae and P. mirabilis were detected in all fecal samples obtained from 8 week old TRUC-fostered Rag2^−/− and WT pups, and at levels comparable to age-matched TRUC-fostered TRUC mice. In contrast, neither of these organisms was detected in any control Rag2^−/−-fostered Rag2^−/− or WT-fostered WT animals (n = 2 foster mothers/genotype; 2-3 pups per litter surveyed; Fig. 3B). Neither TRUC mice fostered on Rag2^−/− nor WT mothers had evidence of colitis at 8 weeks of age and of K. pneumoniae or P. mirabilis. These Rag2^−/− or WT fostered TRUC had no evidence of histologic colitis at 8 weeks of age and K. pneumoniae and P. mirabilis were not detectable at that time point (Fig. S2; Fig 3B).

The presence of K. pneumoniae and P. mirabilis in colitic TRUC mice and TRUC fostered Rag2^−/− and WT mice and the lack of detectable levels of these bacteria in the fecal microbiota of healthy Rag2^−/−, WT, and WT or Rag2^−/− fostered TRUC provided additional evidence for an association between the presence of these bacteria and colitis.

One possibility is that the presence of K. pneumoniae and P. mirabilis is a consequence rather than a cause of inflammation. For example, intestinal inflammation caused by Citrobacter rodentium has been suggested to drive blooms of Enterobacteriaceae, although this result is controversial (Hoffmann et al., 2009; Lupp et al., 2007). To investigate the effects of inflammation on intestinal colonization by K. pneumoniae and P. mirabilis, we treated 8 week-old WT and Rag2^−/− mice with dextran sulfate sodium, a mucosal disruptant and irritant, to induce colitis (n=8 mice/genotype). We did not detect culturable K. pneumoniae or P. mirabilis in the fecal microbiota of any of these mice during our period of surveillance (n=8 mice/genotype; samples collected before and 1d after the completion of a one week treatment course; Fig. S1) arguing against an inflammatory response per se causing expansion of K. pneumoniae and P. mirabilis in the gut microbiota of TRUC mice.

To directly test the colitogenic potential of K. pneumoniae and P. mirabilis, we re-derived conventionally-raised TRUC mice as germ-free and co-colonized the animals with these two Enterobacteriaceae at 8 weeks of age for 8 weeks (n = 5 mice). Both organisms established themselves in the guts of all recipients (mean value 10^11.29±0.46 cfu/microbial species/g dry weight of feces; assayed 48h and weekly after the initial gavage) (Fig. S2). Colonic inflammation did not develop in these co-colonized gnotobiotic TRUC mice, suggesting that interactions among K. pneumoniae and P.mirabilis and other members of a gut microbial community are required to ignite the immuno-inflammatory cascade that leads to colitis. To evaluate this possibility, we colonized 2 week-old specified pathogen-free WT and Rag2^−/− mice with Klebsiella pneumoniae, P. mirabilis, or a combination of K. pneumoniae and P. mirabilis (these strains were recovered from feces obtained from the female TRUC mother in Fig. 2A and were administered by direct oral instillation of 10⁷ cfu, and by addition of 10⁷ cfu to the drinking water every other day for 8 weeks; n= 5-18 mice/treatment group). Control groups of mice received a TRUC-derived E. coli strain. Both K. pneumoniae and P. mirabilis established themselves in the gut microbiota of both Rag2^−/− and WT (as defined by cfu assays of feces obtained 2d after the completion of an 8-week course of treatment; Fig. 3C). Feces from WT and Rag2^−/− hosts contain E. coli, but we did not have the tools to distinguish these indigenous strains from the exogenously administered TRUC-associated E. coli strain. While no colonic inflammation was observed after inoculation with E. coli (Fig. 3D), treatment with P. mirabilis, K. pneumoniae, or a combination of the two organisms, induced inflammation in both WT and Rag2^−/− mice with the severity of the colitis being significantly greater in Rag2^−/− mice exposed to both species, compared to P. mirabilis alone (Fig. 3D). Taken together, these results suggest that two Enterobacteriaceae in concert with members of the microbiota are able to elicit colitis, even in mice that are not genetically predisposed to developing immunopathologic responses.

The penetrance and severity of colitis observed in the co-colonization experiments with K. pneumoniae and P. mirabilis were decreased compared to what we had previously observed in the spontaneous TRUC model (e.g. Fig. 2C) and in neonatal cross-fostering experiments (TRUC-fostered Rag2^−/− mean colitis score 5.6±1.14 and TRUC-fostered WT 3.17±.75 (Fig. 3A)). Instead, it resembled what we had observed in experiments where adult TRUC mice were co-housed with adult Rag2^−/− or WT mice (Garrett et al., 2007), speaking to a possible role of maternal/foster bacterial and non-bacterial factors in structuring microbial communities in the neonate. Consistent with this, we found that TRUC milk has a pro-inflammatory cytokine profile (Fig. S5) and that the microbiota of 2 week old TRUC mice clusters in a distinct group as judged by PCoA plots of UniFrac measurements of 16S rRNA-defined communities (Fig. 1A).

16S rRNA-based analyses of fecal microbial communities

Culture-based studies of fecal microbial community structure

Fecal collection and culture of Gram-negative aerobes

Individual mice were placed in autoclaved plastic cages. Fecal pellets were transferred immediately upon expulsion into capped microfuge tubes. 4-6 pellets were collected per mouse per time point. All Rag2^−/−mice in Fig. 2F were sampled twice over a 3d period for each weekly time point. Pellets were resuspended in sterile PBS and 10-fold serial dilutions were generated, plated on MacConkey's medium, and incubated in ambient air at 37°C overnight. Biochemical assays with the API-20E panel (bioMerieux) confirmed that colony morphology correlated with Klebsiella pneumoniae, Proteus mirabilis, or E. coli: therefore, these organisms were subsequently identified based on their colony morphotypes.

The lower limit of detection for these studies was 10^4.4 cfu/gram fecal dry weight. A minimum of 30 colonies or a maximum of 300 colonies was counted at a given dilution and the serial dilution had to appropriately reflect the colony counts for the quantitative counts to pass our quality control standards.

Histology

Colons were harvested upon sacrifice and colonic contents were removed prior to fixation in 4% paraformaldehyde. Following paraffin embedding, sections (0.5 μm thick) were cut and stained with hematoxylin and eosin. Histopathology was evaluated in a blinded fashion (with respect to genotype and experimental protocol) by J.N.G. using four parameters: mononuclear cell infiltration, polymorphonuclear cell infiltration, epithelial hyperplasia, and epithelial injury that were scored as absent (0), mild (1), moderate (2), or severe (3) as described previously (Neurath et al., 2002).

Antibiotic treatment of TRUC colitis

Mice were treated with the following antibiotics dissolved in their autoclaved drinking water as indicated: ampicillin (1g/L; Roche), vancomycin (500mg/L; Sigma), neomycin sulfate (1g/L; Sigma), metronidazole (1g/L; Sigma, solubilized with 15ml of 0.1N acetic acid/L), and gentamicin (2g/L; Cell Gro); and fluid intake monitored.

Fluorescence In Situ Hybridization (FISH)

Colons were harvested from 16 Rag2−/− and 15 TRUC (3-8 week old) mice and fixed in Carnoy's solution overnight, embedded in paraffin, and 5μm thick sections were prepared (Swidsinksi et al., 2005). The sequences of the following FISH probes were obtained from probeBase (http://www.microbial-ecology.net/probebase/) (Loy A et al., 2007): the ‘universal’ bacterial probe-EUB338 (pB-00159), the Enterobacteriaceae targeted probe (pB-00914), the Klebsiella pneumoniae-directed probe (pB-00352), and the P. mirabilis probe (pB-02110). While several of these probes have been validated for FISH by investigators (Kemp VA et al., 2000, Friedrich U et al., 2003), searches of the probeBase probecheck, Greengenes, and RDP2 databases indicated that the K. pneumoniae and P. mirabilis probes are not species-specific. Therefore, for the FISH analysis described in this report, we performed control experiments using a using a 10 fold molar excess of unlabeled probe and checked for loss of specific fluorescence signal. We also co-incubated sections with the EUB338 probe to determine whether the signal produced by the K. pneumoniae and P. mirabilis oligonucleotides co-localized with the signal from the universal bacterial probe.

Cross-Fostering

On the day of birth, the mother was removed from the birthing cage and placed in a clean cage. A litter of pups with the designated genotype was then transferred into the cage. Pups were weaned on postnatal day 21 (Garrett et al., 2007).

Dextran sulfate sodium treatment

Dextran sulfate sodium (M.W. 40-50,000; USB Cat# 14489) was dissolved in drinking water at a final concentration of 4% (w/v) and provided for 7d.

Gnotobiotic mouse experiments

All protocols related to the generation and husbandry of germ-free mice were approved by the Washington University Animal Studies Committee. Conventionally-raised, specified pathogen free T-bet^−/− × Rag2^−/− mice were re-derived as germ-free in the gnotobiotic facility at Washington University. At 6 weeks of age, germ-free mice were transported in a germ-free state using a specialized shipping apparatus (Taconic Laboratories), to the Harvard Digestive Disease Center (HDDC) gnotobiotic mouse facility. After transfer to flexible film gnotobiotic isolators, mice were monitored for one week and their germ-free status confirmed by culture and qPCR of fecal bacterial cDNA (16S rRNA primer set (FOR: 5′ TCCTACGGGAGGCAGCAGT and REV: 5′ GGACTACCAGGGTATCTAATCCTGTT) (Nadkarni et al., 2002). One cohort of five mice was maintained germ-free. Another cohort of five mice (3 female and 2 male) was co-colonized by introducing 4.8 ×10⁸ cfu of Klebsiella pneumoniae and 9.2 ×10⁸ cfu of Proteus mirabilis into their oral cavity and by simultaneously spreading an equivalent amount of organisms on their fur and anus. All animals were maintained on the Rodent NIH-31 Modified Auto diet (Ziegler Brothers, Inc). Fecal samples were collected to define levels of colonization of these organisms 48h after inoculation, and weekly thereafter for 8 weeks.

Invasion experiments

2×10⁷ cfu of Klebsiella pneumoniae, Proteus mirabilis, E. coli, or both Klebsiella pneumoniae and Proteus mirabilis (all isolated from the TRUC mother in Fig. 1) were gently instilled into the oral cavity of each mouse using a sterile pipette tip, and 1×10⁷ cfu was placed into a new container of their drinking water every other day.

anti-TNF-α treatment

anti-TNF-α (clone TN3-19.12), a hamster anti-mouse TNF-α neutralizing IgG1 antibody and control Ab (hamster anti-GST IgG1) were purchased from Leinco Technologies. Mice were injected with these reagents (15mg/kg) on a weekly basis for four weeks (Garrett et al., 2007).

Adoptive Transfer of T-regulatory cells

Peripheral lymph nodes were harvested and cell suspensions were generated as previously described (Garrett et al., 2007). Fluorescence activated cell sorted CD4⁺ CD62L^hi CD25⁺ cells were collected and resuspended in PBS. 75,000 cells were injected per mouse. An equivalent amount of PBS was injected in the control group. 10 mice were injected with T-regulatory cells and nine mice with PBS. All mice were 4 weeks of age at the time of injection. This experiment was stopped when the mice were 12 weeks old (as opposed to 14 weeks of age in the TNF-α blockade experiment), because two mice in the control group became quite moribund from their colitis, and euthanasia was indicated as per our animal protocol.

Co-culturing bone marrow-derived dendritic cells and bacterial strains

Generation of mouse bone marrow-derived dendritic cells was performed as previously described (Garrett et al., 2007). DCs were purified using MACS bead positive selection with anti-mouse CD11c coupled magnetic beads. K. pneumoniae or P. mirabilis were co-cultured with the DCs at a ratio of 1 CFU per dendritic cell for 4h at 37°C in a cell culture incubator with an atmosphere of 5% CO₂. Gentamicin (50 μg/ml) was then added to the culture medium for 1 h, cells were collected and washed extensively, and then incubated in the presence of medium containing gentamicin (20 μg /ml) for an additional 16 h. Bacteria were also heat-killed (incubation at 100°C for 3 min followed by plating to confirm killing) and added to cultures of DCs at ratios of 1:1, 10:1. 100:1. Cells were co-cultured for 20 h. Supernatants were collected from the live and heat killed co-cultures, centrifuged to pellet cells, and TNF-α levels in the resulting supernatants were determined using the mouse OptEIA ELISA kit (BD Biosciences) according to the manufacturer's instructions. TNF-α levels are expressed as ng/ml/1×10⁶ DCs

TNF-α bacterial co-culture

TNF-α (final concentration 100μg/mL culture medium), or PBS alone, was added to cultures of the designated microbes and bacterial concentrations (cfu/ml) were followed during a 6h incubation (37°C with agitation in ambient air) at 2h intervals. Bacteria were cultured in Luria Broth and plated on MacConkey's medium.

Cytokine assays in milk

Lactating mice were injected with 2U oxytocin (Sigma-Aldrich) i.p. and milk was collected using a suction-powered milking apparatus (Wilson and Butcher, 2004). Milk was then centrifuged (14,000 × g for 5 min) at room temperature, fat was discarded, and the remaining material was stored at −20°C until use (Wilson and Butcher, 2004).

Cytokines were measured in defatted fractions using SearchLight high dynamic range imaging and analysis service unless otherwise indicated. For TNF-α, the mouse OptEIA ELISA kit (BD Biosciences) was used according to the manufacturer's instructions. Low levels of TNF-α (10pg/ml) were detected in the milk of TRUC but not in Rag2^−/− mice (Fig. S5); these low levels in TRUC animals are likely attributable TNF-α sequestration by TNF-R, as milk is known to contain high levels of TNF-R1 and TNF-R2 (Buescher and Malinowska, 1996).

We thank Jonathan Braun (UCLA), David Relman (Stanford University), Alexander Swidsinski (Charite Humboldt University), Gunnar Hansson (University of Gothenburg) and members of the Gordon and Glimcher labs for helpful discussions. We thank Jacobo Ramirez and Diana Pascual for their care of our specified pathogen free colony and Sabrina Wagoner, Vladimir Yesliseyev and Clara Belzer for their technical assistance and care of germ-free TRUC mice. This work was supported by from the NIH (CA112663 to LHG), Danone Research (LHG), and the Crohn's and Colitis Foundation of America (JIG), plus career development awards from the Burroughs Wellcome Fund and the NIH (K08AI078942) to WSG. The HDDC germ-free core is supported by P30-DK03485. 454 pyrosequencing reads have been deposited in the NCBI Short Read Archive.

LHG declares that she is a member of the Board of Directors of the Bristol Myers Squibb Corporation (BMSC) and holds equity in BMSC.